POLR2A

This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. RefSeq, Jul 2008
DNA-directed RNA polymerase II subunit RPB1, also known as RPB1, is an enzyme that in humans is encoded by the POLR2A gene.wikipedia

POLR2A

PDB image
PDB 2GHQ

PDB 2GHQ 2GHT 2LTO 3D9K 3D9L 3D9M 3D9N 3D9O 3D9P 4JXT
ENCODE experiments
Ensemble search
Entrez 5430
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia POLR2A

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

bone marrow - Ren - ENCSR000CBM

loading

bone marrow macrophage - Ren - ENCSR000CFK

loading

brain - Ren - ENCSR000CEI

loading

cerebellum - Ren - ENCSR000CBQ

loading

CH12.LX - Snyder - ENCSR000ERQ

loading

cortical plate - Ren - ENCSR000CBP

loading

embryonic fibroblast - Ren - ENCSR000CBX

loading

ES-Bruce4 - Ren - ENCSR000CCC

loading

heart - Ren - ENCSR000CBS

loading

kidney - Ren - ENCSR000CBK

loading

limb - Ren - ENCSR000CEC

loading

liver - Ren - ENCSR000CBR

loading

lung - Ren - ENCSR000CBT

loading

MEL cell line - Ren - ENCSR000CFI

loading

MEL cell line - Snyder - ENCSR000ETG

loading

MEL cell line - Snyder - ENCSR000EUC

loading

myocyte - Wold - ENCSR000AIX

loading

olfactory bulb - Ren - ENCSR000CDY

loading

small intestine - Ren - ENCSR000CEE

loading

spleen - Ren - ENCSR000CBZ

loading

testis - Ren - ENCSR000CEG

loading

thymus - Ren - ENCSR000CEA

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

CH12.LX - Snyder - ENCSR000ERQ

1.
15 / 500
1.5e-59
ACCATGTCTGGACGTGGCAAGGGCGGAAA
small heat map img p-value: 0.85
pct_center: 0.13
pct_ratio: 0.55
2.
8 / 500
3.3e-39
GGAGCCCTTCTTCGGGGCGGGAGCGGACTT
small heat map img p-value: 0.27
pct_center: 0.14
pct_ratio: 0.65
3.
66 / 500
3.1e-30
AAAGAAGGCAGAAAGCGAAA
small heat map img p-value: 0.17
pct_center: 0.27
pct_ratio: 0.46
4.
5 / 500
3.5e-14
CCCTGGATGTTGTCGCGCAGCACTTTGCGG
small heat map img p-value: 0.91
pct_center: 0.10
pct_ratio: 0.64
5.
50 / 500
2.8e-23
GGCGGCGGCGGCGGCGGAGGC
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 0.67
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

ES-Bruce4 - Ren - ENCSR000CCC

1.
17 / 500
1.4e-95
GAACACTGAAAAACGTGGAAAATGAGAAAT
small heat map img p-value: 0.03
pct_center: 0.07
pct_ratio: 0.28
2.
12 / 500
1.8e-54
ACACACTTTAGGACCTGAAATATGGCGAG
small heat map img p-value: 0.06
pct_center: 0.03
pct_ratio: 0.36
3.
16 / 500
5.5e-30
ACTGTAGGACATGGAATATGG
small heat map img p-value: 0.07
pct_center: 0.04
pct_ratio: 0.40
4.
41 / 500
1.1e-9
AAGATGGCGGC
small heat map img p-value: 0.91
pct_center: 0.16
pct_ratio: 0.74
5.
45 / 500
2.1e-11
GGGAGGGGAGAGCGGAGGGGAGGGGAGAG
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 0.63
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Ren - ENCSR000CFI

1.
103 / 500
6.1e-41
GGAGGCGGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.71
pct_ratio: 0.64
2.
32 / 500
0.000078
TTTATGTTTGTTTTT
small heat map img p-value: 0.92
pct_center: 0.08
pct_ratio: 0.23
3.
13 / 500
0.11
GAAAAGGTGGAAAGGGTCTGGGTAAGGTTG
small heat map img p-value: 0.40
pct_center: 0.06
pct_ratio: 0.44
4.
8 / 500
3.4e+2
AGGATTAAACTACA
small heat map img p-value: 0.25
pct_center: 0.03
pct_ratio: 0.26
5.
8 / 500
6.8e+2
AGGGCAGGCTTGGTAATTGGCTGCATGTA
small heat map img p-value: 0.13
pct_center: 0.11
pct_ratio: 0.53
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Snyder - ENCSR000EUC

1.
109 / 500
8.3e-47
GCGGGGAGGGAGGAAAGGGAGGGGGGAAAG
small heat map img p-value: 0.00
pct_center: 0.50
pct_ratio: 0.96
2.
6 / 500
2.7e-35
ACTTGCGAGCGGTCTGCTTAGTACGAGCCA
small heat map img p-value: 0.14
pct_center: 0.07
pct_ratio: 0.55
3.
6 / 500
9.9e-27
CCTTCTTGGAGCCCTTCTTCGGGGCAGGAG
small heat map img p-value: 0.01
pct_center: 0.15
pct_ratio: 0.59
4.
8 / 500
1.6e-33
TCGCGCAGAACTTTGCGGTGGCGCTTAGC
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.68
5.
51 / 500
5.5e-11
CGTGTTGGTGAGTGT
small heat map img p-value: 0.85
pct_center: 0.16
pct_ratio: 0.51
MEME output

MEL cell line - Snyder - ENCSR000ETG

1.
83 / 500
2.2e-38
CGGGGGCGGCGGCGGGAGCAGCGCGGGGG
small heat map img p-value: 0.00
pct_center: 0.72
pct_ratio: 0.61
2.
71 / 500
1.7e-25
TGAAAAGAAGAAGAAAGAGAG
small heat map img p-value: 0.62
pct_center: 0.25
pct_ratio: 0.43
3.
29 / 500
0.18
TGTGTGTGTGTGTGT
small heat map img p-value: 0.81
pct_center: 0.11
pct_ratio: 0.41
4.
6 / 500
2.1
TGAGAGGTCAAGGCCAGTCTGGTCTACA
small heat map img p-value: 0.97
pct_center: 0.11
pct_ratio: 0.36
5.
12 / 500
31
AAATTTGTATCTCTGAGACAAGAATGAAAC
small heat map img p-value: 0.75
pct_center: 0.03
pct_ratio: 0.25
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

bone marrow - Ren - ENCSR000CBM

1.
35 / 500
5.2e-16
GGGCAAGATGGCGGC
small heat map img p-value: 0.59
pct_center: 0.26
pct_ratio: 0.66
2.
117 / 500
1.6e-27
GGCGGAGGCAGCAGCGGAGGC
small heat map img p-value: 0.00
pct_center: 0.63
pct_ratio: 0.60
3.
37 / 500
3.8e-7
GCGCATGCGCA
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.86
4.
9 / 500
0.12
GCTCAAGCGGCAGGGGCGCACTCTCTACG
small heat map img p-value: 0.49
pct_center: 0.28
pct_ratio: 0.69
5.
11 / 500
17
TAGGTTTAAAAAATATTGGT
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.16
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

