CTCF

This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. RefSeq, Jul 2010
Transcriptional repressor CTCF also known as 11-zinc finger protein or CCCTC-binding factor is a transcription factor that in humans is encoded by the CTCF gene. CTCF is involved in many cellular processes, including transcriptional regulation, insulator activity, V(D)J recombination and regulation of chromatin architecture.wikipedia

CTCF

PDB image
PDB 1X6H

PDB 1X6H 2CT1
ENCODE experiments
Ensemble search
Entrez 10664
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia CTCF

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

bone marrow - Ren - ENCSR000CBL

loading

bone marrow macrophage - Ren - ENCSR000CFJ

loading

brain - Ren - ENCSR000CEH

loading

C2C12 - Wold - ENCSR000AIJ

loading

cerebellum - Ren - ENCSR000CBN

loading

CH12.LX - Hardison - ENCSR000DIU

loading

CH12.LX - Snyder - ENCSR000ERM

loading

cortical plate - Ren - ENCSR000CBO

loading

embryonic fibroblast - Ren - ENCSR000CBW

loading

ES-Bruce4 - Ren - ENCSR000CCB

loading

ES-E14 - Hardison - ENCSR362VNF

loading

G1E - Hardison - ENCSR000DIS

loading

G1E-ER4 - Hardison - ENCSR000DIR

loading

heart - Ren - ENCSR000CBI

loading

kidney - Ren - ENCSR000CBJ

loading

limb - Ren - ENCSR000CEB

loading

liver - Ren - ENCSR000CBU

loading

lung - Ren - ENCSR000CBV

loading

MEL cell line - Hardison - ENCSR000DIP

loading

MEL cell line - Ren - ENCSR000CFH

loading

MEL cell line - Snyder - ENCSR000ETE

loading

MEL cell line - Snyder - ENCSR000ETQ

loading

olfactory bulb - Ren - ENCSR000CDX

loading

small intestine - Ren - ENCSR000CED

loading

spleen - Ren - ENCSR000CBY

loading

testis - Ren - ENCSR000CEF

loading

thymus - Ren - ENCSR000CDZ

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

C2C12 - Wold - ENCSR000AIJ

1.
482 / 500
5.0e-782
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.91
pct_ratio: 2.91
2.
45 / 500
2.0e-9
ACTGCGCCCCCTGGTGGCCACAAGGGG
small heat map img p-value: 0.00
pct_center: 0.88
pct_ratio: 2.55
3.
70 / 500
0.012
CAGGAGCAACTGCAG
small heat map img p-value: 0.97
pct_center: 0.31
pct_ratio: 0.66
4.
11 / 500
6.5e+3
GGAGGCAATACGCCTGTGCCA
small heat map img p-value: 0.00
pct_center: 0.09
pct_ratio: 0.62
5.
4 / 500
4.9e+4
AGTTTTAGAGTTGGCTTGGGCAGTACTGA
small heat map img p-value: 0.39
pct_center: 0.10
pct_ratio: 0.50
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

CH12.LX - Hardison - ENCSR000DIU

1.
296 / 500
2.4e-558
GCCACTAGAGGGCGC
small heat map img p-value: 0.00
pct_center: 0.93
pct_ratio: 3.40
2.
110 / 500
1.6e-65
GGATGCAGTTCCCA
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 1.32
3.
14 / 500
1.5e-35
AGATGGTTGTGAGCCACCATGTGGGTG
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.57
4.
22 / 500
7.8e-17
TTTTTTTTTGTGTTTGTGTGTTTTGTTTGC
small heat map img p-value: 0.01
pct_center: 0.24
pct_ratio: 0.41
5.
19 / 500
2.3e-7
CAGATCCCCTGGAACTGGAGT
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.70
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

CH12.LX - Snyder - ENCSR000ERM

1.
461 / 500
3.6e-917
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.87
pct_ratio: 3.44
2.
115 / 500
4.5e-51
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 3.98
3.
30 / 500
1.8e-15
TAGGTTGCTTTTTTTTTTTTA
small heat map img p-value: 0.01
pct_center: 0.26
pct_ratio: 0.92
4.
28 / 500
0.65
GGGAACTGCAGGCA
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.81
5.
6 / 500
1.3e+5
CTGGGACATGGCAGACATGTGAACAAGCAA
small heat map img p-value: 0.97
pct_center: 0.07
pct_ratio: 0.51
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

