TAL1

T-cell acute lymphocytic leukemia protein 1 is a protein that in humans is encoded by the TAL1 gene. The protein encoded by TAL1 is a basic helix-loop-helix transcription factor.wikipedia

TAL1

PDB image
PDB 2YPA

PDB 2YPA 2YPB
ENCODE experiments
Ensemble search
Entrez 6886
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia TAL1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

erythroblast - Hardison - ENCSR000DIB

loading

G1E - Hardison - ENCSR000DIN

loading

G1E-ER4 - Hardison - ENCSR000DIM

loading

megakaryocyte - Hardison - ENCSR000DHE

loading

MEL cell line - Hardison - ENCSR000DIA

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

G1E - Hardison - ENCSR000DIN

1.
229 / 500
5.5e-115
AGAGATAAGAA
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 2.45
2.
37 / 500
5.4e-35
GTGTTTGTTTGTTTGTGTGTT
small heat map img p-value: 0.61
pct_center: 0.25
pct_ratio: 0.37
3.
6 / 500
1.5e-26
TAACAGAAAGGAGATTCCGGCCAGATGGTG
small heat map img p-value: 0.09
pct_center: 0.09
pct_ratio: 0.57
4.
91 / 500
1.7e-18
GGGAAGGAGGAAGAG
small heat map img p-value: 0.93
pct_center: 0.36
pct_ratio: 0.48
5.
5 / 500
3.0e-8
ATGTATATGACTTTACTCGGCGCCAAGGGG
small heat map img p-value: 0.85
pct_center: 0.05
pct_ratio: 0.50
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

G1E-ER4 - Hardison - ENCSR000DIM

1.
168 / 500
1.7e-122
AAGGCTGGGGGATGGAGATAAGAG
small heat map img p-value: 0.00
pct_center: 0.57
pct_ratio: 2.90
2.
7 / 500
1.4e-23
AAACAAAAACAAGATAGCAACAGAGAAAAA
small heat map img p-value: 0.74
pct_center: 0.19
pct_ratio: 0.29
3.
81 / 500
1.2e-15
GGAGACAGGGTGTGTCTGTGT
small heat map img p-value: 1.00
pct_center: 0.35
pct_ratio: 0.53
4.
100 / 500
5.4e-8
AGAAGAAGGCAGAG
small heat map img p-value: 0.29
pct_center: 0.38
pct_ratio: 0.50
5.
10 / 500
0.00016
GGCTTGGCTGGTTGT
small heat map img p-value: 0.54
pct_center: 0.14
pct_ratio: 0.79
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Hardison - ENCSR000DIA

1.
233 / 500
2.5e-81
AGATAAGA
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 2.36
2.
84 / 500
7.2e-16
AGAGGAAG
small heat map img p-value: 0.00
pct_center: 0.37
pct_ratio: 0.65
3.
13 / 500
2.2e-13
CCAGGGAGAAATCTGCAGGA
small heat map img p-value: 0.07
pct_center: 0.15
pct_ratio: 0.59
4.
5 / 500
2.6e-12
TATTATCAGGGAGGAGCAGCAGCTGAGCTA
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.72
5.
9 / 500
2.4e-7
TAATCCTAGCACCCAGGAGGCAGAGGCA
small heat map img p-value: 0.70
pct_center: 0.15
pct_ratio: 0.41
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

erythroblast - Hardison - ENCSR000DIB

1.
223 / 500
2.0e-123
AGATAAGG
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 2.74
2.
95 / 500
3.8e-40
TGTGTGTGTGTGTGT
small heat map img p-value: 0.71
pct_center: 0.26
pct_ratio: 0.51
3.
26 / 500
5.3e-28
ATGTGTGTGTGTGTATATGTGCATGTGTG
small heat map img p-value: 0.81
pct_center: 0.21
pct_ratio: 0.47
4.
114 / 500
2.8e-17
TGGGAGGAGGAGGAAGGGACTGGGAGGAG
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 0.53
5.
171 / 500
3.9e-11
CAGTGAGCAGA
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 0.69
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

megakaryocyte - Hardison - ENCSR000DHE

1.
344 / 500
1.3e-184
ACAGGAAGCAG
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 0.74
2.
168 / 500
2.5e-171
GCTGGTGAGAACAGATAAG
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 1.29
3.
8 / 500
8.9e-32
TGGAATGGAATGGAATGGAATGGAATGGAA
small heat map img p-value: 0.62
pct_center: 0.11
pct_ratio: 0.50
4.
124 / 500
1.3e-28
AGACACAGCTG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.66
5.
6 / 500
2.6e-20
GGAATGGAATGGAATGGAATGGAATGGAAT
small heat map img p-value: 0.56
pct_center: 0.11
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at TAL1 peaks