bone marrow macrophage - Ren - ENCSR000CFK

1.
58 / 500
2.7e-10
GGCAGAGGAAGAGGGAAAGCA
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 0.53
2.
90 / 500
0.00031
AGCAGCAG
small heat map img p-value: 1.00
pct_center: 0.27
pct_ratio: 0.59
3.
36 / 500
0.21
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.66
4.
24 / 500
2.4e+2
AGTGTGTTGTTGGTT
small heat map img p-value: 0.11
pct_center: 0.05
pct_ratio: 0.36
5.
58 / 500
4.7e+2
GGCGGCGGCGGCAGC
small heat map img p-value: 0.32
pct_center: 0.36
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

brain - Ren - ENCSR000CEI

1.
145 / 500
1.4e-73
GCGGCGGCGGCGGCGGCGGCG
small heat map img p-value:
pct_center:
pct_ratio:
2.
27 / 500
1.8e-12
AAGATGGCGGC
small heat map img p-value:
pct_center:
pct_ratio:
3.
35 / 500
0.0000022
AGAGAGAGAGGGAGCCAGC
small heat map img p-value:
pct_center:
pct_ratio:
4.
15 / 500
0.39
TTTAAAAG
small heat map img p-value:
pct_center:
pct_ratio:
5.
25 / 500
2.3
CGCGACGAGGAGGAG
small heat map img p-value:
pct_center:
pct_ratio:
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

cerebellum - Ren - ENCSR000CBQ

1.
191 / 500
6.2e-55
GGGAAGGAGCAGGAAGAGGAG
small heat map img p-value: 0.00
pct_center: 0.60
pct_ratio: 0.56
2.
84 / 500
1.9
GGAGCTG
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.68
3.
39 / 500
3.4
GGGGCGGCGGCGGCGGCGGCC
small heat map img p-value: 0.00
pct_center: 0.47
pct_ratio: 0.66
4.
28 / 500
1.9
AGAGGCTGAGAATTCAAAGGA
small heat map img p-value: 0.60
pct_center: 0.23
pct_ratio: 0.53
5.
29 / 500
9.2e+2
TGCCTGTGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

cortical plate - Ren - ENCSR000CBP

1.
53 / 500
4.9e-26
AAGATGGCGGC
small heat map img p-value: 0.89
pct_center: 0.11
pct_ratio: 0.61
2.
62 / 500
4.5e-23
GCGCATGCGCAGTG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.96
3.
154 / 500
1.7e-16
AGGAAGCGGAG
small heat map img p-value: 0.68
pct_center: 0.35
pct_ratio: 0.59
4.
38 / 500
0.00062
TGCGGCTGCTGCTGC
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.73
5.
11 / 500
71
AAGTTCCCTTGCCTTGTACTGAAGGTGTGC
small heat map img p-value: 0.87
pct_center: 0.15
pct_ratio: 0.63
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

embryonic fibroblast - Ren - ENCSR000CBX

1.
115 / 500
1.2e-19
GGAGGGGGGGGAGGAGGAGGAGAGAGAG
small heat map img p-value: 0.00
pct_center: 0.47
pct_ratio: 1.06
2.
5 / 500
8.2e-10
AAGGGTCTTGGCAAAGGTGGCGCCAAGCGC
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.65
3.
22 / 500
0.000024
TGTTTGTGTGGTTGTGTGTCT
small heat map img p-value: 0.90
pct_center: 0.16
pct_ratio: 0.43
4.
8 / 500
0.00021
AACATGTCTGGACGCGGCAAG
small heat map img p-value: 0.32
pct_center: 0.06
pct_ratio: 0.53
5.
13 / 500
2.9e+4
GATGGTGAGTG
small heat map img p-value: 1.00
pct_center: 0.13
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

heart - Ren - ENCSR000CBS

1.
87 / 500
4.3e-16
GGAGGAGGAGAAGGAGGGGGA
small heat map img p-value: 0.00
pct_center: 0.55
pct_ratio: 0.99
2.
22 / 500
0.0011
GCGCCTGCGCAGTG
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.89
3.
29 / 500
0.00024
AAAATGGCGGCGGC
small heat map img p-value: 0.96
pct_center: 0.12
pct_ratio: 0.59
4.
31 / 500
0.15
TATAAAAGGCG
small heat map img p-value: 0.00
pct_center: 0.04
pct_ratio: 0.40
5.
20 / 500
1.9e+3
GAAACAAAGAGAGAA
small heat map img p-value: 0.59
pct_center: 0.20
pct_ratio: 0.51
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

kidney - Ren - ENCSR000CBK

1.
97 / 500
7.3e-69
CTATAAAAG
small heat map img p-value: 0.00
pct_center: 0.03
pct_ratio: 0.43
2.
97 / 500
7.9e-29
GAGGAGGAGCAGAGGGAAGAG
small heat map img p-value: 0.00
pct_center: 0.58
pct_ratio: 0.60
3.
4 / 500
0.000072
GCAACTCATACTTACCTGGCAGGGGAGATA
small heat map img p-value: 1.00
pct_center: 0.10
pct_ratio: 0.54
4.
5 / 500
0.012
CATGTCTGGACGTGGCAAGGGTGGAAAAGG
small heat map img p-value: 1.00
pct_center: 0.15
pct_ratio: 0.60
5.
32 / 500
0.00088
AGAGGCAGCAGCAGCAGCAGC
small heat map img p-value: 0.95
pct_center: 0.37
pct_ratio: 0.71
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

limb - Ren - ENCSR000CEC

1.
69 / 500
3.8e-34
CAAGATGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.95
2.
62 / 500
3.5e-21
AGAGAGAGGGGGAGGAGGAGAGGACCGGG
small heat map img p-value: 0.00
pct_center: 0.77
pct_ratio: 0.63
3.
25 / 500
0.000026
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.02
pct_ratio: 0.48
4.
35 / 500
0.34
GAGGGTGGAGGGGTGGAGGCGGCGGCAGC
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 0.73
5.
23 / 500
0.074
GGGGATGGGTGGGGAGGTGTGTTGGTG
small heat map img p-value: 0.76
pct_center: 0.42
pct_ratio: 0.57
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

liver - Ren - ENCSR000CBR

1.
149 / 500
2.7e-33
AGGCAGCAGCGGAGGCAGGGG
small heat map img p-value: 0.00
pct_center: 0.64
pct_ratio: 0.62
2.
61 / 500
19
AGGAGGAGCGCGGAG
small heat map img p-value: 0.29
pct_center: 0.32
pct_ratio: 0.59
3.
17 / 500
2.7e+2
TATATAAG
small heat map img p-value: 0.00
pct_center: 0.02
pct_ratio: 0.64
4.
31 / 500
4.3e+2
GGAGCTGAGGAGCTG
small heat map img p-value: 0.86
pct_center: 0.43
pct_ratio: 0.69
5.
5 / 500
1.1e+3
CTTGGGAAGGGTGGCGCCAAG
small heat map img p-value: 0.05
pct_center: 0.14
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

