GATA1

This gene encodes a protein which belongs to the GATA family of transcription factors. The protein plays an important role in erythroid development by regulating the switch of fetal hemoglobin to adult hemoglobin. Mutations in this gene have been associated with X-linked dyserythropoietic anemia and thrombocytopenia. RefSeq, Jul 2008
Erythroid transcription factor also known as GATA-binding factor 1 or GATA-1 is a protein that in humans is encoded by the GATA1 gene. GATA-1 is a member of the GATA transcription factor family and is a key mediator of the development of specific types of blood cells from their precursor cells, termed hematopoietic progenitors or precursors.wikipedia

GATA1


ENCODE experiments
Ensemble search
Entrez 2623
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia GATA1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

G1E-ER4 - Hardison - ENCSR000DGX

loading

G1E-ER4 - Hardison - ENCSR000DGY

loading

G1E-ER4 - Hardison - ENCSR000DGZ

loading

G1E-ER4 - Hardison - ENCSR000DHA

loading

G1E-ER4 - Hardison - ENCSR000DHB

loading

G1E-ER4 - Hardison - ENCSR000DHC

loading

G1E-ER4 - Hardison - ENCSR000DIQ

loading

megakaryocyte - Hardison - ENCSR000DIJ

loading

MEL cell line - Snyder - ENCSR000ETA

loading

MEL cell line - Snyder - ENCSR000EUG

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

G1E-ER4 - Hardison - ENCSR000DHA

1.
284 / 500
1.4e-83
AGATAAGA
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 2.60
2.
38 / 500
1.5e-78
AGATAGATAGACAGATAGATA
small heat map img p-value: 0.30
pct_center: 0.20
pct_ratio: 0.47
3.
18 / 500
2.5e-37
AGATAGATAGATAGATAGA
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.56
4.
24 / 500
3.5e-15
GGGGTGGGGTTAGGGTGAGGGTGAGGGTG
small heat map img p-value: 0.99
pct_center: 0.25
pct_ratio: 0.47
5.
69 / 500
0.0000010
CAGACAGCAG
small heat map img p-value: 0.05
pct_center: 0.27
pct_ratio: 0.64
MEME output

G1E-ER4 - Hardison - ENCSR000DHB

1.
270 / 500
4.8e-103
CAGATAAG
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 2.69
2.
43 / 500
9.0e-39
TATCTGTCTGTGTGTCTGTGT
small heat map img p-value: 0.14
pct_center: 0.24
pct_ratio: 0.45
3.
91 / 500
1.5e-12
GAGCAGAGGGAGAGG
small heat map img p-value: 1.00
pct_center: 0.41
pct_ratio: 0.51
4.
9 / 500
0.0000050
GATAGATAGATAGATAGA
small heat map img p-value: 0.65
pct_center: 0.12
pct_ratio: 0.47
5.
29 / 500
2.6
GGGATATGAGTGCGTGTGTGTGTGTGTGTG
small heat map img p-value: 0.44
pct_center: 0.28
pct_ratio: 0.50
MEME output

G1E-ER4 - Hardison - ENCSR000DHC

1.
336 / 500
2.5e-146
CAGATAAGAA
small heat map img p-value: 0.00
pct_center: 0.46
pct_ratio: 3.07
2.
21 / 500
4.4e-12
GGGGTGAGGGCTGGGGTTAGGGTTGGGGAG
small heat map img p-value: 0.99
pct_center: 0.18
pct_ratio: 0.47
3.
71 / 500
5.0e-9
TGTGGTTT
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.88
4.
14 / 500
0.000063
CTGGCCAGGTGACTCAGCAGT
small heat map img p-value: 0.84
pct_center: 0.11
pct_ratio: 0.49
5.
43 / 500
0.0011
AGCCTGTG
small heat map img p-value: 0.03
pct_center: 0.19
pct_ratio: 0.59
MEME output

