NANOG

The protein encoded by this gene is a DNA binding homeobox transcription factor involved in embryonic stem (ES) cell proliferation, renewal, and pluripotency. The encoded protein can block ES cell differentiation and can also autorepress its own expression in differentiating cells. Two transcript variants encoding different isoforms have been found for this gene. RefSeq, Sep 2015
NANOG (pron. nanOg) is a transcription factor critically involved with self-renewal of undifferentiated embryonic stem cells.wikipedia

NANOG

PDB image
PDB 2KT0

PDB 2KT0
ENCODE experiments
Ensemble search
Entrez 79923
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia Homeobox_protein_NANOG

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

ES-E14 - Hardison - ENCSR779CZG

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

ES-E14 - Hardison - ENCSR779CZG

1.
14 / 500
2.5e-80
GTGGCTGAACAATAGAGCGATCTAGGGAGG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.98
2.
15 / 500
1.3e-73
GGCCTCTCAGCAGGTAGCAGTATCTTGGAG
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.77
3.
90 / 500
1.6e-40
TTTTGTTATGTAAAT
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 1.04
4.
67 / 500
3.8e-19
GGGTGGGG
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 0.61
5.
109 / 500
9.3e-17
CAGAGAAAAAGAAAG
small heat map img p-value: 0.77
pct_center: 0.33
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at NANOG peaks

ES-E14 - Hardison - ENCSR779CZG

ES-E14
Hardison
NANOG
ENCSR779CZG
r=1.00

small heat map img

ES-E14
Hardison
H3K4me1
ENCSR000ADK
r=0.33

small heat map img

ES-E14
Hardison
H3K4me1
ENCSR032JUI
r=0.25

small heat map img

ES-E14
Hardison
H3K27ac
ENCSR000CGQ
r=0.24

small heat map img

ES-E14
Hardison
H3K4me1
ENCSR000CGN
r=0.21

small heat map img

ES-E14
Hardison
H3K4me3
ENCSR000ADL
r=0.20

small heat map img

ES-E14
Hardison
H3K4me3
ENCSR212KGS
r=0.14

small heat map img

ES-E14
Hardison
H3K9ac
ENCSR000CGP
r=0.10

small heat map img

ES-E14
Hardison
H3K9me3
ENCSR000ADM
r=0.08

small heat map img

ES-E14
Hardison
H3K4me3
ENCSR000CGO
r=0.07

small heat map img

ES-E14
Hardison
H3K9me3
ENCSR857MYS
r=-0.01

small heat map img

ES-E14
Hardison
H3K36me3
ENCSR000CGR
r=-0.01

small heat map img

ES-E14
Hardison
H3K36me3
ENCSR253QPK
r=-0.06

small heat map img

ES-E14
Hardison
H3K27me3
ENCSR059MBO
r=-0.09

small heat map img
6,511 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at NANOG peaks

ES-E14 - Hardison - ENCSR779CZG

ES-E14
Hardison
NANOG
ENCSR779CZG
r=1.00

small heat map img

ES-E14
Hardison
HCFC1
ENCSR000ERX
r=0.40

small heat map img

ES-E14
Hardison
ZC3H11A
ENCSR000ERW
r=0.30

small heat map img

ES-E14
Hardison
ZNF384
ENCSR000ERV
r=0.29

small heat map img

ES-E14
Hardison
CTCF
ENCSR362VNF
r=0.12

small heat map img
6,511 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help