E2F4

The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. RefSeq, Jul 2008
Transcription factor E2F4 is a protein that in humans is encoded by the E2F4 gene.wikipedia

E2F4

PDB image
PDB 1CF7

PDB 1CF7
ENCODE experiments
Ensemble search
Entrez 1874
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia E2F4

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

CH12.LX - Snyder - ENCSR000ERU

loading

MEL cell line - Snyder - ENCSR000ETY

loading

myocyte - Wold - ENCSR000AII

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

CH12.LX - Snyder - ENCSR000ERU

1.
393 / 500
1.5e-306
TGGGCGGGAAA
small heat map img p-value: 0.00
pct_center: 0.47
pct_ratio: 1.31
2.
26 / 500
2.0e-81
AAAAAAAAAAAAAAAAAAAAA
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.37
3.
124 / 500
6.4e-85
TTCTGATTGGCTG
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 1.71
4.
23 / 500
4.2e-53
CCTTCTGGGAGTTGTAGTTT
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.83
5.
43 / 500
2.2e-21
GCGCATGCGCAGA
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.89
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Snyder - ENCSR000ETY

1.
339 / 500
8.4e-374
GTGGCGGGAAA
small heat map img p-value: 0.00
pct_center: 0.77
pct_ratio: 1.69
2.
32 / 500
6.4e-39
AAAAAAAAAAAAAAAAAAAAA
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.43
3.
73 / 500
6.1e-36
TCTGATTGGCT
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 2.17
4.
12 / 500
1.1e-20
GCACTCTGGGAATTGTAGTCTTT
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.71
5.
65 / 500
4.6e-19
GCGCATGCGCA
small heat map img p-value: 0.00
pct_center: 0.44
pct_ratio: 1.14
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

myocyte - Wold - ENCSR000AII

1.
323 / 500
3.5e-301
GGGCGCGAAATTTGAAAT
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 1.66
2.
151 / 500
1.3e-109
TCTGATTGGCT
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 1.78
3.
150 / 500
6.3e-65
GGGGCGGGAAA
small heat map img p-value: 0.00
pct_center: 0.54
pct_ratio: 1.06
4.
86 / 500
8.1e-13
GGAGGGGGCGGGGCC
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 0.77
5.
35 / 500
0.0000014
ATGACGTCACG
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 1.42
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at E2F4 peaks

CH12.LX - Snyder - ENCSR000ERU

CH12.LX
Snyder
E2F4
ENCSR000ERU
r=1.00

small heat map img

CH12.LX
Snyder
H3K9ac
ENCSR000CGL
r=0.50

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000CGK
r=0.49

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000ADI
r=0.46

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000DHU
r=0.45

small heat map img

CH12.LX
Snyder
H3K27ac
ENCSR000CGJ
r=0.38

small heat map img

CH12.LX
Snyder
H3K4me2
ENCSR000CGI
r=0.37

small heat map img

CH12.LX
Snyder
H3K79me2
ENCSR000CGM
r=0.11

small heat map img

CH12.LX
Snyder
H3K27me3
ENCSR000DHY
r=0.04

small heat map img

CH12.LX
Snyder
H3K4me1
ENCSR000CGH
r=0.00

small heat map img

CH12.LX
Snyder
H3K4me1
ENCSR000DHQ
r=-0.01

small heat map img

CH12.LX
Snyder
H3K9me3
ENCSR000DHO
r=-0.11

small heat map img

CH12.LX
Snyder
H3K36me3
ENCSR000CFL
r=-0.13

small heat map img

CH12.LX
Snyder
H3K36me3
ENCSR000DHW
r=-0.21

small heat map img
2,851 peaks (download )

