IRF4

The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene. RefSeq, Aug 2010
Interferon regulatory factor 4 also known as MUM1 is a protein that in humans is encoded by the IRF4 gene, located at 6p25-p23. The MUM1 symbol is polysemous; although it is an older synonym for IRF4 (HGNC:6119), it is also the current HGNC official symbol for melanoma associated antigen (mutated) 1 (HGNC:29641; located at 19p13.3).wikipedia

IRF4

PDB image
PDB 2DLL

PDB 2DLL
ENCODE experiments
Ensemble search
Entrez 3662
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia IRF4

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

CH12.LX - Snyder - ENCSR743ZJL

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

CH12.LX - Snyder - ENCSR743ZJL

1.
286 / 500
2.9e-550
AAAAAGAGGAACTGAAACT
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 1.11
2.
263 / 500
4.4e-239
TGAGTCATATCGAAA
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 1.87
3.
8 / 500
1.7e-29
AGAAAGCCCCGACCACAAGGCAGGTGCAGA
small heat map img p-value: 0.01
pct_center: 0.11
pct_ratio: 0.58
4.
11 / 500
3.4e-24
TCTCTGTTTGTGTGTGCGTGTGTGTGTGTT
small heat map img p-value: 0.83
pct_center: 0.21
pct_ratio: 0.41
5.
32 / 500
1.5e-15
GGGGGTGGGGG
small heat map img p-value: 0.05
pct_center: 0.33
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at IRF4 peaks

No histone modification ChIP-seq data are available in the corresponding cell type


Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at IRF4 peaks

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help