G1E-ER4 - Hardison - ENCSR000DGY

1.
21 / 500
6.1e-86
AGATAGATAGATAGATAGATAGATA
small heat map img p-value: 0.76
pct_center: 0.16
pct_ratio: 0.51
2.
264 / 500
1.4e-58
AGATAAGA
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 2.06
3.
6 / 500
8.8e-25
GAGCCATAGTGGCTATGGATTCCAGAAGA
small heat map img p-value: 0.04
pct_center: 0.07
pct_ratio: 0.52
4.
16 / 500
3.7e-20
TGTGTGTGTGTGTGTGTGTGTGCATGGGTG
small heat map img p-value: 1.00
pct_center: 0.21
pct_ratio: 0.39
5.
19 / 500
1.1e-15
TAGATAGATAGATAGATAGAT
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.56
MEME output

G1E-ER4 - Hardison - ENCSR000DGX

1.
343 / 500
2.2e-77
AGAGAGATAAG
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 1.82
2.
20 / 500
6.8e-45
AGATAGATAGATAGA
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.57
3.
20 / 500
1.1e-9
AGATAGATAGA
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.59
4.
15 / 500
4.0e-16
AGATAGATAGATAGA
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.59
5.
36 / 500
7.7e-11
TCTGTGGGTGTGGGTGTGTGT
small heat map img p-value: 1.00
pct_center: 0.21
pct_ratio: 0.42
MEME output

G1E-ER4 - Hardison - ENCSR000DGZ

1.
53 / 500
5.5e-131
GTGTGTGTGTATGTGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.46
2.
40 / 500
3.3e-93
GTGTGTGTGTATGTGTGTATGTGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.51
3.
215 / 500
1.8e-89
AGATAAGA
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 2.72
4.
37 / 500
5.5e-22
GTGCAGGAGGAGGAGGGGGAGCAGGGGGAG
small heat map img p-value: 1.00
pct_center: 0.37
pct_ratio: 0.52
5.
40 / 500
8.9e-18
TGTGTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.52
MEME output

G1E-ER4 - Hardison - ENCSR000DIQ

1.
343 / 500
9.2e-178
AGATAAGA
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 2.86
2.
90 / 500
9.9e-12
CAGGGGCAGGCAGGA
small heat map img p-value: 0.96
pct_center: 0.38
pct_ratio: 0.51
3.
59 / 500
0.0000033
CTGTGTGT
small heat map img p-value: 0.93
pct_center: 0.21
pct_ratio: 0.57
4.
42 / 500
0.0013
GGCAGCAGCAG
small heat map img p-value: 0.08
pct_center: 0.23
pct_ratio: 0.67
5.
72 / 500
8.7e+2
TGAGGGCTGAG
small heat map img p-value: 0.79
pct_center: 0.31
pct_ratio: 0.53
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Snyder - ENCSR000ETA

1.
491 / 500
5.0e-497
CTGGGGGGGGCAGATAAG
small heat map img p-value: 0.00
pct_center: 0.37
pct_ratio: 3.82
2.
245 / 500
8.1e-75
AGATAAGA
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 3.54
3.
78 / 500
3.9e-18
GCAGGAAG
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 0.62
4.
43 / 500
3.7e+2
GAAGGGTGGAGAGGG
small heat map img p-value: 0.33
pct_center: 0.35
pct_ratio: 0.52
5.
5 / 500
4.5e+4
AAAAACAAGGATGAGAAA
small heat map img p-value: 0.59
pct_center: 0.22
pct_ratio: 0.43
MEME output