MEL cell line - Snyder - ENCSR000ETY

MEL cell line
Snyder
E2F4
ENCSR000ETY
r=1.00

small heat map img

MEL cell line
Snyder
H3K9ac
ENCSR000CEU
r=0.64

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000AEA
r=0.62

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000CEX
r=0.61

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000ADR
r=0.60

small heat map img

MEL cell line
Snyder
H3K27ac
ENCSR000CEV
r=0.56

small heat map img

MEL cell line
Snyder
H3K79me2
ENCSR000CET
r=0.35

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADQ
r=0.25

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000CER
r=0.20

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADW
r=0.19

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADY
r=0.16

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000AEB
r=0.12

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000ADT
r=0.12

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADP
r=0.11

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000CEW
r=0.09

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000CES
r=0.05

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000ADX
r=-0.06

small heat map img
525 peaks (download )

myocyte - Wold - ENCSR000AII

myocyte
Wold
E2F4
ENCSR000AII
r=1.00

small heat map img

myocyte
Wold
H3ac
ENCSR000AHU
r=0.32

small heat map img

myocyte
Wold
H3K4me3
ENCSR000AHT
r=0.32

small heat map img

myocyte
Wold
H3K4me2
ENCSR000AHS
r=0.22

small heat map img

myocyte
Wold
H3K27me3
ENCSR000AHM
r=0.02

small heat map img

myocyte
Wold
H3K79me2
ENCSR000AHN
r=-0.02

small heat map img

myocyte
Wold
H3K36me3
ENCSR000AHV
r=-0.13

small heat map img
4,321 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at E2F4 peaks

CH12.LX - Snyder - ENCSR000ERU

CH12.LX
Snyder
E2F4
ENCSR000ERU
r=1.00

small heat map img

CH12.LX
Snyder
KAT2A
ENCSR000EQU
r=0.74

small heat map img

CH12.LX
Snyder
SIN3A
ENCSR000EQY
r=0.67

small heat map img

CH12.LX
Snyder
RCOR1
ENCSR000EQZ
r=0.66

small heat map img

CH12.LX
Snyder
GABPA
ENCSR000EQS
r=0.66

small heat map img

CH12.LX
Snyder
MAX
ENCSR000ERL
r=0.64

small heat map img

CH12.LX
Snyder
MAZ
ENCSR000EQT
r=0.63

small heat map img

CH12.LX
Snyder
MYC
ENCSR000ERN
r=0.63

small heat map img

CH12.LX
Snyder
JUND
ENCSR000ERR
r=0.62

small heat map img

CH12.LX
Snyder
JUN
ENCSR000ERO
r=0.60

small heat map img

CH12.LX
Snyder
NELFE
ENCSR000ERD
r=0.59

small heat map img

CH12.LX
Snyder
CHD2
ENCSR000ERF
r=0.59

small heat map img

CH12.LX
Snyder
MXI1
ENCSR000ERE
r=0.58

small heat map img

CH12.LX
Snyder
MAFK
ENCSR000ERB
r=0.57

small heat map img

CH12.LX
Snyder
HCFC1
ENCSR000EQR
r=0.57

small heat map img

CH12.LX
Snyder
ETS1
ENCSR000ERA
r=0.55

small heat map img

CH12.LX
Snyder
ZC3H11A
ENCSR000EQQ
r=0.55

small heat map img

CH12.LX
Snyder
ZKSCAN1
ENCSR000EQW
r=0.54

small heat map img

CH12.LX
Snyder
ZMIZ1
ENCSR000EQP
r=0.54

small heat map img

CH12.LX
Snyder
POLR2A
ENCSR000ERQ
r=0.51

small heat map img

CH12.LX
Snyder
TBP
ENCSR000ERP
r=0.50

small heat map img

CH12.LX
Snyder
EP300
ENCSR000ERI
r=0.45

small heat map img

CH12.LX
Snyder
USF2
ENCSR000ERJ
r=0.44

small heat map img

CH12.LX
Snyder
BHLHE40
ENCSR000ERC
r=0.42

small heat map img

CH12.LX
Snyder
SMC3
ENCSR000ERG
r=0.40

small heat map img

CH12.LX
Snyder
ZNF384
ENCSR000EQO
r=0.36

small heat map img

CH12.LX
Snyder
CHD1
ENCSR000EQV
r=0.36

small heat map img

CH12.LX
Snyder
RAD21
ENCSR000ERK
r=0.32

small heat map img

CH12.LX
Snyder
UBTF
ENCSR000EQX
r=0.31

small heat map img

CH12.LX
Snyder
CTCF
ENCSR000ERM
r=0.26

small heat map img

CH12.LX
Snyder
CTCF
ENCSR000DIU
r=0.07

small heat map img

CH12.LX
Snyder
PAX5
ENCSR000DIH
r=-0.02

small heat map img
2,851 peaks (download )