lung - Ren - ENCSR000CBT

1.
59 / 500
1.4e-22
CAAGATGGCGGCGGC
small heat map img p-value: 0.17
pct_center: 0.18
pct_ratio: 0.84
2.
30 / 500
0.0000055
GCGCATGCGCA
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.95
3.
92 / 500
0.000020
AGCAGAAG
small heat map img p-value: 1.00
pct_center: 0.25
pct_ratio: 0.65
4.
95 / 500
9.3
AGGAAG
small heat map img p-value: 0.00
pct_center:
pct_ratio:
5.
5 / 500
4.9e+2
TGTGCATGTGGGTGTGTATGTGTGTG
small heat map img p-value: 0.58
pct_center: 0.13
pct_ratio: 0.42
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

myocyte - Wold - ENCSR000AIX

1.
70 / 500
7.5e-50
AGCGGCGGCGGCAGCGGCAGC
small heat map img p-value: 0.00
pct_center: 0.56
pct_ratio: 0.78
2.
36 / 500
4.3e-7
AAGATGGCGGC
small heat map img p-value: 0.57
pct_center: 0.11
pct_ratio: 0.71
3.
24 / 500
0.000049
TGCGGGGGTCTGTGTGTGTGAGTGTGT
small heat map img p-value: 0.42
pct_center: 0.18
pct_ratio: 0.55
4.
68 / 500
0.086
AGGGGAGAGAG
small heat map img p-value: 0.71
pct_center: 0.26
pct_ratio: 0.52
5.
17 / 500
0.054
AGGCAGACAGGCAGGAAGGCC
small heat map img p-value: 1.00
pct_center: 0.42
pct_ratio: 0.69
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

olfactory bulb - Ren - ENCSR000CDY

1.
108 / 500
6.5e-43
GGCGGCGGCGGCGGCGGCGG
small heat map img p-value: 0.00
pct_center: 0.70
pct_ratio: 0.71
2.
36 / 500
4.5e-18
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.26
3.
77 / 500
4.1e-10
AGAGAGAGAAGGAGAGCGCGG
small heat map img p-value: 0.00
pct_center: 0.60
pct_ratio: 0.65
4.
23 / 500
2.3
AAGGAGCCGGAAAATAAACTG
small heat map img p-value: 0.27
pct_center: 0.21
pct_ratio: 0.50
5.
25 / 500
0.56
CAACATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.94
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

small intestine - Ren - ENCSR000CEE

1.
161 / 500
2.8e-53
GAGGCGGCGGCGGCGGCGGAG
small heat map img p-value: 0.00
pct_center: 0.59
pct_ratio: 0.65
2.
59 / 500
1.5e-30
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.02
pct_ratio: 0.32
3.
40 / 500
0.00057
AAAGAGCCAGAGAGCGCGCGC
small heat map img p-value: 0.71
pct_center: 0.35
pct_ratio: 0.62
4.
23 / 500
1.3e+2
AGAAATGAGAA
small heat map img p-value: 0.40
pct_center: 0.12
pct_ratio: 0.45
5.
33 / 500
1.7e+2
AGAAGCTGCAGGGAA
small heat map img p-value: 0.82
pct_center: 0.26
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

spleen - Ren - ENCSR000CBZ

1.
122 / 500
2.2e-37
GGGCGGCGGCGGCGGCGGCGG
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 0.72
2.
39 / 500
2.1e-19
AAGATGGCGGC
small heat map img p-value: 0.90
pct_center: 0.16
pct_ratio: 0.89
3.
78 / 500
1.3e-13
AAAGAGGAAGT
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.82
4.
17 / 500
0.019
TTTTTTGTTTTGCCTTTGTTT
small heat map img p-value: 0.21
pct_center: 0.07
pct_ratio: 0.25
5.
32 / 500
4.0
GCGCATGCGCA
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 0.94
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

testis - Ren - ENCSR000CEG

1.
74 / 500
1.5e-46
CAAGATGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.77
2.
38 / 500
5.4e-20
TATAAAAGG
small heat map img p-value: 0.00
pct_center: 0.02
pct_ratio: 0.38
3.
38 / 500
1.9e-9
CGGAAGTGACG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.72
4.
88 / 500
8.9e-10
GAGGAGGAGGAGGAG
small heat map img p-value: 0.00
pct_center: 0.52
pct_ratio: 0.57
5.
49 / 500
1.2e-9
GCGCAGGCGCA
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 1.01
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

thymus - Ren - ENCSR000CEA

1.
140 / 500
6.8e-59
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 0.73
2.
44 / 500
4.4e-11
AGAGAGAGAGGGAGCGGAAGG
small heat map img p-value: 0.00
pct_center: 0.48
pct_ratio: 0.58
3.
30 / 500
4.2e-7
CAAGATGGCGGCG
small heat map img p-value: 0.01
pct_center: 0.16
pct_ratio: 0.82
4.
14 / 500
0.00016
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.35
5.
128 / 500
0.079
AGGAGCAG
small heat map img p-value: 1.00
pct_center: 0.25
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at POLR2A peaks

CH12.LX - Snyder - ENCSR000ERQ

CH12.LX
Snyder
POLR2A
ENCSR000ERQ
r=1.00

small heat map img

CH12.LX
Snyder
H3K9ac
ENCSR000CGL
r=0.53

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000CGK
r=0.51

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000ADI
r=0.51

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000DHU
r=0.47

small heat map img

CH12.LX
Snyder
H3K4me2
ENCSR000CGI
r=0.43

small heat map img

CH12.LX
Snyder
H3K27ac
ENCSR000CGJ
r=0.30

small heat map img

CH12.LX
Snyder
H3K79me2
ENCSR000CGM
r=0.16

small heat map img

CH12.LX
Snyder
H3K4me1
ENCSR000DHQ
r=0.07

small heat map img

CH12.LX
Snyder
H3K4me1
ENCSR000CGH
r=0.06

small heat map img

CH12.LX
Snyder
H3K27me3
ENCSR000DHY
r=0.01

small heat map img

CH12.LX
Snyder
H3K9me3
ENCSR000DHO
r=-0.08

small heat map img

CH12.LX
Snyder
H3K36me3
ENCSR000CFL
r=-0.17

small heat map img

CH12.LX
Snyder
H3K36me3
ENCSR000DHW
r=-0.22

small heat map img
10,000 randomly-selected peaks from a total of 28,805 (download )