MEL cell line - Snyder - ENCSR000EUG

1.
500 / 500
2.8e-393
ACAGATAAGA
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 3.84
2.
256 / 500
1.1e-36
ACAGGAAG
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 0.62
3.
256 / 500
3.1e-11
AGATAA
small heat map img p-value: 0.00
pct_center:
pct_ratio:
4.
34 / 500
0.037
CAGGGAGGCTGGTGGGGGGAG
small heat map img p-value: 0.45
pct_center: 0.26
pct_ratio: 0.49
5.
23 / 500
25
AGTGCCTGGCCTGGGGCTGGG
small heat map img p-value: 0.11
pct_center: 0.13
pct_ratio: 0.47
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

erythroblast - Hardison - ENCSR000DIL

1.
286 / 500
4.1e-176
CTGGGGGGCGCAGATAAGGG
small heat map img p-value: 0.00
pct_center: 0.54
pct_ratio: 2.93
2.
57 / 500
0.0000086
GGGGGGGAGGGAGGAGGCTCA
small heat map img p-value: 0.87
pct_center: 0.38
pct_ratio: 0.50
3.
7 / 500
0.0019
TGTTTGTTTGGTTTTGTTTTGTTTTTTTTT
small heat map img p-value: 1.00
pct_center: 0.15
pct_ratio: 0.27
4.
56 / 500
12
AGAAAAGCAGC
small heat map img p-value: 0.48
pct_center: 0.25
pct_ratio: 0.69
5.
47 / 500
1.4e+2
GCAGGCAG
small heat map img p-value: 0.20
pct_center: 0.27
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

megakaryocyte - Hardison - ENCSR000DIJ

1.
59 / 500
2.5e-230
GGATAGATTGATAGATAGAGAGATGGATAG
small heat map img p-value: 0.97
pct_center: 0.25
pct_ratio: 0.46
2.
298 / 500
3.8e-138
ACAGATAAGGA
small heat map img p-value: 0.00
pct_center: 0.38
pct_ratio: 3.15
3.
195 / 500
2.2e-111
ACAGGAAG
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 1.03
4.
21 / 500
7.0e-56
TAGATAGATAGATAGATAGAT
small heat map img p-value: 0.02
pct_center: 0.08
pct_ratio: 0.39
5.
14 / 500
5.2e-73
GAATGGAATGGAATGGAATGGAATGGAATG
small heat map img p-value: 0.81
pct_center: 0.08
pct_ratio: 0.43
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at GATA1 peaks

G1E-ER4 - Hardison - ENCSR000DGX

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.88

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.82

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.82

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.73

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.72

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.64

small heat map img

G1E-ER4
Hardison
H3K4me1
ENCSR000DIY
r=0.27

small heat map img

G1E-ER4
Hardison
H3K4me3
ENCSR000DIW
r=0.14

small heat map img

G1E-ER4
Hardison
H3K9me3
ENCSR000DHJ
r=0.02

small heat map img

G1E-ER4
Hardison
H3K36me3
ENCSR000DHS
r=-0.03

small heat map img

G1E-ER4
Hardison
H3K27me3
ENCSR000DIZ
r=-0.07

small heat map img
10,000 randomly-selected peaks from a total of 15,699 (download )

G1E-ER4 - Hardison - ENCSR000DGY

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.85

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.77

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.75

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.67

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.65

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.58

small heat map img

G1E-ER4
Hardison
H3K4me1
ENCSR000DIY
r=0.26

small heat map img

G1E-ER4
Hardison
H3K4me3
ENCSR000DIW
r=0.13

small heat map img

G1E-ER4
Hardison
H3K9me3
ENCSR000DHJ
r=0.02

small heat map img

G1E-ER4
Hardison
H3K36me3
ENCSR000DHS
r=-0.03

small heat map img

G1E-ER4
Hardison
H3K27me3
ENCSR000DIZ
r=-0.07

small heat map img
10,000 randomly-selected peaks from a total of 22,729 (download )

G1E-ER4 - Hardison - ENCSR000DGZ

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.85

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.82

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.80

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.77

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.73

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.72

small heat map img

G1E-ER4
Hardison
H3K4me1
ENCSR000DIY
r=0.22

small heat map img

G1E-ER4
Hardison
H3K4me3
ENCSR000DIW
r=0.19

small heat map img

G1E-ER4
Hardison
H3K9me3
ENCSR000DHJ
r=0.00

small heat map img

G1E-ER4
Hardison
H3K36me3
ENCSR000DHS
r=-0.04

small heat map img

G1E-ER4
Hardison
H3K27me3
ENCSR000DIZ
r=-0.08

small heat map img
7,512 peaks (download )

