ELF1

This gene encodes an E26 transformation-specific related transcription factor. The encoded protein is primarily expressed in lymphoid cells and acts as both an enhancer and a repressor to regulate transcription of various genes. Alternative splicing results in multiple transcript variants. RefSeq, Feb 2009
E74-like factor 1 (ets domain transcription factor) is a protein that in humans is encoded by the ELF1 gene.wikipedia

ELF1


ENCODE experiments
Ensemble search
Entrez 1997
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia ELF1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

CH12.LX - Snyder - ENCSR293WTN

loading

MEL cell line - Snyder - ENCSR033OWC

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

CH12.LX - Snyder - ENCSR293WTN

1.
432 / 500
4.8e-568
ACCCGGAAGTG
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 3.01
2.
57 / 500
9.1e-169
GGGATTCGAACCCGGGACCTC
small heat map img p-value: 0.03
pct_center: 0.09
pct_ratio: 0.39
3.
47 / 500
3.2e-90
GGTAGAGCGTTGGACTCGTAA
small heat map img p-value: 0.00
pct_center: 0.07
pct_ratio: 0.58
4.
31 / 500
9.5e-67
TGCATGCTGGGAATTGTAGTT
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.69
5.
179 / 500
1.7e-45
CCGGAAGT
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 2.60
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Snyder - ENCSR033OWC

1.
500 / 500
3.3e-713
GAACCCGGAAGTGG
small heat map img p-value: 0.00
pct_center: 0.55
pct_ratio: 2.62
2.
48 / 500
1.3e-126
TGCATGCTGGGAATTGTAGTT
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.66
3.
232 / 500
2.3e-61
CCGGAAGT
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 2.84
4.
48 / 500
9.9e-31
GCGCATGCGCA
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.98
5.
99 / 500
2.8e-17
GGGGGCGGGGC
small heat map img p-value: 0.00
pct_center: 0.47
pct_ratio: 0.82
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at ELF1 peaks

No histone modification ChIP-seq data are available in the corresponding cell type


Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at ELF1 peaks

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help