ES-Bruce4 - Ren - ENCSR000CCC

ES-Bruce4
Ren
POLR2A
ENCSR000CCC
r=1.00

small heat map img

ES-Bruce4
Ren
H3K9ac
ENCSR000CGS
r=0.62

small heat map img

ES-Bruce4
Ren
H3K4me3
ENCSR000CBG
r=0.59

small heat map img

ES-Bruce4
Ren
H3K27ac
ENCSR000CDE
r=0.42

small heat map img

ES-Bruce4
Ren
H3K4me1
ENCSR000CBF
r=0.17

small heat map img

ES-Bruce4
Ren
H3K27me3
ENCSR000CFN
r=0.12

small heat map img

ES-Bruce4
Ren
H3K9me3
ENCSR000CFZ
r=0.01

small heat map img

ES-Bruce4
Ren
H3K36me3
ENCSR000CFO
r=-0.03

small heat map img
8,999 peaks (download )

MEL cell line - Ren - ENCSR000CFI

MEL cell line
Ren
POLR2A
ENCSR000CFI
r=1.00

small heat map img

MEL cell line
Ren
POLR2A
ENCSR000EUC
r=0.79

small heat map img

MEL cell line
Ren
POLR2A
ENCSR000ETG
r=0.74

small heat map img

MEL cell line
Ren
H3K9ac
ENCSR000CEU
r=0.60

small heat map img

MEL cell line
Ren
H3K4me3
ENCSR000ADR
r=0.59

small heat map img

MEL cell line
Ren
H3K4me3
ENCSR000AEA
r=0.58

small heat map img

MEL cell line
Ren
H3K4me3
ENCSR000CEX
r=0.58

small heat map img

MEL cell line
Ren
H3K79me2
ENCSR000CET
r=0.52

small heat map img

MEL cell line
Ren
H3K27ac
ENCSR000CEV
r=0.43

small heat map img

MEL cell line
Ren
H3K4me1
ENCSR000ADQ
r=0.41

small heat map img

MEL cell line
Ren
H3K4me1
ENCSR000ADY
r=0.32

small heat map img

MEL cell line
Ren
H3K36me3
ENCSR000CES
r=0.31

small heat map img

MEL cell line
Ren
H3K4me1
ENCSR000CEW
r=0.28

small heat map img

MEL cell line
Ren
H3K9me3
ENCSR000ADT
r=0.18

small heat map img

MEL cell line
Ren
H3K9me3
ENCSR000AEB
r=0.17

small heat map img

MEL cell line
Ren
H3K27me3
ENCSR000ADW
r=0.13

small heat map img

MEL cell line
Ren
H3K36me3
ENCSR000ADX
r=0.13

small heat map img

MEL cell line
Ren
H3K27me3
ENCSR000ADP
r=0.09

small heat map img

MEL cell line
Ren
H3K27me3
ENCSR000CER
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 16,990 (download )

MEL cell line - Snyder - ENCSR000ETG

MEL cell line
Snyder
POLR2A
ENCSR000ETG
r=1.00

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000EUC
r=0.80

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000CFI
r=0.66

small heat map img

MEL cell line
Snyder
H3K9ac
ENCSR000CEU
r=0.56

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000AEA
r=0.56

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000CEX
r=0.55

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000ADR
r=0.54

small heat map img

MEL cell line
Snyder
H3K27ac
ENCSR000CEV
r=0.45

small heat map img

MEL cell line
Snyder
H3K79me2
ENCSR000CET
r=0.33

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADQ
r=0.24

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADY
r=0.17

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADW
r=0.14

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000CER
r=0.14

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000CEW
r=0.13

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000CES
r=0.11

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000AEB
r=0.11

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000ADT
r=0.09

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADP
r=0.08

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000ADX
r=-0.04

small heat map img
5,372 peaks (download )

MEL cell line - Snyder - ENCSR000EUC

MEL cell line
Snyder
POLR2A
ENCSR000EUC
r=1.00

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000ETG
r=0.88

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000CFI
r=0.79

small heat map img

MEL cell line
Snyder
H3K9ac
ENCSR000CEU
r=0.55

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000ADR
r=0.53

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000AEA
r=0.53

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000CEX
r=0.52

small heat map img

MEL cell line
Snyder
H3K27ac
ENCSR000CEV
r=0.44

small heat map img

MEL cell line
Snyder
H3K79me2
ENCSR000CET
r=0.34

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADQ
r=0.30

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADY
r=0.24

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000CEW
r=0.21

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000CES
r=0.19

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADW
r=0.16

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000CER
r=0.15

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000ADT
r=0.13

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADP
r=0.13

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000AEB
r=0.12

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000ADX
r=-0.09

small heat map img
10,000 randomly-selected peaks from a total of 27,844 (download )

bone marrow - Ren - ENCSR000CBM

bone marrow
Ren
POLR2A
ENCSR000CBM
r=1.00

small heat map img

bone marrow
Ren
H3K4me3
ENCSR000CAH
r=0.46

small heat map img

bone marrow
Ren
H3K27ac
ENCSR000CCL
r=0.37

small heat map img

bone marrow
Ren
H3K4me1
ENCSR000CAG
r=0.23

small heat map img
8,436 peaks (download )

bone marrow macrophage - Ren - ENCSR000CFK

bone marrow macrophage
Ren
POLR2A
ENCSR000CFK
r=1.00

small heat map img

bone marrow macrophage
Ren
H3K4me3
ENCSR000CFF
r=0.42

small heat map img

bone marrow macrophage
Ren
H3K27ac
ENCSR000CFD
r=0.33

small heat map img

bone marrow macrophage
Ren
H3K4me1
ENCSR000CFE
r=0.20

small heat map img
10,000 randomly-selected peaks from a total of 21,529 (download )

brain - Ren - ENCSR000CEI

brain
Ren
POLR2A
ENCSR000CEI
r=1.00

small heat map img

brain
Ren
H3K4me3
ENCSR000CDA
r=0.55

small heat map img

brain
Ren
H3K27ac
ENCSR000CCY
r=0.43

small heat map img

brain
Ren
H3K9me3
ENCSR000CGE
r=0.38

small heat map img

brain
Ren
H3K4me1
ENCSR000CCZ
r=0.37

small heat map img

brain
Ren
H3K27me3
ENCSR000CGD
r=0.23

small heat map img

brain
Ren
H3K36me3
ENCSR000CFW
r=0.08

small heat map img
10,000 randomly-selected peaks from a total of 16,606 (download )

cerebellum - Ren - ENCSR000CBQ

cerebellum
Ren
POLR2A
ENCSR000CBQ
r=1.00

small heat map img

cerebellum
Ren
H3K27ac
ENCSR000CDC
r=0.30

small heat map img

cerebellum
Ren
H3K4me3
ENCSR000CAK
r=0.27

small heat map img

cerebellum
Ren
H3K27me3
ENCSR000CFM
r=0.21

small heat map img
7,736 peaks (download )

cortical plate - Ren - ENCSR000CBP

cortical plate
Ren
POLR2A
ENCSR000CBP
r=1.00

small heat map img

cortical plate
Ren
H3K4me3
ENCSR000CAJ
r=0.41

small heat map img

cortical plate
Ren
H3K27ac
ENCSR000CDD
r=0.34

small heat map img

cortical plate
Ren
H3K4me1
ENCSR000CAI
r=0.22

small heat map img
10,000 randomly-selected peaks from a total of 19,448 (download )