G1E-ER4 - Hardison - ENCSR000DHA

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.79

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.79

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.78

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.78

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.74

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.71

small heat map img

G1E-ER4
Hardison
H3K4me1
ENCSR000DIY
r=0.20

small heat map img

G1E-ER4
Hardison
H3K4me3
ENCSR000DIW
r=0.17

small heat map img

G1E-ER4
Hardison
H3K9me3
ENCSR000DHJ
r=0.05

small heat map img

G1E-ER4
Hardison
H3K36me3
ENCSR000DHS
r=-0.06

small heat map img

G1E-ER4
Hardison
H3K27me3
ENCSR000DIZ
r=-0.08

small heat map img
4,796 peaks (download )

G1E-ER4 - Hardison - ENCSR000DHB

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.84

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.82

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.81

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.80

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.75

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.68

small heat map img

G1E-ER4
Hardison
H3K4me1
ENCSR000DIY
r=0.25

small heat map img

G1E-ER4
Hardison
H3K4me3
ENCSR000DIW
r=0.17

small heat map img

G1E-ER4
Hardison
H3K9me3
ENCSR000DHJ
r=0.01

small heat map img

G1E-ER4
Hardison
H3K36me3
ENCSR000DHS
r=-0.03

small heat map img

G1E-ER4
Hardison
H3K27me3
ENCSR000DIZ
r=-0.07

small heat map img
10,000 randomly-selected peaks from a total of 13,343 (download )

G1E-ER4 - Hardison - ENCSR000DHC

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.88

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.86

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.78

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.71

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.67

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.61

small heat map img

G1E-ER4
Hardison
H3K4me1
ENCSR000DIY
r=0.29

small heat map img

G1E-ER4
Hardison
H3K4me3
ENCSR000DIW
r=0.15

small heat map img

G1E-ER4
Hardison
H3K9me3
ENCSR000DHJ
r=0.02

small heat map img

G1E-ER4
Hardison
H3K36me3
ENCSR000DHS
r=-0.04

small heat map img

G1E-ER4
Hardison
H3K27me3
ENCSR000DIZ
r=-0.07

small heat map img
8,781 peaks (download )

G1E-ER4 - Hardison - ENCSR000DIQ

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.86

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.83

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.81

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.79

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.73

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.72

small heat map img

G1E-ER4
Hardison
H3K4me1
ENCSR000DIY
r=0.23

small heat map img

G1E-ER4
Hardison
H3K4me3
ENCSR000DIW
r=0.17

small heat map img

G1E-ER4
Hardison
H3K9me3
ENCSR000DHJ
r=-0.01

small heat map img

G1E-ER4
Hardison
H3K36me3
ENCSR000DHS
r=-0.05

small heat map img

G1E-ER4
Hardison
H3K27me3
ENCSR000DIZ
r=-0.08

small heat map img
7,819 peaks (download )

MEL cell line - Snyder - ENCSR000ETA

MEL cell line
Snyder
GATA1
ENCSR000ETA
r=1.00

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000EUG
r=0.83

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADY
r=0.41

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADQ
r=0.38

small heat map img

MEL cell line
Snyder
H3K27ac
ENCSR000CEV
r=0.38

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000CES
r=0.37

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000CEW
r=0.36

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000AEA
r=0.32

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000ADR
r=0.28

small heat map img

MEL cell line
Snyder
H3K9ac
ENCSR000CEU
r=0.28

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000CEX
r=0.23

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000AEB
r=0.16

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000ADT
r=0.14

small heat map img

MEL cell line
Snyder
H3K79me2
ENCSR000CET
r=0.14

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADW
r=0.13

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000ADX
r=0.09

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADP
r=0.07

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000CER
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 23,793 (download )