G1E - Hardison - ENCSR000DIN

G1E
Hardison
TAL1
ENCSR000DIN
r=1.00

small heat map img

G1E
Hardison
H3K4me1
ENCSR000DJB
r=0.27

small heat map img

G1E
Hardison
H3K4me3
ENCSR000DIX
r=0.18

small heat map img

G1E
Hardison
H3K9me3
ENCSR000DHM
r=-0.03

small heat map img

G1E
Hardison
H3K36me3
ENCSR000DHV
r=-0.08

small heat map img

G1E
Hardison
H3K27me3
ENCSR000DHX
r=-0.10

small heat map img
5,705 peaks (download )

G1E-ER4 - Hardison - ENCSR000DIM

G1E-ER4
Hardison
TAL1
ENCSR000DIM
r=1.00

small heat map img

G1E-ER4
Hardison
H3K4me1
ENCSR000DIY
r=0.26

small heat map img

G1E-ER4
Hardison
H3K4me3
ENCSR000DIW
r=0.19

small heat map img

G1E-ER4
Hardison
H3K9me3
ENCSR000DHJ
r=-0.04

small heat map img

G1E-ER4
Hardison
H3K36me3
ENCSR000DHS
r=-0.05

small heat map img

G1E-ER4
Hardison
H3K27me3
ENCSR000DIZ
r=-0.10

small heat map img
1,756 peaks (download )

MEL cell line - Hardison - ENCSR000DIA

MEL cell line
Hardison
TAL1
ENCSR000DIA
r=1.00

small heat map img

MEL cell line
Hardison
H3K4me1
ENCSR000ADY
r=0.38

small heat map img

MEL cell line
Hardison
H3K36me3
ENCSR000CES
r=0.36

small heat map img

MEL cell line
Hardison
H3K4me1
ENCSR000ADQ
r=0.36

small heat map img

MEL cell line
Hardison
H3K4me1
ENCSR000CEW
r=0.35

small heat map img

MEL cell line
Hardison
H3K27ac
ENCSR000CEV
r=0.33

small heat map img

MEL cell line
Hardison
H3K4me3
ENCSR000AEA
r=0.24

small heat map img

MEL cell line
Hardison
H3K4me3
ENCSR000ADR
r=0.20

small heat map img

MEL cell line
Hardison
H3K9ac
ENCSR000CEU
r=0.19

small heat map img

MEL cell line
Hardison
H3K9me3
ENCSR000AEB
r=0.14

small heat map img

MEL cell line
Hardison
H3K4me3
ENCSR000CEX
r=0.14

small heat map img

MEL cell line
Hardison
H3K9me3
ENCSR000ADT
r=0.12

small heat map img

MEL cell line
Hardison
H3K27me3
ENCSR000ADW
r=0.12

small heat map img

MEL cell line
Hardison
H3K36me3
ENCSR000ADX
r=0.07

small heat map img

MEL cell line
Hardison
H3K79me2
ENCSR000CET
r=0.07

small heat map img

MEL cell line
Hardison
H3K27me3
ENCSR000ADP
r=0.07

small heat map img

MEL cell line
Hardison
H3K27me3
ENCSR000CER
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 0 (download )

erythroblast - Hardison - ENCSR000DIB

erythroblast
Hardison
TAL1
ENCSR000DIB
r=1.00

small heat map img

erythroblast
Hardison
H3K4me3
ENCSR000DHG
r=0.03

small heat map img

erythroblast
Hardison
H3K9me3
ENCSR000DHN
r=0.01

small heat map img

erythroblast
Hardison
H3K36me3
ENCSR000DHL
r=0.00

small heat map img
3,917 peaks (download )

megakaryocyte - Hardison - ENCSR000DHE

megakaryocyte
Hardison
TAL1
ENCSR000DHE
r=1.00

small heat map img
6,232 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at TAL1 peaks

G1E - Hardison - ENCSR000DIN

G1E
Hardison
TAL1
ENCSR000DIN
r=1.00

small heat map img

G1E
Hardison
GATA2
ENCSR000DIE
r=0.27

small heat map img

G1E
Hardison
CTCF
ENCSR000DIS
r=0.05

small heat map img

G1E
Hardison
GATA1
ENCSR000DIC
r=0.03

small heat map img
5,705 peaks (download )

G1E-ER4 - Hardison - ENCSR000DIM

G1E-ER4
Hardison
TAL1
ENCSR000DIM
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.81

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.79

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.78

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.72

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.72

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.69

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.68

small heat map img

G1E-ER4
Hardison
CTCF
ENCSR000DIR
r=0.13

small heat map img

G1E-ER4
Hardison
GATA2
ENCSR000DID
r=0.07

small heat map img
1,756 peaks (download )