embryonic fibroblast - Ren - ENCSR000CBX

embryonic fibroblast
Ren
POLR2A
ENCSR000CBX
r=1.00

small heat map img

embryonic fibroblast
Ren
H3K4me3
ENCSR000CBA
r=0.42

small heat map img

embryonic fibroblast
Ren
H3K27ac
ENCSR000CDI
r=0.23

small heat map img

embryonic fibroblast
Ren
H3K4me1
ENCSR000CAZ
r=0.06

small heat map img
10,000 randomly-selected peaks from a total of 26,295 (download )

heart - Ren - ENCSR000CBS

heart
Ren
POLR2A
ENCSR000CBS
r=1.00

small heat map img

heart
Ren
H3K4me3
ENCSR000CAM
r=0.46

small heat map img

heart
Ren
H3K9ac
ENCSR000CEM
r=0.45

small heat map img

heart
Ren
H3K27ac
ENCSR000CDF
r=0.36

small heat map img

heart
Ren
H3K79me2
ENCSR000CEL
r=0.21

small heat map img

heart
Ren
H3K4me1
ENCSR000CAE
r=0.18

small heat map img

heart
Ren
H3K27me3
ENCSR000CEJ
r=0.18

small heat map img

heart
Ren
H3K36me3
ENCSR000CEK
r=0.06

small heat map img

heart
Ren
H3K4me3
ENCSR000CDM
r=0.06

small heat map img

heart
Ren
H3K27ac
ENCSR000CDK
r=0.04

small heat map img

heart
Ren
H3K4me1
ENCSR000CDL
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 29,287 (download )

kidney - Ren - ENCSR000CBK

kidney
Ren
POLR2A
ENCSR000CBK
r=1.00

small heat map img

kidney
Ren
H3K4me3
ENCSR000CAN
r=0.51

small heat map img

kidney
Ren
H3K27ac
ENCSR000CDG
r=0.43

small heat map img

kidney
Ren
H3K27me3
ENCSR000CFP
r=0.35

small heat map img

kidney
Ren
H3K4me1
ENCSR000CAF
r=0.25

small heat map img

kidney
Ren
H3K36me3
ENCSR000CFQ
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 13,194 (download )

limb - Ren - ENCSR000CEC

limb
Ren
POLR2A
ENCSR000CEC
r=1.00

small heat map img

limb
Ren
H3K4me3
ENCSR000CCO
r=0.56

small heat map img

limb
Ren
H3K27ac
ENCSR000CCM
r=0.46

small heat map img

limb
Ren
H3K4me1
ENCSR000CCN
r=0.27

small heat map img
10,000 randomly-selected peaks from a total of 14,426 (download )

liver - Ren - ENCSR000CBR

liver
Ren
POLR2A
ENCSR000CBR
r=1.00

small heat map img

liver
Ren
H3K9ac
ENCSR000CEQ
r=0.56

small heat map img

liver
Ren
H3K4me3
ENCSR000CAP
r=0.56

small heat map img

liver
Ren
H3K27ac
ENCSR000CDH
r=0.50

small heat map img

liver
Ren
H3K79me2
ENCSR000CEP
r=0.37

small heat map img

liver
Ren
H3K27me3
ENCSR000CEN
r=0.33

small heat map img

liver
Ren
H3K4me1
ENCSR000CAO
r=0.28

small heat map img

liver
Ren
H3K4me3
ENCSR000CDV
r=0.09

small heat map img

liver
Ren
H3K27ac
ENCSR000CDU
r=0.08

small heat map img

liver
Ren
H3K4me1
ENCSR000CDW
r=0.07

small heat map img

liver
Ren
H3K36me3
ENCSR000CEO
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 11,034 (download )

lung - Ren - ENCSR000CBT

lung
Ren
POLR2A
ENCSR000CBT
r=1.00

small heat map img

lung
Ren
H3K4me3
ENCSR000CAR
r=0.47

small heat map img

lung
Ren
H3K4me1
ENCSR000CAQ
r=0.26

small heat map img
10,000 randomly-selected peaks from a total of 18,098 (download )

myocyte - Wold - ENCSR000AIX

myocyte
Wold
POLR2A
ENCSR000AIX
r=1.00

small heat map img

myocyte
Wold
H3K4me3
ENCSR000AHT
r=0.31

small heat map img

myocyte
Wold
H3ac
ENCSR000AHU
r=0.31

small heat map img

myocyte
Wold
H3K4me2
ENCSR000AHS
r=0.22

small heat map img

myocyte
Wold
H3K79me2
ENCSR000AHN
r=0.04

small heat map img

myocyte
Wold
H3K27me3
ENCSR000AHM
r=0.02

small heat map img

myocyte
Wold
H3K36me3
ENCSR000AHV
r=-0.10

small heat map img
10,000 randomly-selected peaks from a total of 22,982 (download )

olfactory bulb - Ren - ENCSR000CDY

olfactory bulb
Ren
POLR2A
ENCSR000CDY
r=1.00

small heat map img

olfactory bulb
Ren
H3K4me3
ENCSR000CDS
r=0.52

small heat map img

olfactory bulb
Ren
H3K27ac
ENCSR000CCE
r=0.42

small heat map img

olfactory bulb
Ren
H3K4me1
ENCSR000CCF
r=0.17

small heat map img
10,000 randomly-selected peaks from a total of 16,598 (download )

small intestine - Ren - ENCSR000CEE

small intestine
Ren
POLR2A
ENCSR000CEE
r=1.00

small heat map img

small intestine
Ren
H3K4me3
ENCSR000CCS
r=0.47

small heat map img

small intestine
Ren
H3K27ac
ENCSR000CCQ
r=0.38

small heat map img

small intestine
Ren
H3K4me1
ENCSR000CCR
r=0.24

small heat map img

small intestine
Ren
H3K27me3
ENCSR000CFR
r=0.17

small heat map img

small intestine
Ren
H3K36me3
ENCSR000CFS
r=0.00

small heat map img
10,000 randomly-selected peaks from a total of 24,608 (download )

spleen - Ren - ENCSR000CBZ

spleen
Ren
POLR2A
ENCSR000CBZ
r=1.00

small heat map img

spleen
Ren
H3K4me3
ENCSR000CBD
r=0.52

small heat map img

spleen
Ren
H3K27ac
ENCSR000CDJ
r=0.42

small heat map img

spleen
Ren
H3K4me1
ENCSR000CBC
r=0.32

small heat map img

spleen
Ren
H3K27me3
ENCSR000CGA
r=0.31

small heat map img

spleen
Ren
H3K36me3
ENCSR000CFT
r=0.01

small heat map img
5,430 peaks (download )