MEL cell line - Snyder - ENCSR000EUG

MEL cell line
Snyder
GATA1
ENCSR000EUG
r=1.00

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000ETA
r=0.80

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADQ
r=0.42

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000CES
r=0.42

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADY
r=0.38

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000CEW
r=0.37

small heat map img

MEL cell line
Snyder
H3K27ac
ENCSR000CEV
r=0.34

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000AEA
r=0.24

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000ADR
r=0.24

small heat map img

MEL cell line
Snyder
H3K9ac
ENCSR000CEU
r=0.23

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000CEX
r=0.17

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000ADT
r=0.15

small heat map img

MEL cell line
Snyder
H3K79me2
ENCSR000CET
r=0.14

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000AEB
r=0.13

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000ADX
r=0.11

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADW
r=0.08

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADP
r=0.05

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000CER
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 60,511 (download )

erythroblast - Hardison - ENCSR000DIL

erythroblast
Hardison
GATA1
ENCSR000DIL
r=1.00

small heat map img

erythroblast
Hardison
H3K4me3
ENCSR000DHG
r=0.04

small heat map img

erythroblast
Hardison
H3K9me3
ENCSR000DHN
r=0.01

small heat map img

erythroblast
Hardison
H3K36me3
ENCSR000DHL
r=-0.00

small heat map img
4,897 peaks (download )

megakaryocyte - Hardison - ENCSR000DIJ

megakaryocyte
Hardison
GATA1
ENCSR000DIJ
r=1.00

small heat map img
1,286 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at GATA1 peaks

G1E-ER4 - Hardison - ENCSR000DGX

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.88

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.82

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.82

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.73

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.72

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.64

small heat map img

G1E-ER4
Hardison
TAL1
ENCSR000DIM
r=0.45

small heat map img

G1E-ER4
Hardison
CTCF
ENCSR000DIR
r=0.10

small heat map img

G1E-ER4
Hardison
GATA2
ENCSR000DID
r=0.06

small heat map img
10,000 randomly-selected peaks from a total of 15,699 (download )

G1E-ER4 - Hardison - ENCSR000DGY

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.85

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.77

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.75

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.67

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.65

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.58

small heat map img

G1E-ER4
Hardison
TAL1
ENCSR000DIM
r=0.37

small heat map img

G1E-ER4
Hardison
CTCF
ENCSR000DIR
r=0.09

small heat map img

G1E-ER4
Hardison
GATA2
ENCSR000DID
r=0.06

small heat map img
10,000 randomly-selected peaks from a total of 22,729 (download )

G1E-ER4 - Hardison - ENCSR000DGZ

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.85

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.82

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.80

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.77

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.73

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.72

small heat map img

G1E-ER4
Hardison
TAL1
ENCSR000DIM
r=0.62

small heat map img

G1E-ER4
Hardison
CTCF
ENCSR000DIR
r=0.16

small heat map img

G1E-ER4
Hardison
GATA2
ENCSR000DID
r=0.13

small heat map img
7,512 peaks (download )

G1E-ER4 - Hardison - ENCSR000DHA

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.79

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.79

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.78

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.78

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.74

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.71

small heat map img

G1E-ER4
Hardison
TAL1
ENCSR000DIM
r=0.55

small heat map img

G1E-ER4
Hardison
CTCF
ENCSR000DIR
r=0.13

small heat map img

G1E-ER4
Hardison
GATA2
ENCSR000DID
r=0.07

small heat map img
4,796 peaks (download )

G1E-ER4 - Hardison - ENCSR000DHB

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.84

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.82

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.81

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.80

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.75

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.68

small heat map img

G1E-ER4
Hardison
TAL1
ENCSR000DIM
r=0.53

small heat map img

G1E-ER4
Hardison
CTCF
ENCSR000DIR
r=0.13

small heat map img

G1E-ER4
Hardison
GATA2
ENCSR000DID
r=0.11

small heat map img
10,000 randomly-selected peaks from a total of 13,343 (download )