MEL cell line - Snyder - ENCSR000ETY

MEL cell line
Snyder
E2F4
ENCSR000ETY
r=1.00

small heat map img

MEL cell line
Snyder
KAT2A
ENCSR000ESM
r=0.78

small heat map img

MEL cell line
Snyder
MAX
ENCSR000ETX
r=0.72

small heat map img

MEL cell line
Snyder
SIN3A
ENCSR000ETC
r=0.72

small heat map img

MEL cell line
Snyder
ETS1
ENCSR000ETB
r=0.65

small heat map img

MEL cell line
Snyder
RCOR1
ENCSR000ESI
r=0.65

small heat map img

MEL cell line
Snyder
TBP
ENCSR000EUB
r=0.64

small heat map img

MEL cell line
Snyder
NELFE
ENCSR000ETU
r=0.64

small heat map img

MEL cell line
Snyder
MAZ
ENCSR000ESL
r=0.63

small heat map img

MEL cell line
Snyder
ZMIZ1
ENCSR000ESE
r=0.63

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETP
r=0.63

small heat map img

MEL cell line
Snyder
HCFC1
ENCSR000ESG
r=0.63

small heat map img

MEL cell line
Snyder
MYB
ENCSR000ETR
r=0.63

small heat map img

MEL cell line
Snyder
CHD2
ENCSR000ETO
r=0.62

small heat map img

MEL cell line
Snyder
MYC
ENCSR000EUA
r=0.62

small heat map img

MEL cell line
Snyder
GABPA
ENCSR000ESK
r=0.61

small heat map img

MEL cell line
Snyder
MXI1
ENCSR000ETN
r=0.61

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000ETA
r=0.60

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ETK
r=0.60

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000EUC
r=0.59

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000ETG
r=0.58

small heat map img

MEL cell line
Snyder
JUND
ENCSR000ETZ
r=0.57

small heat map img

MEL cell line
Snyder
BHLHE40
ENCSR000ESH
r=0.55

small heat map img

MEL cell line
Snyder
ZC3H11A
ENCSR000ESF
r=0.54

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ESY
r=0.53

small heat map img

MEL cell line
Snyder
ZKSCAN1
ENCSR000ESX
r=0.53

small heat map img

MEL cell line
Snyder
SMC3
ENCSR000ETL
r=0.49

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000CFI
r=0.46

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETV
r=0.43

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETT
r=0.35

small heat map img

MEL cell line
Snyder
UBTF
ENCSR000ESJ
r=0.35

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000EUG
r=0.35

small heat map img

MEL cell line
Snyder
ZNF384
ENCSR000ESD
r=0.34

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000CFH
r=0.33

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETF
r=0.33

small heat map img

MEL cell line
Snyder
CHD1
ENCSR000ESN
r=0.32

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETS
r=0.28

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETE
r=0.24

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETQ
r=0.22

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETW
r=0.17

small heat map img

MEL cell line
Snyder
TAL1
ENCSR000DIA
r=0.06

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000DIP
r=0.00

small heat map img
525 peaks (download )

myocyte - Wold - ENCSR000AII

myocyte
Wold
E2F4
ENCSR000AII
r=1.00

small heat map img

myocyte
Wold
SRF
ENCSR000AIM
r=0.37

small heat map img

myocyte
Wold
POLR2A
ENCSR000AIX
r=0.31

small heat map img

myocyte
Wold
MAX
ENCSR000AIL
r=0.30

small heat map img

myocyte
Wold
MYOG
ENCSR000AIC
r=0.29

small heat map img

myocyte
Wold
TCF3
ENCSR000AIP
r=0.24

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIH
r=0.23

small heat map img

myocyte
Wold
MYOG
ENCSR000AID
r=0.22

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIR
r=0.20

small heat map img

myocyte
Wold
REST
ENCSR000AIS
r=0.18

small heat map img

myocyte
Wold
USF1
ENCSR000AIE
r=0.18

small heat map img

myocyte
Wold
TCF12
ENCSR000AIN
r=0.17

small heat map img

myocyte
Wold
CEBPB
ENCSR000AIB
r=0.12

small heat map img

myocyte
Wold
MYOG
ENCSR000AIW
r=0.08

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIT
r=-0.02

small heat map img
4,321 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help