PAX5

This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. RefSeq, Jul 2013
Paired box protein Pax-5 is a protein that in humans is encoded by the PAX5 gene.wikipedia

PAX5

PDB image
PDB 1K78

PDB 1K78 1MDM
ENCODE experiments
Ensemble search
Entrez 5079
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia PAX5

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

CH12.LX - Hardison - ENCSR000DIH

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

CH12.LX - Hardison - ENCSR000DIH

1.
34 / 500
7.1e-34
TGTGTATGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.49
pct_ratio: 0.63
2.
8 / 500
1.4e-34
GTGTGTGCAGACTTAGTATGTGTGTGCAG
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.67
3.
14 / 500
5.9e-18
GCAGCCAAGCGTGAC
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 3.83
4.
15 / 500
1.2e-16
CAGTGGGCATGTGAATGTGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 0.60
5.
7 / 500
1.3e-16
ACTTAGTATGTGTGTGCAGAC
small heat map img p-value: 0.05
pct_center: 0.16
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at PAX5 peaks

CH12.LX - Hardison - ENCSR000DIH

CH12.LX
Hardison
PAX5
ENCSR000DIH
r=1.00

small heat map img

CH12.LX
Hardison
H3K9me3
ENCSR000DHO
r=0.64

small heat map img

CH12.LX
Hardison
H3K27me3
ENCSR000DHY
r=0.62

small heat map img

CH12.LX
Hardison
H3K4me3
ENCSR000DHU
r=0.62

small heat map img

CH12.LX
Hardison
H3K36me3
ENCSR000DHW
r=0.37

small heat map img

CH12.LX
Hardison
H3K4me1
ENCSR000DHQ
r=0.34

small heat map img

CH12.LX
Hardison
H3K4me3
ENCSR000ADI
r=0.05

small heat map img

CH12.LX
Hardison
H3K4me3
ENCSR000CGK
r=0.04

small heat map img

CH12.LX
Hardison
H3K27ac
ENCSR000CGJ
r=0.04

small heat map img

CH12.LX
Hardison
H3K4me2
ENCSR000CGI
r=0.00

small heat map img

CH12.LX
Hardison
H3K9ac
ENCSR000CGL
r=-0.03

small heat map img

CH12.LX
Hardison
H3K4me1
ENCSR000CGH
r=-0.04

small heat map img

CH12.LX
Hardison
H3K36me3
ENCSR000CFL
r=-0.07

small heat map img

CH12.LX
Hardison
H3K79me2
ENCSR000CGM
r=-0.09

small heat map img
50 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at PAX5 peaks

CH12.LX - Hardison - ENCSR000DIH

CH12.LX
Hardison
PAX5
ENCSR000DIH
r=1.00

small heat map img

CH12.LX
Hardison
CTCF
ENCSR000DIU
r=0.70

small heat map img

CH12.LX
Hardison
RAD21
ENCSR000ERK
r=0.12

small heat map img

CH12.LX
Hardison
ETS1
ENCSR000ERA
r=0.11

small heat map img

CH12.LX
Hardison
EP300
ENCSR000ERI
r=0.09

small heat map img

CH12.LX
Hardison
BHLHE40
ENCSR000ERC
r=0.09

small heat map img

CH12.LX
Hardison
MAX
ENCSR000ERL
r=0.08

small heat map img

CH12.LX
Hardison
SMC3
ENCSR000ERG
r=0.08

small heat map img

CH12.LX
Hardison
JUN
ENCSR000ERO
r=0.07

small heat map img

CH12.LX
Hardison
MYC
ENCSR000ERN
r=0.07

small heat map img

CH12.LX
Hardison
NELFE
ENCSR000ERD
r=0.07

small heat map img

CH12.LX
Hardison
ZC3H11A
ENCSR000EQQ
r=0.07

small heat map img

CH12.LX
Hardison
CTCF
ENCSR000ERM
r=0.06

small heat map img

CH12.LX
Hardison
HCFC1
ENCSR000EQR
r=0.05

small heat map img

CH12.LX
Hardison
JUND
ENCSR000ERR
r=0.04

small heat map img

CH12.LX
Hardison
TBP
ENCSR000ERP
r=0.04

small heat map img

CH12.LX
Hardison
GABPA
ENCSR000EQS
r=0.04

small heat map img

CH12.LX
Hardison
MAZ
ENCSR000EQT
r=0.04

small heat map img

CH12.LX
Hardison
E2F4
ENCSR000ERU
r=0.03

small heat map img

CH12.LX
Hardison
MXI1
ENCSR000ERE
r=0.03

small heat map img

CH12.LX
Hardison
POLR2A
ENCSR000ERQ
r=0.03

small heat map img

CH12.LX
Hardison
SIN3A
ENCSR000EQY
r=0.03

small heat map img

CH12.LX
Hardison
ZMIZ1
ENCSR000EQP
r=0.03

small heat map img

CH12.LX
Hardison
USF2
ENCSR000ERJ
r=0.02

small heat map img

CH12.LX
Hardison
UBTF
ENCSR000EQX
r=0.02

small heat map img

CH12.LX
Hardison
ZNF384
ENCSR000EQO
r=0.01

small heat map img

CH12.LX
Hardison
ZKSCAN1
ENCSR000EQW
r=0.00

small heat map img

CH12.LX
Hardison
CHD1
ENCSR000EQV
r=-0.00

small heat map img

CH12.LX
Hardison
RCOR1
ENCSR000EQZ
r=-0.00

small heat map img

CH12.LX
Hardison
MAFK
ENCSR000ERB
r=-0.01

small heat map img

CH12.LX
Hardison
CHD2
ENCSR000ERF
r=-0.01

small heat map img

CH12.LX
Hardison
KAT2A
ENCSR000EQU
r=-0.02

small heat map img
50 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help