G1E-ER4 - Hardison - ENCSR000DHC

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.88

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.86

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.78

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.71

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.67

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.61

small heat map img

G1E-ER4
Hardison
TAL1
ENCSR000DIM
r=0.44

small heat map img

G1E-ER4
Hardison
CTCF
ENCSR000DIR
r=0.09

small heat map img

G1E-ER4
Hardison
GATA2
ENCSR000DID
r=0.05

small heat map img
8,781 peaks (download )

G1E-ER4 - Hardison - ENCSR000DIQ

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.86

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.83

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.81

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.79

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.73

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.72

small heat map img

G1E-ER4
Hardison
TAL1
ENCSR000DIM
r=0.62

small heat map img

G1E-ER4
Hardison
CTCF
ENCSR000DIR
r=0.13

small heat map img

G1E-ER4
Hardison
GATA2
ENCSR000DID
r=0.10

small heat map img
7,819 peaks (download )

MEL cell line - Snyder - ENCSR000ETA

MEL cell line
Snyder
GATA1
ENCSR000ETA
r=1.00

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000EUG
r=0.83

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETV
r=0.78

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETP
r=0.77

small heat map img

MEL cell line
Snyder
RCOR1
ENCSR000ESI
r=0.76

small heat map img

MEL cell line
Snyder
ETS1
ENCSR000ETB
r=0.73

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ETK
r=0.69

small heat map img

MEL cell line
Snyder
TAL1
ENCSR000DIA
r=0.68

small heat map img

MEL cell line
Snyder
BHLHE40
ENCSR000ESH
r=0.66

small heat map img

MEL cell line
Snyder
MYB
ENCSR000ETR
r=0.66

small heat map img

MEL cell line
Snyder
MAZ
ENCSR000ESL
r=0.63

small heat map img

MEL cell line
Snyder
JUND
ENCSR000ETZ
r=0.63

small heat map img

MEL cell line
Snyder
SIN3A
ENCSR000ETC
r=0.62

small heat map img

MEL cell line
Snyder
CHD2
ENCSR000ETO
r=0.62

small heat map img

MEL cell line
Snyder
KAT2A
ENCSR000ESM
r=0.61

small heat map img

MEL cell line
Snyder
MYC
ENCSR000EUA
r=0.61

small heat map img

MEL cell line
Snyder
MAX
ENCSR000ETX
r=0.59

small heat map img

MEL cell line
Snyder
ZC3H11A
ENCSR000ESF
r=0.58

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ESY
r=0.56

small heat map img

MEL cell line
Snyder
GABPA
ENCSR000ESK
r=0.56

small heat map img

MEL cell line
Snyder
MXI1
ENCSR000ETN
r=0.55

small heat map img

MEL cell line
Snyder
ZKSCAN1
ENCSR000ESX
r=0.55

small heat map img

MEL cell line
Snyder
E2F4
ENCSR000ETY
r=0.54

small heat map img

MEL cell line
Snyder
ZMIZ1
ENCSR000ESE
r=0.52

small heat map img

MEL cell line
Snyder
SMC3
ENCSR000ETL
r=0.49

small heat map img

MEL cell line
Snyder
NELFE
ENCSR000ETU
r=0.45

small heat map img

MEL cell line
Snyder
TBP
ENCSR000EUB
r=0.44

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETF
r=0.42

small heat map img

MEL cell line
Snyder
ZNF384
ENCSR000ESD
r=0.41

small heat map img

MEL cell line
Snyder
UBTF
ENCSR000ESJ
r=0.41

small heat map img

MEL cell line
Snyder
CHD1
ENCSR000ESN
r=0.41

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETT
r=0.40

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000ETG
r=0.39

small heat map img

MEL cell line
Snyder
HCFC1
ENCSR000ESG
r=0.34

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETS
r=0.33

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000EUC
r=0.32

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000CFI
r=0.25

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETE
r=0.25

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETQ
r=0.22

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETW
r=0.20

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000CFH
r=0.19

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000DIP
r=0.09

small heat map img
10,000 randomly-selected peaks from a total of 23,793 (download )