ES-Bruce4 - Ren - ENCSR000CCB

1.
488 / 500
3.7e-1065
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.89
pct_ratio: 3.25
2.
7 / 500
7.6e-25
ACACTGTAGGACCTGGAATATGGCGAGAAA
small heat map img p-value: 0.90
pct_center: 0.08
pct_ratio: 0.40
3.
6 / 500
2.1e-16
ACTGAAAAAGGTGGAAAATTTAGAAATGT
small heat map img p-value: 0.01
pct_center: 0.15
pct_ratio: 0.39
4.
110 / 500
1.0e-9
GGCTGCAG
small heat map img p-value: 0.05
pct_center: 0.25
pct_ratio: 0.75
5.
5 / 500
0.0000063
AAAAACATGGAAAATGAGAAA
small heat map img p-value: 0.70
pct_center: 0.17
pct_ratio: 0.40
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

ES-E14 - Hardison - ENCSR362VNF

1.
312 / 500
1.3e-581
CCAGAAGAGGGCACC
small heat map img p-value: 0.00
pct_center: 0.89
pct_ratio: 2.46
2.
32 / 500
2.0e-190
CATGGTGGCTCACAACCATCTGTAATGAGA
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.94
3.
34 / 500
1.3e-122
TAGTTAAGAACACTGTCTGTGCTTTCAGAG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.90
4.
42 / 500
1.2e-53
TTGTTTGTCTGTATGTATGTAT
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.58
5.
70 / 500
3.4e-85
CCTGAGTGCAGTTCCCAGGGA
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 1.09
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

G1E - Hardison - ENCSR000DIS

1.
324 / 500
7.0e-566
GGCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.94
pct_ratio: 3.34
2.
131 / 500
8.1e-64
ATGTGTGGAACTGCA
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 1.24
3.
15 / 500
5.4e-7
TGGAGGAGGAGGAGGAGGAGGGGGAAGAG
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.46
4.
15 / 500
0.26
CACAAACAGAAGAAAGGAATAAAATAAA
small heat map img p-value: 0.70
pct_center: 0.19
pct_ratio: 0.36
5.
50 / 500
94
AGGCAGGAGAG
small heat map img p-value: 0.76
pct_center: 0.21
pct_ratio: 0.51
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

G1E-ER4 - Hardison - ENCSR000DIR

1.
286 / 500
1.1e-429
GGCCAGAAGAGGGCA
small heat map img p-value: 0.00
pct_center: 0.89
pct_ratio: 2.44
2.
25 / 500
4.8e-133
CTGGGAATTGAACTCAGGACCTCTGGAAGA
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.81
3.
38 / 500
7.3e-125
TTACAGATGGTTGTGAGCCACCATGTGGG
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 1.01
4.
38 / 500
5.2e-80
TCAGATCCCCTGGAACTGGAG
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.82
5.
19 / 500
7.4e-68
CTGGAGAGATGGCTCAGCGGTTAAGA
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.74
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Hardison - ENCSR000DIP

1.
228 / 500
1.0e-518
TGGCCAGCAGGGGGCACCAG
small heat map img p-value: 0.00
pct_center: 0.91
pct_ratio: 2.95
2.
21 / 500
2.9e-107
TGAGCCACCATGTGGTTGCTGGGAATTGAA
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.75
3.
14 / 500
5.4e-50
AAGAGCAGCCAGTGCTCTTAACCGCTGAG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.98
4.
57 / 500
1.6e-43
TTTTTTTTTTTTTTTTTTAGTTTTTTGTA
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 0.83
5.
36 / 500
2.2e-28
GTAACTCCAGTTCCAGGGGAT
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 1.10
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Ren - ENCSR000CFH