MEL cell line - Hardison - ENCSR000DIA

MEL cell line
Hardison
TAL1
ENCSR000DIA
r=1.00

small heat map img

MEL cell line
Hardison
GATA1
ENCSR000ETA
r=0.79

small heat map img

MEL cell line
Hardison
EP300
ENCSR000ETP
r=0.79

small heat map img

MEL cell line
Hardison
EP300
ENCSR000ETV
r=0.78

small heat map img

MEL cell line
Hardison
GATA1
ENCSR000EUG
r=0.78

small heat map img

MEL cell line
Hardison
RCOR1
ENCSR000ESI
r=0.72

small heat map img

MEL cell line
Hardison
ETS1
ENCSR000ETB
r=0.70

small heat map img

MEL cell line
Hardison
MAFK
ENCSR000ETK
r=0.66

small heat map img

MEL cell line
Hardison
CHD2
ENCSR000ETO
r=0.63

small heat map img

MEL cell line
Hardison
MYB
ENCSR000ETR
r=0.63

small heat map img

MEL cell line
Hardison
BHLHE40
ENCSR000ESH
r=0.62

small heat map img

MEL cell line
Hardison
SIN3A
ENCSR000ETC
r=0.61

small heat map img

MEL cell line
Hardison
JUND
ENCSR000ETZ
r=0.60

small heat map img

MEL cell line
Hardison
MYC
ENCSR000EUA
r=0.59

small heat map img

MEL cell line
Hardison
KAT2A
ENCSR000ESM
r=0.59

small heat map img

MEL cell line
Hardison
MAZ
ENCSR000ESL
r=0.58

small heat map img

MEL cell line
Hardison
MAX
ENCSR000ETX
r=0.57

small heat map img

MEL cell line
Hardison
MXI1
ENCSR000ETN
r=0.55

small heat map img

MEL cell line
Hardison
E2F4
ENCSR000ETY
r=0.51

small heat map img

MEL cell line
Hardison
ZC3H11A
ENCSR000ESF
r=0.51

small heat map img

MEL cell line
Hardison
SMC3
ENCSR000ETL
r=0.51

small heat map img

MEL cell line
Hardison
ZMIZ1
ENCSR000ESE
r=0.51

small heat map img

MEL cell line
Hardison
MAFK
ENCSR000ESY
r=0.50

small heat map img

MEL cell line
Hardison
GABPA
ENCSR000ESK
r=0.50

small heat map img

MEL cell line
Hardison
ZKSCAN1
ENCSR000ESX
r=0.50

small heat map img

MEL cell line
Hardison
TBP
ENCSR000EUB
r=0.46

small heat map img

MEL cell line
Hardison
RAD21
ENCSR000ETT
r=0.44

small heat map img

MEL cell line
Hardison
NELFE
ENCSR000ETU
r=0.44

small heat map img

MEL cell line
Hardison
HCFC1
ENCSR000ESG
r=0.41

small heat map img

MEL cell line
Hardison
ZNF384
ENCSR000ESD
r=0.39

small heat map img

MEL cell line
Hardison
USF2
ENCSR000ETF
r=0.39

small heat map img

MEL cell line
Hardison
UBTF
ENCSR000ESJ
r=0.37

small heat map img

MEL cell line
Hardison
RAD21
ENCSR000ETS
r=0.36

small heat map img

MEL cell line
Hardison
POLR2A
ENCSR000ETG
r=0.36

small heat map img

MEL cell line
Hardison
CHD1
ENCSR000ESN
r=0.35

small heat map img

MEL cell line
Hardison
POLR2A
ENCSR000EUC
r=0.27

small heat map img

MEL cell line
Hardison
POLR2A
ENCSR000CFI
r=0.22

small heat map img

MEL cell line
Hardison
CTCF
ENCSR000ETE
r=0.21

small heat map img

MEL cell line
Hardison
CTCF
ENCSR000ETQ
r=0.18

small heat map img

MEL cell line
Hardison
USF2
ENCSR000ETW
r=0.14

small heat map img

MEL cell line
Hardison
CTCF
ENCSR000CFH
r=0.11

small heat map img

MEL cell line
Hardison
CTCF
ENCSR000DIP
r=0.04

small heat map img
10,000 randomly-selected peaks from a total of 0 (download )

erythroblast - Hardison - ENCSR000DIB

erythroblast
Hardison
TAL1
ENCSR000DIB
r=1.00

small heat map img

erythroblast
Hardison
GATA1
ENCSR000DIL
r=0.83

small heat map img
3,917 peaks (download )

megakaryocyte - Hardison - ENCSR000DHE

megakaryocyte
Hardison
TAL1
ENCSR000DHE
r=1.00

small heat map img

megakaryocyte
Hardison
GATA1
ENCSR000DIJ
r=0.63

small heat map img

megakaryocyte
Hardison
FLI1
ENCSR000DHD
r=0.34

small heat map img
6,232 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help