testis - Ren - ENCSR000CEG

testis
Ren
POLR2A
ENCSR000CEG
r=1.00

small heat map img

testis
Ren
H3K4me3
ENCSR000CCW
r=0.48

small heat map img

testis
Ren
H3K27ac
ENCSR000CCU
r=0.43

small heat map img

testis
Ren
H3K4me1
ENCSR000CCV
r=0.31

small heat map img

testis
Ren
H3K27me3
ENCSR000CGB
r=0.20

small heat map img

testis
Ren
H3K36me3
ENCSR000CFU
r=0.08

small heat map img
10,000 randomly-selected peaks from a total of 28,027 (download )

thymus - Ren - ENCSR000CEA

thymus
Ren
POLR2A
ENCSR000CEA
r=1.00

small heat map img

thymus
Ren
H3K4me3
ENCSR000CCJ
r=0.54

small heat map img

thymus
Ren
H3K27ac
ENCSR000CCH
r=0.40

small heat map img

thymus
Ren
H3K27me3
ENCSR000CGC
r=0.33

small heat map img

thymus
Ren
H3K4me1
ENCSR000CCI
r=0.28

small heat map img

thymus
Ren
H3K36me3
ENCSR000CFV
r=0.17

small heat map img
10,000 randomly-selected peaks from a total of 18,285 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at POLR2A peaks

CH12.LX - Snyder - ENCSR000ERQ

CH12.LX
Snyder
POLR2A
ENCSR000ERQ
r=1.00

small heat map img

CH12.LX
Snyder
NELFE
ENCSR000ERD
r=0.93

small heat map img

CH12.LX
Snyder
ZMIZ1
ENCSR000EQP
r=0.85

small heat map img

CH12.LX
Snyder
KAT2A
ENCSR000EQU
r=0.74

small heat map img

CH12.LX
Snyder
MXI1
ENCSR000ERE
r=0.74

small heat map img

CH12.LX
Snyder
SIN3A
ENCSR000EQY
r=0.73

small heat map img

CH12.LX
Snyder
MAX
ENCSR000ERL
r=0.70

small heat map img

CH12.LX
Snyder
TBP
ENCSR000ERP
r=0.69

small heat map img

CH12.LX
Snyder
HCFC1
ENCSR000EQR
r=0.65

small heat map img

CH12.LX
Snyder
MAZ
ENCSR000EQT
r=0.65

small heat map img

CH12.LX
Snyder
GABPA
ENCSR000EQS
r=0.64

small heat map img

CH12.LX
Snyder
MYC
ENCSR000ERN
r=0.61

small heat map img

CH12.LX
Snyder
RCOR1
ENCSR000EQZ
r=0.60

small heat map img

CH12.LX
Snyder
UBTF
ENCSR000EQX
r=0.60

small heat map img

CH12.LX
Snyder
E2F4
ENCSR000ERU
r=0.57

small heat map img

CH12.LX
Snyder
CHD2
ENCSR000ERF
r=0.57

small heat map img

CH12.LX
Snyder
ZKSCAN1
ENCSR000EQW
r=0.53

small heat map img

CH12.LX
Snyder
BHLHE40
ENCSR000ERC
r=0.47

small heat map img

CH12.LX
Snyder
ZC3H11A
ENCSR000EQQ
r=0.47

small heat map img

CH12.LX
Snyder
ETS1
ENCSR000ERA
r=0.46

small heat map img

CH12.LX
Snyder
MAFK
ENCSR000ERB
r=0.45

small heat map img

CH12.LX
Snyder
USF2
ENCSR000ERJ
r=0.45

small heat map img

CH12.LX
Snyder
CHD1
ENCSR000EQV
r=0.44

small heat map img

CH12.LX
Snyder
JUN
ENCSR000ERO
r=0.42

small heat map img

CH12.LX
Snyder
JUND
ENCSR000ERR
r=0.41

small heat map img

CH12.LX
Snyder
SMC3
ENCSR000ERG
r=0.41

small heat map img

CH12.LX
Snyder
EP300
ENCSR000ERI
r=0.38

small heat map img

CH12.LX
Snyder
RAD21
ENCSR000ERK
r=0.30

small heat map img

CH12.LX
Snyder
ZNF384
ENCSR000EQO
r=0.29

small heat map img

CH12.LX
Snyder
CTCF
ENCSR000ERM
r=0.22

small heat map img

CH12.LX
Snyder
CTCF
ENCSR000DIU
r=-0.04

small heat map img

CH12.LX
Snyder
PAX5
ENCSR000DIH
r=-0.06

small heat map img
10,000 randomly-selected peaks from a total of 28,805 (download )

ES-Bruce4 - Ren - ENCSR000CCC

ES-Bruce4
Ren
POLR2A
ENCSR000CCC
r=1.00

small heat map img

ES-Bruce4
Ren
EP300
ENCSR000CCD
r=0.77

small heat map img

ES-Bruce4
Ren
CTCF
ENCSR000CCB
r=0.40

small heat map img
8,999 peaks (download )

