TCF12

The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. RefSeq, Jul 2008
Transcription factor 12 is a protein that in humans is encoded by the TCF12 gene. The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins.wikipedia

TCF12

PDB image
PDB 2KNH

PDB 2KNH 4JOL
ENCODE experiments
Ensemble search
Entrez 6938
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia TCF12

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

CH12.LX - Snyder - ENCSR906QEK

loading

MEL cell line - Snyder - ENCSR349JDH

loading

myocyte - Wold - ENCSR000AIN

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

CH12.LX - Snyder - ENCSR906QEK

1.
314 / 500
8.4e-198
GCAGGTGT
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 1.08
2.
143 / 500
1.9e-100
AAAGAGGAAGTGAAA
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.59
3.
125 / 500
1.2e-19
AGTGACTCAGA
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.81
4.
6 / 500
9.2e-16
GGGCTTTCTTGTAAAGCTTGTTTTGCTGG
small heat map img p-value: 0.00
pct_center: 0.08
pct_ratio: 0.45
5.
110 / 500
3.3e-10
TGTGGTTT
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.80
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Snyder - ENCSR349JDH

1.
483 / 500
2.3e-482
GAAATCTGGGGGGGACAGATAAGA
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 3.92
2.
313 / 500
4.2e-72
AGATAA
small heat map img p-value: 0.00
pct_center:
pct_ratio:
3.
15 / 500
0.054
GGAGGAGGGGGGTGGGGGGGAGGGGGAG
small heat map img p-value: 0.31
pct_center: 0.38
pct_ratio: 0.57
4.
32 / 500
12
GAGACAGGAAG
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.58
5.
48 / 500
1.5e+3
GACTGCAGGCAGCTG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.61
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

myocyte - Wold - ENCSR000AIN

1.
493 / 500
5.5e-732
GACAGCTGCAG
small heat map img p-value: 0.00
pct_center: 0.76
pct_ratio: 2.24
2.
382 / 500
4.1e-233
AACAGCTG
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 2.24
3.
72 / 500
1.6e-20
TGTGGGTGGGG
small heat map img p-value: 0.08
pct_center: 0.38
pct_ratio: 0.57
4.
38 / 500
0.14
TGTGGTCA
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.79
5.
13 / 500
8.0e+2
TGCGGTGAGTCACAG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.80
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at TCF12 peaks

myocyte - Wold - ENCSR000AIN

myocyte
Wold
TCF12
ENCSR000AIN
r=1.00

small heat map img

myocyte
Wold
H3K4me2
ENCSR000AHS
r=0.27

small heat map img

myocyte
Wold
H3ac
ENCSR000AHU
r=0.10

small heat map img

myocyte
Wold
H3K4me3
ENCSR000AHT
r=0.09

small heat map img

myocyte
Wold
H3K27me3
ENCSR000AHM
r=-0.01

small heat map img

myocyte
Wold
H3K79me2
ENCSR000AHN
r=-0.01

small heat map img

myocyte
Wold
H3K36me3
ENCSR000AHV
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 16,467 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at TCF12 peaks

myocyte - Wold - ENCSR000AIN

myocyte
Wold
TCF12
ENCSR000AIN
r=1.00

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIR
r=0.75

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIH
r=0.75

small heat map img

myocyte
Wold
MYOG
ENCSR000AIW
r=0.71

small heat map img

myocyte
Wold
MYOG
ENCSR000AIC
r=0.70

small heat map img

myocyte
Wold
TCF3
ENCSR000AIP
r=0.70

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIT
r=0.64

small heat map img

myocyte
Wold
MYOG
ENCSR000AID
r=0.57

small heat map img

myocyte
Wold
MAX
ENCSR000AIL
r=0.34

small heat map img

myocyte
Wold
SRF
ENCSR000AIM
r=0.33

small heat map img

myocyte
Wold
CEBPB
ENCSR000AIB
r=0.29

small heat map img

myocyte
Wold
USF1
ENCSR000AIE
r=0.28

small heat map img

myocyte
Wold
E2F4
ENCSR000AII
r=0.22

small heat map img

myocyte
Wold
POLR2A
ENCSR000AIX
r=0.22

small heat map img

myocyte
Wold
REST
ENCSR000AIS
r=0.18

small heat map img
10,000 randomly-selected peaks from a total of 16,467 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help