USF1

This gene encodes a member of the basic helix-loop-helix leucine zipper family, and can function as a cellular transcription factor. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs. This gene has been linked to familial combined hyperlipidemia (FCHL). Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been defined on chromosome 21. RefSeq, Feb 2013
Upstream stimulatory factor 1 is a protein that in humans is encoded by the USF1 gene.wikipedia

USF1

PDB image
PDB 1AN4

PDB 1AN4
ENCODE experiments
Ensemble search
Entrez 7391
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia USF1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

C2C12 - Wold - ENCSR000AIQ

loading

CH12.LX - Snyder - ENCSR973SOG

loading

MEL cell line - Snyder - ENCSR705HGT

loading

myocyte - Wold - ENCSR000AIE

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

C2C12 - Wold - ENCSR000AIQ

1.
497 / 500
6.5e-994
GGTCACGTGACC
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 7.55
2.
23 / 500
2.7e-34
CGCAGAGCATCCTGGGAAATGTAGT
small heat map img p-value: 0.99
pct_center: 0.12
pct_ratio: 0.56
3.
77 / 500
4.8e-33
GTCACGTG
small heat map img p-value: 0.00
pct_center: 0.70
pct_ratio: 6.90
4.
44 / 500
1.3e-14
GGGGCGGGGCT
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 0.64
5.
51 / 500
0.000067
AAGGGGAAGGGGAAG
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 0.46
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

CH12.LX - Snyder - ENCSR973SOG

1.
498 / 500
2.7e-1088
GGGTCACGTGACC
small heat map img p-value: 0.00
pct_center: 0.79
pct_ratio: 7.12
2.
151 / 500
4.5e-72
GGGGGCGGGGC
small heat map img p-value: 0.00
pct_center: 0.38
pct_ratio: 0.71
3.
20 / 500
2.3e-44
CTCGCAGGGCATGCTGGGAATTGTAGTT
small heat map img p-value: 0.76
pct_center: 0.13
pct_ratio: 0.66
4.
89 / 500
7.3e-44
CTCTGATTGGCTG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 1.30
5.
85 / 500
2.2e-41
GTCACGTG
small heat map img p-value: 0.00
pct_center: 0.69
pct_ratio: 7.12
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Snyder - ENCSR705HGT

1.
500 / 500
7.8e-1053
GGTCACGTGACC
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 7.10
2.
24 / 500
3.2e-56
CTCGCAGGGCATGCTGGGAATTGTAGTTC
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.74
3.
143 / 500
5.1e-53
GGGGGCGGGGC
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 0.74
4.
97 / 500
1.9e-51
GTCACGTG
small heat map img p-value: 0.00
pct_center: 0.57
pct_ratio: 6.75
5.
95 / 500
4.1e-48
CAGCCAATCGGAG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 1.22
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

myocyte - Wold - ENCSR000AIE

1.
498 / 500
6.8e-976
GGTCACGTGACC
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 7.31
2.
25 / 500
3.3e-47
GCGCAGGGCATGCTGGGAAATGTAGTTC
small heat map img p-value: 0.11
pct_center: 0.13
pct_ratio: 0.60
3.
92 / 500
5.9e-33
GGTCACGTGAC
small heat map img p-value: 0.00
pct_center: 0.69
pct_ratio: 5.11
4.
26 / 500
1.7e-15
GGCGCCGCCATGTTG
small heat map img p-value: 0.14
pct_center: 0.08
pct_ratio: 0.69
5.
86 / 500
1.5e-14
CCGATTGGCTG
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.99
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at USF1 peaks

C2C12 - Wold - ENCSR000AIQ

C2C12
Wold
USF1
ENCSR000AIQ
r=1.00

small heat map img

C2C12
Wold
H3ac
ENCSR000AHP
r=0.26

small heat map img

C2C12
Wold
H3K4me3
ENCSR000AHO
r=0.21

small heat map img

C2C12
Wold
H3K79me2
ENCSR000AHQ
r=0.02

small heat map img

C2C12
Wold
H3K79me3
ENCSR000AHW
r=0.01

small heat map img

C2C12
Wold
H3K27me3
ENCSR000AHR
r=-0.03

small heat map img

C2C12
Wold
H3K36me3
ENCSR000AHL
r=-0.05

small heat map img
8,476 peaks (download )

myocyte - Wold - ENCSR000AIE

myocyte
Wold
USF1
ENCSR000AIE
r=1.00

small heat map img

myocyte
Wold
H3K4me2
ENCSR000AHS
r=0.29

small heat map img

myocyte
Wold
H3K4me3
ENCSR000AHT
r=0.25

small heat map img

myocyte
Wold
H3ac
ENCSR000AHU
r=0.21

small heat map img

myocyte
Wold
H3K27me3
ENCSR000AHM
r=0.00

small heat map img

myocyte
Wold
H3K79me2
ENCSR000AHN
r=-0.00

small heat map img

myocyte
Wold
H3K36me3
ENCSR000AHV
r=-0.06

small heat map img
6,640 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at USF1 peaks

C2C12 - Wold - ENCSR000AIQ

C2C12
Wold
USF1
ENCSR000AIQ
r=1.00

small heat map img

C2C12
Wold
MAX
ENCSR000AIO
r=0.47

small heat map img

C2C12
Wold
MYOD1
ENCSR000AIG
r=0.25

small heat map img

C2C12
Wold
FOSL1
ENCSR000AIK
r=0.21

small heat map img

C2C12
Wold
CEBPB
ENCSR000AIV
r=0.21

small heat map img

C2C12
Wold
CTCF
ENCSR000AIJ
r=0.13

small heat map img

C2C12
Wold
MYOG
ENCSR000AIF
r=0.08

small heat map img
8,476 peaks (download )

myocyte - Wold - ENCSR000AIE

myocyte
Wold
USF1
ENCSR000AIE
r=1.00

small heat map img

myocyte
Wold
MAX
ENCSR000AIL
r=0.40

small heat map img

myocyte
Wold
SRF
ENCSR000AIM
r=0.26

small heat map img

myocyte
Wold
MYOG
ENCSR000AIC
r=0.24

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIH
r=0.24

small heat map img

myocyte
Wold
TCF12
ENCSR000AIN
r=0.24

small heat map img

myocyte
Wold
POLR2A
ENCSR000AIX
r=0.23

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIR
r=0.22

small heat map img

myocyte
Wold
TCF3
ENCSR000AIP
r=0.22

small heat map img

myocyte
Wold
E2F4
ENCSR000AII
r=0.21

small heat map img

myocyte
Wold
MYOG
ENCSR000AID
r=0.19

small heat map img

myocyte
Wold
MYOG
ENCSR000AIW
r=0.18

small heat map img

myocyte
Wold
CEBPB
ENCSR000AIB
r=0.18

small heat map img

myocyte
Wold
REST
ENCSR000AIS
r=0.17

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIT
r=0.11

small heat map img
6,640 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help