GATA2

This gene encodes a member of the GATA family of zinc-finger transcription factors that are named for the consensus nucleotide sequence they bind in the promoter regions of target genes. The encoded protein plays an essential role in regulating transcription of genes involved in the development and proliferation of hematopoietic and endocrine cell lineages. Alternative splicing results in multiple transcript variants.RefSeq, Mar 2009
GATA2 is a human gene which makes a protein called GATA binding protein 2 - a transcription factor.wikipedia

GATA2


ENCODE experiments
Ensemble search
Entrez 2624
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia GATA2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

G1E - Hardison - ENCSR000DIE

loading

G1E-ER4 - Hardison - ENCSR000DID

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

G1E - Hardison - ENCSR000DIE

1.
263 / 500
3.8e-204
GGAGATAAGAA
small heat map img p-value: 0.00
pct_center: 0.56
pct_ratio: 3.72
2.
9 / 500
5.2e-57
GGTTAGGGTTAGGGTTAGGGTTAGGG
small heat map img p-value: 0.65
pct_center: 0.16
pct_ratio: 0.59
3.
7 / 500
7.4e-35
GGTTAGGGTTAGGGTTAGGGTTAGGG
small heat map img p-value: 0.15
pct_center: 0.13
pct_ratio: 0.77
4.
58 / 500
5.5e-17
GTGTGTGCATGTCTG
small heat map img p-value: 0.00
pct_center: 0.38
pct_ratio: 0.62
5.
5 / 500
0.0000077
GTGCTGTCTGTGCTGTGCTGT
small heat map img p-value: 0.10
pct_center: 0.20
pct_ratio: 0.65
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

G1E-ER4 - Hardison - ENCSR000DID

1.
500 / 500
7.1e-247
GTGTGCATGGGTGTG
small heat map img p-value: 0.46
pct_center: 0.59
pct_ratio: 0.62
2.
25 / 500
6.0e-209
GGGTTAGGGTTAGGGTTAGGGTTA
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 1.18
3.
143 / 500
2.6e-118
GTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 0.59
4.
97 / 500
1.0e-124
TGTGTGCATGT
small heat map img p-value: 0.43
pct_center: 0.37
pct_ratio: 0.59
5.
21 / 500
1.4e-89
GGTTAGGGTTAGGGTTAGGGTTAGG
small heat map img p-value: 0.00
pct_center: 0.44
pct_ratio: 0.67
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at GATA2 peaks

G1E - Hardison - ENCSR000DIE

G1E
Hardison
GATA2
ENCSR000DIE
r=1.00

small heat map img

G1E
Hardison
H3K4me3
ENCSR000DIX
r=0.15

small heat map img

G1E
Hardison
H3K4me1
ENCSR000DJB
r=0.09

small heat map img

G1E
Hardison
H3K9me3
ENCSR000DHM
r=0.02

small heat map img

G1E
Hardison
H3K27me3
ENCSR000DHX
r=-0.01

small heat map img

G1E
Hardison
H3K36me3
ENCSR000DHV
r=-0.08

small heat map img
349 peaks (download )

G1E-ER4 - Hardison - ENCSR000DID

G1E-ER4
Hardison
GATA2
ENCSR000DID
r=1.00

small heat map img

G1E-ER4
Hardison
H3K9me3
ENCSR000DHJ
r=0.28

small heat map img

G1E-ER4
Hardison
H3K4me3
ENCSR000DIW
r=0.13

small heat map img

G1E-ER4
Hardison
H3K36me3
ENCSR000DHS
r=0.12

small heat map img

G1E-ER4
Hardison
H3K4me1
ENCSR000DIY
r=0.12

small heat map img

G1E-ER4
Hardison
H3K27me3
ENCSR000DIZ
r=0.10

small heat map img
523 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at GATA2 peaks

G1E - Hardison - ENCSR000DIE

G1E
Hardison
GATA2
ENCSR000DIE
r=1.00

small heat map img

G1E
Hardison
TAL1
ENCSR000DIN
r=0.52

small heat map img

G1E
Hardison
CTCF
ENCSR000DIS
r=0.18

small heat map img

G1E
Hardison
GATA1
ENCSR000DIC
r=0.10

small heat map img
349 peaks (download )

G1E-ER4 - Hardison - ENCSR000DID

G1E-ER4
Hardison
GATA2
ENCSR000DID
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.66

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.62

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.57

small heat map img

G1E-ER4
Hardison
CTCF
ENCSR000DIR
r=0.54

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.54

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.52

small heat map img

G1E-ER4
Hardison
TAL1
ENCSR000DIM
r=0.49

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.47

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.39

small heat map img
523 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help