NELFE

Negative elongation factor E is a protein that in humans is encoded by the RDBP gene.wikipedia

NELFE


ENCODE experiments
Ensemble search
Entrez
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia RDBP

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

CH12.LX - Snyder - ENCSR000ERD

loading

MEL cell line - Snyder - ENCSR000ETU

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

CH12.LX - Snyder - ENCSR000ERD

1.
8 / 500
2.5e-40
ACTTGCGAGCGGTCTGCTTAGTAC
small heat map img p-value: 0.13
pct_center: 0.06
pct_ratio: 0.63
2.
14 / 500
6.1e-37
ATGTCTGGACGTGGCAAGGG
small heat map img p-value: 0.58
pct_center: 0.09
pct_ratio: 0.49
3.
11 / 500
3.7e-35
AAAGGCCTGGGCAAAGGTGGCGCTAAGCG
small heat map img p-value: 0.13
pct_center: 0.18
pct_ratio: 0.63
4.
7 / 500
3.8e-29
GGAGCCCTTCTTCGGGGCGGGAGCGGACTT
small heat map img p-value: 0.22
pct_center: 0.15
pct_ratio: 0.63
5.
117 / 500
1.6e-26
AAGAAAAGAAAAAGAGAGAAG
small heat map img p-value: 0.82
pct_center: 0.34
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Snyder - ENCSR000ETU

1.
77 / 500
2.7e-19
AGAAAAAGGGAAACA
small heat map img p-value: 0.98
pct_center: 0.23
pct_ratio: 0.41
2.
59 / 500
2.0e-9
GCGGCGGCGGCGGCTGCGGAG
small heat map img p-value: 0.00
pct_center: 0.62
pct_ratio: 0.75
3.
32 / 500
0.0089
CAAAATGGCG
small heat map img p-value: 0.80
pct_center: 0.11
pct_ratio: 0.76
4.
15 / 500
1.0
TTCTTAGAGCTTTTCTTTTGG
small heat map img p-value: 0.01
pct_center: 0.07
pct_ratio: 0.41
5.
25 / 500
8.0e+2
GGTTTGTGTTTCTGTGTGCTGTGTTGG
small heat map img p-value: 0.99
pct_center: 0.19
pct_ratio: 0.41
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at NELFE peaks

CH12.LX - Snyder - ENCSR000ERD

CH12.LX
Snyder
NELFE
ENCSR000ERD
r=1.00

small heat map img

CH12.LX
Snyder
H3K9ac
ENCSR000CGL
r=0.54

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000CGK
r=0.51

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000ADI
r=0.51

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000DHU
r=0.48

small heat map img

CH12.LX
Snyder
H3K4me2
ENCSR000CGI
r=0.43

small heat map img

CH12.LX
Snyder
H3K27ac
ENCSR000CGJ
r=0.35

small heat map img

CH12.LX
Snyder
H3K79me2
ENCSR000CGM
r=0.24

small heat map img

CH12.LX
Snyder
H3K4me1
ENCSR000DHQ
r=0.08

small heat map img

CH12.LX
Snyder
H3K4me1
ENCSR000CGH
r=0.07

small heat map img

CH12.LX
Snyder
H3K27me3
ENCSR000DHY
r=-0.01

small heat map img

CH12.LX
Snyder
H3K36me3
ENCSR000CFL
r=-0.07

small heat map img

CH12.LX
Snyder
H3K9me3
ENCSR000DHO
r=-0.12

small heat map img

CH12.LX
Snyder
H3K36me3
ENCSR000DHW
r=-0.14

small heat map img
10,000 randomly-selected peaks from a total of 18,983 (download )

MEL cell line - Snyder - ENCSR000ETU

MEL cell line
Snyder
NELFE
ENCSR000ETU
r=1.00

small heat map img

MEL cell line
Snyder
H3K9ac
ENCSR000CEU
r=0.64

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000ADR
r=0.62

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000CEX
r=0.62

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000AEA
r=0.62

small heat map img

MEL cell line
Snyder
H3K27ac
ENCSR000CEV
r=0.51

small heat map img

MEL cell line
Snyder
H3K79me2
ENCSR000CET
r=0.41

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADQ
r=0.29

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADY
r=0.20

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000CER
r=0.17

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADW
r=0.17

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000AEB
r=0.14

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000ADT
r=0.14

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000CEW
r=0.13

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000CES
r=0.12

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADP
r=0.11

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000ADX
r=-0.02

small heat map img
9,153 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at NELFE peaks