MEL cell line - Snyder - ENCSR000EUG

MEL cell line
Snyder
GATA1
ENCSR000EUG
r=1.00

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETV
r=0.87

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETP
r=0.84

small heat map img

MEL cell line
Snyder
RCOR1
ENCSR000ESI
r=0.81

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000ETA
r=0.80

small heat map img

MEL cell line
Snyder
ETS1
ENCSR000ETB
r=0.77

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ETK
r=0.71

small heat map img

MEL cell line
Snyder
MYB
ENCSR000ETR
r=0.69

small heat map img

MEL cell line
Snyder
BHLHE40
ENCSR000ESH
r=0.68

small heat map img

MEL cell line
Snyder
CHD2
ENCSR000ETO
r=0.66

small heat map img

MEL cell line
Snyder
JUND
ENCSR000ETZ
r=0.64

small heat map img

MEL cell line
Snyder
MYC
ENCSR000EUA
r=0.64

small heat map img

MEL cell line
Snyder
SIN3A
ENCSR000ETC
r=0.62

small heat map img

MEL cell line
Snyder
TAL1
ENCSR000DIA
r=0.62

small heat map img

MEL cell line
Snyder
KAT2A
ENCSR000ESM
r=0.61

small heat map img

MEL cell line
Snyder
MAX
ENCSR000ETX
r=0.59

small heat map img

MEL cell line
Snyder
MAZ
ENCSR000ESL
r=0.59

small heat map img

MEL cell line
Snyder
ZC3H11A
ENCSR000ESF
r=0.56

small heat map img

MEL cell line
Snyder
MXI1
ENCSR000ETN
r=0.56

small heat map img

MEL cell line
Snyder
ZKSCAN1
ENCSR000ESX
r=0.55

small heat map img

MEL cell line
Snyder
E2F4
ENCSR000ETY
r=0.54

small heat map img

MEL cell line
Snyder
GABPA
ENCSR000ESK
r=0.53

small heat map img

MEL cell line
Snyder
ZMIZ1
ENCSR000ESE
r=0.52

small heat map img

MEL cell line
Snyder
CHD1
ENCSR000ESN
r=0.47

small heat map img

MEL cell line
Snyder
SMC3
ENCSR000ETL
r=0.46

small heat map img

MEL cell line
Snyder
ZNF384
ENCSR000ESD
r=0.46

small heat map img

MEL cell line
Snyder
NELFE
ENCSR000ETU
r=0.44

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETF
r=0.43

small heat map img

MEL cell line
Snyder
TBP
ENCSR000EUB
r=0.43

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ESY
r=0.41

small heat map img

MEL cell line
Snyder
UBTF
ENCSR000ESJ
r=0.39

small heat map img

MEL cell line
Snyder
HCFC1
ENCSR000ESG
r=0.32

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETS
r=0.29

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000EUC
r=0.29

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETT
r=0.29

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000ETG
r=0.28

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETW
r=0.25

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000CFI
r=0.20

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETE
r=0.17

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETQ
r=0.16

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000CFH
r=0.13

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000DIP
r=0.07

small heat map img
10,000 randomly-selected peaks from a total of 60,511 (download )

erythroblast - Hardison - ENCSR000DIL

erythroblast
Hardison
GATA1
ENCSR000DIL
r=1.00

small heat map img

erythroblast
Hardison
TAL1
ENCSR000DIB
r=0.72

small heat map img
4,897 peaks (download )

megakaryocyte - Hardison - ENCSR000DIJ

megakaryocyte
Hardison
GATA1
ENCSR000DIJ
r=1.00

small heat map img

megakaryocyte
Hardison
TAL1
ENCSR000DHE
r=0.67

small heat map img

megakaryocyte
Hardison
FLI1
ENCSR000DHD
r=0.43

small heat map img
1,286 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help