FLI1

This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. RefSeq, Aug 2012
Friend leukemia integration 1 transcription factor (FLI1), also known as transcription factor ERGB, is a protein that in humans is encoded by the FLI1 gene, which is a proto-oncogene.wikipedia

FLI1

PDB image
PDB 1FLI

PDB 1FLI 1X66 2YTU
ENCODE experiments
Ensemble search
Entrez 2313
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia FLI1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

megakaryocyte - Hardison - ENCSR000DHD

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

megakaryocyte - Hardison - ENCSR000DHD

1.
442 / 500
6.9e-440
ACCGGAAGTGG
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.72
2.
238 / 500
2.1e-57
CCGGAAGC
small heat map img p-value: 0.00
pct_center: 0.69
pct_ratio: 3.22
3.
7 / 500
1.3e-37
CTGACACACACACAGCAGAGGATGTGAGG
small heat map img p-value: 0.57
pct_center: 0.14
pct_ratio: 0.48
4.
11 / 500
0.0000024
GTGTGTGTCAGGGCC
small heat map img p-value: 0.16
pct_center: 0.18
pct_ratio: 0.55
5.
104 / 500
0.019
GGGGGCGGGGC
small heat map img p-value: 0.00
pct_center: 0.55
pct_ratio: 0.77
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at FLI1 peaks

megakaryocyte - Hardison - ENCSR000DHD

megakaryocyte
Hardison
FLI1
ENCSR000DHD
r=1.00

small heat map img
994 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at FLI1 peaks

megakaryocyte - Hardison - ENCSR000DHD

megakaryocyte
Hardison
FLI1
ENCSR000DHD
r=1.00

small heat map img

megakaryocyte
Hardison
GATA1
ENCSR000DIJ
r=0.38

small heat map img

megakaryocyte
Hardison
TAL1
ENCSR000DHE
r=0.35

small heat map img
994 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help