MEL cell line - Ren - ENCSR000CFI

MEL cell line
Ren
POLR2A
ENCSR000CFI
r=1.00

small heat map img

MEL cell line
Ren
NELFE
ENCSR000ETU
r=0.79

small heat map img

MEL cell line
Ren
POLR2A
ENCSR000EUC
r=0.79

small heat map img

MEL cell line
Ren
POLR2A
ENCSR000ETG
r=0.74

small heat map img

MEL cell line
Ren
MXI1
ENCSR000ETN
r=0.68

small heat map img

MEL cell line
Ren
SIN3A
ENCSR000ETC
r=0.67

small heat map img

MEL cell line
Ren
ZMIZ1
ENCSR000ESE
r=0.65

small heat map img

MEL cell line
Ren
MAX
ENCSR000ETX
r=0.64

small heat map img

MEL cell line
Ren
MAZ
ENCSR000ESL
r=0.64

small heat map img

MEL cell line
Ren
UBTF
ENCSR000ESJ
r=0.60

small heat map img

MEL cell line
Ren
KAT2A
ENCSR000ESM
r=0.58

small heat map img

MEL cell line
Ren
E2F4
ENCSR000ETY
r=0.56

small heat map img

MEL cell line
Ren
MYC
ENCSR000EUA
r=0.52

small heat map img

MEL cell line
Ren
RCOR1
ENCSR000ESI
r=0.51

small heat map img

MEL cell line
Ren
HCFC1
ENCSR000ESG
r=0.50

small heat map img

MEL cell line
Ren
MYB
ENCSR000ETR
r=0.49

small heat map img

MEL cell line
Ren
GABPA
ENCSR000ESK
r=0.49

small heat map img

MEL cell line
Ren
CTCF
ENCSR000CFH
r=0.48

small heat map img

MEL cell line
Ren
TBP
ENCSR000EUB
r=0.48

small heat map img

MEL cell line
Ren
CHD1
ENCSR000ESN
r=0.47

small heat map img

MEL cell line
Ren
BHLHE40
ENCSR000ESH
r=0.46

small heat map img

MEL cell line
Ren
ZKSCAN1
ENCSR000ESX
r=0.46

small heat map img

MEL cell line
Ren
MAFK
ENCSR000ESY
r=0.45

small heat map img

MEL cell line
Ren
ETS1
ENCSR000ETB
r=0.44

small heat map img

MEL cell line
Ren
MAFK
ENCSR000ETK
r=0.44

small heat map img

MEL cell line
Ren
GATA1
ENCSR000ETA
r=0.43

small heat map img

MEL cell line
Ren
CHD2
ENCSR000ETO
r=0.42

small heat map img

MEL cell line
Ren
SMC3
ENCSR000ETL
r=0.41

small heat map img

MEL cell line
Ren
EP300
ENCSR000ETP
r=0.41

small heat map img

MEL cell line
Ren
ZC3H11A
ENCSR000ESF
r=0.40

small heat map img

MEL cell line
Ren
JUND
ENCSR000ETZ
r=0.37

small heat map img

MEL cell line
Ren
EP300
ENCSR000ETV
r=0.35

small heat map img

MEL cell line
Ren
USF2
ENCSR000ETF
r=0.30

small heat map img

MEL cell line
Ren
RAD21
ENCSR000ETT
r=0.27

small heat map img

MEL cell line
Ren
RAD21
ENCSR000ETS
r=0.21

small heat map img

MEL cell line
Ren
ZNF384
ENCSR000ESD
r=0.20

small heat map img

MEL cell line
Ren
CTCF
ENCSR000ETE
r=0.18

small heat map img

MEL cell line
Ren
GATA1
ENCSR000EUG
r=0.18

small heat map img

MEL cell line
Ren
CTCF
ENCSR000ETQ
r=0.17

small heat map img

MEL cell line
Ren
USF2
ENCSR000ETW
r=0.17

small heat map img

MEL cell line
Ren
TAL1
ENCSR000DIA
r=0.03

small heat map img

MEL cell line
Ren
CTCF
ENCSR000DIP
r=-0.05

small heat map img
10,000 randomly-selected peaks from a total of 16,990 (download )

MEL cell line - Snyder - ENCSR000ETG

MEL cell line
Snyder
POLR2A
ENCSR000ETG
r=1.00

small heat map img

MEL cell line
Snyder
NELFE
ENCSR000ETU
r=0.85

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000EUC
r=0.80

small heat map img

MEL cell line
Snyder
ZMIZ1
ENCSR000ESE
r=0.72

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000CFI
r=0.66

small heat map img

MEL cell line
Snyder
SIN3A
ENCSR000ETC
r=0.63

small heat map img

MEL cell line
Snyder
MAZ
ENCSR000ESL
r=0.62

small heat map img

MEL cell line
Snyder
KAT2A
ENCSR000ESM
r=0.58

small heat map img

MEL cell line
Snyder
MXI1
ENCSR000ETN
r=0.58

small heat map img

MEL cell line
Snyder
MAX
ENCSR000ETX
r=0.56

small heat map img

MEL cell line
Snyder
E2F4
ENCSR000ETY
r=0.55

small heat map img

MEL cell line
Snyder
TBP
ENCSR000EUB
r=0.54

small heat map img

MEL cell line
Snyder
RCOR1
ENCSR000ESI
r=0.50

small heat map img

MEL cell line
Snyder
GABPA
ENCSR000ESK
r=0.47

small heat map img

MEL cell line
Snyder
HCFC1
ENCSR000ESG
r=0.47

small heat map img

MEL cell line
Snyder
MYC
ENCSR000EUA
r=0.47

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ESY
r=0.46

small heat map img

MEL cell line
Snyder
ETS1
ENCSR000ETB
r=0.45

small heat map img

MEL cell line
Snyder
UBTF
ENCSR000ESJ
r=0.44

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000ETA
r=0.43

small heat map img

MEL cell line
Snyder
CHD2
ENCSR000ETO
r=0.43

small heat map img

MEL cell line
Snyder
MYB
ENCSR000ETR
r=0.43

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ETK
r=0.43

small heat map img

MEL cell line
Snyder
ZKSCAN1
ENCSR000ESX
r=0.42

small heat map img

MEL cell line
Snyder
BHLHE40
ENCSR000ESH
r=0.41

small heat map img

MEL cell line
Snyder
ZC3H11A
ENCSR000ESF
r=0.40

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETP
r=0.38

small heat map img

MEL cell line
Snyder
JUND
ENCSR000ETZ
r=0.37

small heat map img

MEL cell line
Snyder
SMC3
ENCSR000ETL
r=0.37

small heat map img

MEL cell line
Snyder
CHD1
ENCSR000ESN
r=0.37

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETV
r=0.33

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000CFH
r=0.31

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETT
r=0.28

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETF
r=0.26

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000EUG
r=0.24

small heat map img

MEL cell line
Snyder
ZNF384
ENCSR000ESD
r=0.22

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETS
r=0.20

small heat map img

MEL cell line
Snyder
TAL1
ENCSR000DIA
r=0.16

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETE
r=0.16

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETQ
r=0.14

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETW
r=0.09

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000DIP
r=-0.04

small heat map img
5,372 peaks (download )