CH12.LX - Snyder - ENCSR000ERD

CH12.LX
Snyder
NELFE
ENCSR000ERD
r=1.00

small heat map img

CH12.LX
Snyder
POLR2A
ENCSR000ERQ
r=0.92

small heat map img

CH12.LX
Snyder
ZMIZ1
ENCSR000EQP
r=0.81

small heat map img

CH12.LX
Snyder
SIN3A
ENCSR000EQY
r=0.77

small heat map img

CH12.LX
Snyder
KAT2A
ENCSR000EQU
r=0.76

small heat map img

CH12.LX
Snyder
MXI1
ENCSR000ERE
r=0.74

small heat map img

CH12.LX
Snyder
MAX
ENCSR000ERL
r=0.73

small heat map img

CH12.LX
Snyder
TBP
ENCSR000ERP
r=0.72

small heat map img

CH12.LX
Snyder
GABPA
ENCSR000EQS
r=0.70

small heat map img

CH12.LX
Snyder
MAZ
ENCSR000EQT
r=0.70

small heat map img

CH12.LX
Snyder
RCOR1
ENCSR000EQZ
r=0.70

small heat map img

CH12.LX
Snyder
MYC
ENCSR000ERN
r=0.66

small heat map img

CH12.LX
Snyder
E2F4
ENCSR000ERU
r=0.65

small heat map img

CH12.LX
Snyder
HCFC1
ENCSR000EQR
r=0.62

small heat map img

CH12.LX
Snyder
ZKSCAN1
ENCSR000EQW
r=0.58

small heat map img

CH12.LX
Snyder
CHD2
ENCSR000ERF
r=0.57

small heat map img

CH12.LX
Snyder
UBTF
ENCSR000EQX
r=0.56

small heat map img

CH12.LX
Snyder
MAFK
ENCSR000ERB
r=0.55

small heat map img

CH12.LX
Snyder
ETS1
ENCSR000ERA
r=0.54

small heat map img

CH12.LX
Snyder
JUN
ENCSR000ERO
r=0.52

small heat map img

CH12.LX
Snyder
JUND
ENCSR000ERR
r=0.52

small heat map img

CH12.LX
Snyder
ZC3H11A
ENCSR000EQQ
r=0.52

small heat map img

CH12.LX
Snyder
BHLHE40
ENCSR000ERC
r=0.50

small heat map img

CH12.LX
Snyder
EP300
ENCSR000ERI
r=0.46

small heat map img

CH12.LX
Snyder
CHD1
ENCSR000EQV
r=0.46

small heat map img

CH12.LX
Snyder
USF2
ENCSR000ERJ
r=0.46

small heat map img

CH12.LX
Snyder
SMC3
ENCSR000ERG
r=0.36

small heat map img

CH12.LX
Snyder
ZNF384
ENCSR000EQO
r=0.32

small heat map img

CH12.LX
Snyder
RAD21
ENCSR000ERK
r=0.28

small heat map img

CH12.LX
Snyder
CTCF
ENCSR000ERM
r=0.26

small heat map img

CH12.LX
Snyder
CTCF
ENCSR000DIU
r=0.07

small heat map img

CH12.LX
Snyder
PAX5
ENCSR000DIH
r=-0.05

small heat map img
10,000 randomly-selected peaks from a total of 18,983 (download )

MEL cell line - Snyder - ENCSR000ETU

MEL cell line
Snyder
NELFE
ENCSR000ETU
r=1.00

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000EUC
r=0.96

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000ETG
r=0.90

small heat map img

MEL cell line
Snyder
ZMIZ1
ENCSR000ESE
r=0.87

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000CFI
r=0.78

small heat map img

MEL cell line
Snyder
SIN3A
ENCSR000ETC
r=0.75

small heat map img

MEL cell line
Snyder
TBP
ENCSR000EUB
r=0.73

small heat map img

MEL cell line
Snyder
KAT2A
ENCSR000ESM
r=0.72

small heat map img

MEL cell line
Snyder
MAX
ENCSR000ETX
r=0.70

small heat map img

MEL cell line
Snyder
MXI1
ENCSR000ETN
r=0.69

small heat map img

MEL cell line
Snyder
MAZ
ENCSR000ESL
r=0.68

small heat map img

MEL cell line
Snyder
E2F4
ENCSR000ETY
r=0.68

small heat map img

MEL cell line
Snyder
RCOR1
ENCSR000ESI
r=0.65

small heat map img

MEL cell line
Snyder
HCFC1
ENCSR000ESG
r=0.63

small heat map img

MEL cell line
Snyder
MYC
ENCSR000EUA
r=0.62

small heat map img

MEL cell line
Snyder
MYB
ENCSR000ETR
r=0.61

small heat map img

MEL cell line
Snyder
GABPA
ENCSR000ESK
r=0.60

small heat map img

MEL cell line
Snyder
ETS1
ENCSR000ETB
r=0.60

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ETK
r=0.59

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETP
r=0.58

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000ETA
r=0.56

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ESY
r=0.54

small heat map img

MEL cell line
Snyder
ZKSCAN1
ENCSR000ESX
r=0.54

small heat map img

MEL cell line
Snyder
BHLHE40
ENCSR000ESH
r=0.52

small heat map img

MEL cell line
Snyder
CHD2
ENCSR000ETO
r=0.52

small heat map img

MEL cell line
Snyder
SMC3
ENCSR000ETL
r=0.52

small heat map img

MEL cell line
Snyder
ZC3H11A
ENCSR000ESF
r=0.51

small heat map img

MEL cell line
Snyder
JUND
ENCSR000ETZ
r=0.50

small heat map img

MEL cell line
Snyder
UBTF
ENCSR000ESJ
r=0.48

small heat map img

MEL cell line
Snyder
CHD1
ENCSR000ESN
r=0.44

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETV
r=0.42

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000CFH
r=0.39

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETT
r=0.35

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETF
r=0.33

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETS
r=0.28

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000EUG
r=0.27

small heat map img

MEL cell line
Snyder
ZNF384
ENCSR000ESD
r=0.27

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETE
r=0.21

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETQ
r=0.20

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETW
r=0.16

small heat map img

MEL cell line
Snyder
TAL1
ENCSR000DIA
r=0.07

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000DIP
r=-0.03

small heat map img
9,153 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help