NRF1

This gene encodes a protein that homodimerizes and functions as a transcription factor which activates the expression of some key metabolic genes regulating cellular growth and nuclear genes required for respiration, heme biosynthesis, and mitochondrial DNA transcription and replication. The protein has also been associated with the regulation of neurite outgrowth. Alternative splicing results in multiple transcript variants. Confusion has occurred in bibliographic databases due to the shared symbol of NRF1 for this gene and for "nuclear factor (erythroid-derived 2)-like 1" which has an official symbol of NFE2L1. RefSeq, May 2014
Nuclear respiratory factor 1, also known as Nrf1, Nrf-1, NRF1 and NRF-1, encodes a protein that homodimerizes and functions as a transcription factor which activates the expression of some key metabolic genes regulating cellular growth and nuclear genes required for respiration, heme biosynthesis, and mitochondrial DNA transcription and replication. The protein has also been associated with the regulation of neurite outgrowth.wikipedia

NRF1


ENCODE experiments
Ensemble search
Entrez 4899
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia NRF1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

CH12.LX - Snyder - ENCSR980YXJ

loading

MEL cell line - Snyder - ENCSR135SWH

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

CH12.LX - Snyder - ENCSR980YXJ

1.
497 / 500
1.7e-1211
TGCGCATGCGCAGTG
small heat map img p-value: 0.00
pct_center: 0.62
pct_ratio: 2.06
2.
252 / 500
9.1e-237
TGCGCAGGCGC
small heat map img p-value: 0.00
pct_center: 0.57
pct_ratio: 2.45
3.
78 / 500
0.000030
AGGGGGCGGGG
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 0.63
4.
35 / 500
0.00041
GAAAAAGA
small heat map img p-value: 0.00
pct_center: 0.08
pct_ratio: 0.30
5.
9 / 500
0.50
CCTTCTGGGAGTTGTAGTTCT
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.68
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Snyder - ENCSR135SWH

1.
500 / 500
9.8e-1168
CACTGCGCATGCGCAGG
small heat map img p-value: 0.00
pct_center: 0.74
pct_ratio: 1.88
2.
222 / 500
6.0e-200
TGCGCAGGCGC
small heat map img p-value: 0.00
pct_center: 0.67
pct_ratio: 2.41
3.
16 / 500
1.9e-22
GCCTGCTGGGAGTTGTAGTTC
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.79
4.
107 / 500
8.2e-8
GAGGGGGCGGGGCCG
small heat map img p-value: 0.00
pct_center: 0.64
pct_ratio: 0.76
5.
37 / 500
0.00019
AAAAATAAAGAAACA
small heat map img p-value: 0.00
pct_center: 0.09
pct_ratio: 0.30
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at NRF1 peaks

No histone modification ChIP-seq data are available in the corresponding cell type


Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at NRF1 peaks

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help