MEL cell line - Snyder - ENCSR000EUC

MEL cell line
Snyder
POLR2A
ENCSR000EUC
r=1.00

small heat map img

MEL cell line
Snyder
NELFE
ENCSR000ETU
r=0.94

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000ETG
r=0.88

small heat map img

MEL cell line
Snyder
ZMIZ1
ENCSR000ESE
r=0.85

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000CFI
r=0.79

small heat map img

MEL cell line
Snyder
SIN3A
ENCSR000ETC
r=0.74

small heat map img

MEL cell line
Snyder
TBP
ENCSR000EUB
r=0.74

small heat map img

MEL cell line
Snyder
MAX
ENCSR000ETX
r=0.73

small heat map img

MEL cell line
Snyder
KAT2A
ENCSR000ESM
r=0.73

small heat map img

MEL cell line
Snyder
MXI1
ENCSR000ETN
r=0.72

small heat map img

MEL cell line
Snyder
E2F4
ENCSR000ETY
r=0.69

small heat map img

MEL cell line
Snyder
MAZ
ENCSR000ESL
r=0.69

small heat map img

MEL cell line
Snyder
MYC
ENCSR000EUA
r=0.67

small heat map img

MEL cell line
Snyder
HCFC1
ENCSR000ESG
r=0.65

small heat map img

MEL cell line
Snyder
RCOR1
ENCSR000ESI
r=0.62

small heat map img

MEL cell line
Snyder
MYB
ENCSR000ETR
r=0.60

small heat map img

MEL cell line
Snyder
CHD2
ENCSR000ETO
r=0.58

small heat map img

MEL cell line
Snyder
BHLHE40
ENCSR000ESH
r=0.57

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ETK
r=0.57

small heat map img

MEL cell line
Snyder
ETS1
ENCSR000ETB
r=0.56

small heat map img

MEL cell line
Snyder
GABPA
ENCSR000ESK
r=0.56

small heat map img

MEL cell line
Snyder
CHD1
ENCSR000ESN
r=0.55

small heat map img

MEL cell line
Snyder
ZKSCAN1
ENCSR000ESX
r=0.54

small heat map img

MEL cell line
Snyder
SMC3
ENCSR000ETL
r=0.53

small heat map img

MEL cell line
Snyder
UBTF
ENCSR000ESJ
r=0.53

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000ETA
r=0.53

small heat map img

MEL cell line
Snyder
JUND
ENCSR000ETZ
r=0.51

small heat map img

MEL cell line
Snyder
ZC3H11A
ENCSR000ESF
r=0.50

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ESY
r=0.50

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETP
r=0.49

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000CFH
r=0.45

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETV
r=0.44

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETF
r=0.40

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETT
r=0.37

small heat map img

MEL cell line
Snyder
ZNF384
ENCSR000ESD
r=0.33

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETS
r=0.31

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000EUG
r=0.31

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETE
r=0.23

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETW
r=0.22

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETQ
r=0.22

small heat map img

MEL cell line
Snyder
TAL1
ENCSR000DIA
r=0.10

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000DIP
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 27,844 (download )

bone marrow - Ren - ENCSR000CBM

bone marrow
Ren
POLR2A
ENCSR000CBM
r=1.00

small heat map img

bone marrow
Ren
CTCF
ENCSR000CBL
r=0.50

small heat map img
8,436 peaks (download )

bone marrow macrophage - Ren - ENCSR000CFK

bone marrow macrophage
Ren
POLR2A
ENCSR000CFK
r=1.00

small heat map img

bone marrow macrophage
Ren
CTCF
ENCSR000CFJ
r=0.54

small heat map img
10,000 randomly-selected peaks from a total of 21,529 (download )

brain - Ren - ENCSR000CEI

brain
Ren
POLR2A
ENCSR000CEI
r=1.00

small heat map img

brain
Ren
CTCF
ENCSR000CEH
r=0.34

small heat map img
10,000 randomly-selected peaks from a total of 16,606 (download )

cerebellum - Ren - ENCSR000CBQ

cerebellum
Ren
POLR2A
ENCSR000CBQ
r=1.00

small heat map img

cerebellum
Ren
CTCF
ENCSR000CBN
r=0.41

small heat map img
7,736 peaks (download )

cortical plate - Ren - ENCSR000CBP

cortical plate
Ren
POLR2A
ENCSR000CBP
r=1.00

small heat map img

cortical plate
Ren
CTCF
ENCSR000CBO
r=0.37

small heat map img
10,000 randomly-selected peaks from a total of 19,448 (download )

embryonic fibroblast - Ren - ENCSR000CBX

embryonic fibroblast
Ren
POLR2A
ENCSR000CBX
r=1.00

small heat map img

embryonic fibroblast
Ren
CTCF
ENCSR000CBW
r=0.30

small heat map img
10,000 randomly-selected peaks from a total of 26,295 (download )

heart - Ren - ENCSR000CBS

heart
Ren
POLR2A
ENCSR000CBS
r=1.00

small heat map img

heart
Ren
EP300
ENCSR000CCA
r=0.76

small heat map img

heart
Ren
CTCF
ENCSR000CBI
r=0.39

small heat map img
10,000 randomly-selected peaks from a total of 29,287 (download )

kidney - Ren - ENCSR000CBK

kidney
Ren
POLR2A
ENCSR000CBK
r=1.00

small heat map img

kidney
Ren
CTCF
ENCSR000CBJ
r=0.47

small heat map img
10,000 randomly-selected peaks from a total of 13,194 (download )

limb - Ren - ENCSR000CEC

limb
Ren
POLR2A
ENCSR000CEC
r=1.00

small heat map img

limb
Ren
CTCF
ENCSR000CEB
r=0.53

small heat map img
10,000 randomly-selected peaks from a total of 14,426 (download )

liver - Ren - ENCSR000CBR

liver
Ren
POLR2A
ENCSR000CBR
r=1.00

small heat map img

liver
Ren
CTCF
ENCSR000CBU
r=0.55

small heat map img
10,000 randomly-selected peaks from a total of 11,034 (download )

lung - Ren - ENCSR000CBT

lung
Ren
POLR2A
ENCSR000CBT
r=1.00

small heat map img

lung
Ren
CTCF
ENCSR000CBV
r=0.36

small heat map img
10,000 randomly-selected peaks from a total of 18,098 (download )

myocyte - Wold - ENCSR000AIX

myocyte
Wold
POLR2A
ENCSR000AIX
r=1.00

small heat map img

myocyte
Wold
REST
ENCSR000AIS
r=0.55

small heat map img

myocyte
Wold
TCF3
ENCSR000AIP
r=0.46

small heat map img

myocyte
Wold
MYOG
ENCSR000AID
r=0.45

small heat map img

myocyte
Wold
SRF
ENCSR000AIM
r=0.41

small heat map img

myocyte
Wold
MYOG
ENCSR000AIC
r=0.40

small heat map img

myocyte
Wold
E2F4
ENCSR000AII
r=0.37

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIH
r=0.37

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIR
r=0.29

small heat map img

myocyte
Wold
MAX
ENCSR000AIL
r=0.23

small heat map img

myocyte
Wold
USF1
ENCSR000AIE
r=0.15

small heat map img

myocyte
Wold
TCF12
ENCSR000AIN
r=0.13

small heat map img

myocyte
Wold
MYOG
ENCSR000AIW
r=0.09

small heat map img

myocyte
Wold
CEBPB
ENCSR000AIB
r=0.07

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIT
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 22,982 (download )

olfactory bulb - Ren - ENCSR000CDY

olfactory bulb
Ren
POLR2A
ENCSR000CDY
r=1.00

small heat map img

olfactory bulb
Ren
CTCF
ENCSR000CDX
r=0.63

small heat map img
10,000 randomly-selected peaks from a total of 16,598 (download )

small intestine - Ren - ENCSR000CEE

small intestine
Ren
POLR2A
ENCSR000CEE
r=1.00

small heat map img

small intestine
Ren
CTCF
ENCSR000CED
r=0.54

small heat map img
10,000 randomly-selected peaks from a total of 24,608 (download )

spleen - Ren - ENCSR000CBZ

spleen
Ren
POLR2A
ENCSR000CBZ
r=1.00

small heat map img

spleen
Ren
CTCF
ENCSR000CBY
r=0.47

small heat map img
5,430 peaks (download )

testis - Ren - ENCSR000CEG

testis
Ren
POLR2A
ENCSR000CEG
r=1.00

small heat map img

testis
Ren
CTCF
ENCSR000CEF
r=0.52

small heat map img
10,000 randomly-selected peaks from a total of 28,027 (download )

thymus - Ren - ENCSR000CEA

thymus
Ren
POLR2A
ENCSR000CEA
r=1.00

small heat map img

thymus
Ren
CTCF
ENCSR000CDZ
r=0.82

small heat map img
10,000 randomly-selected peaks from a total of 18,285 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help