1.
465 / 500
7.4e-907
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 2.41
2.
48 / 500
0.000021
CAGCAGGAGGCGCTGCAGCCC
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 1.11
3.
5 / 500
0.00051
AGATCCCCTGGAACTGGAGTTATAGA
small heat map img p-value: 0.79
pct_center: 0.20
pct_ratio: 0.79
4.
19 / 500
2.6
TGTAGTTTTTTCTGC
small heat map img p-value: 0.02
pct_center: 0.15
pct_ratio: 0.44
5.
29 / 500
9.3e+2
GGGGCGGGGAGGGGGCGGGG
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 0.90
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MEL cell line - Snyder - ENCSR000ETQ

1.
473 / 500
6.8e-1095
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.90
pct_ratio: 3.69
2.
39 / 500
6.2e-18
TGCATGCAGTTCCCACGGAGG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 1.47
3.
41 / 500
9.1e-12
TGGCCACCAGAGGGC
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.90
4.
8 / 500
7.1e-7
ATGCCCTGGAACTGGAGTTACAGGCAGTGG
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.84
5.
36 / 500
0.0000057
AAAAAAAAAGAAAAA
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 1.00
MEME output

MEL cell line - Snyder - ENCSR000ETE

1.
466 / 500
4.8e-996
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.91
pct_ratio: 3.81
2.
37 / 500
9.2e-18
TGCATGCAGTACCCAAAGAGG
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 1.37
3.
35 / 500
1.4e-11
AAAAAAAAAAAAAAA
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 1.21
4.
11 / 500
0.045
TGGAACTGGAGTTACAGGTGGTTGTGA
small heat map img p-value: 0.04
pct_center: 0.19
pct_ratio: 1.08
5.
16 / 500
3.9
AGCCACCAGAGGGCA
small heat map img p-value: 0.00
pct_center: 0.66
pct_ratio: 2.61
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

bone marrow - Ren - ENCSR000CBL

1.
433 / 500
3.0e-733
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.88
pct_ratio: 2.59
2.
19 / 500
3.7e-18
TCCCCTGGAACTGGAGTTACAGAGGGGTG
small heat map img p-value: 0.02
pct_center: 0.24
pct_ratio: 0.75
3.
39 / 500
0.019
TGGGAACTGCAGGCA
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.85
4.
10 / 500
0.96
CAGAGAGCACGCCGGGAAAAA
small heat map img p-value: 0.24
pct_center: 0.18
pct_ratio: 0.51
5.
7 / 500
5.5e+3
TGCAAGAGCAGTAAG
small heat map img p-value: 0.89
pct_center: 0.10
pct_ratio: 0.56
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

bone marrow macrophage - Ren - ENCSR000CFJ

1.
338 / 500
3.7e-728
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.66
pct_ratio: 1.89
2.
29 / 500
9.9e-14
AAAAAAAAAAAAAAA
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.35
3.
49 / 500
3.7e-17
TGGCCACCAGAGGGC
small heat map img p-value: 0.00
pct_center: 0.59
pct_ratio: 1.92
4.
32 / 500
0.0041
CAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.37
pct_ratio: 1.73
5.
32 / 500
0.086
GGGGGTGGGGAGGGTGGGGAG
small heat map img p-value: 0.00
pct_center: 0.41
pct_ratio: 0.50
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

brain - Ren - ENCSR000CEH

1.
485 / 500
1.1e-1021
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 2.82
2.
74 / 500
1.5e-28
TGGCCACCAGGGGGCGCCA
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 2.80
3.
87 / 500
7.5e-20
GGGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.81
4.
17 / 500
7.6e+2
GGAAGTGAGGATCAG
small heat map img p-value: 0.91
pct_center: 0.14
pct_ratio: 0.54
5.
32 / 500
1.4e+3
AGAAAGAAAAT
small heat map img p-value: 0.20
pct_center: 0.19
pct_ratio: 0.44
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

cerebellum - Ren - ENCSR000CBN

1.
496 / 500
1.0e-1015
GGCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.90
pct_ratio: 3.58
2.
147 / 500
2.4e-24
AGCTGCAG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.80
3.
50 / 500
0.0056
GCAGAAGGAAGGCAG
small heat map img p-value: 0.31
pct_center: 0.24
pct_ratio: 0.50
4.
26 / 500
2.6e+3
AGGTCCTGCTGGCTG
small heat map img p-value: 0.16
pct_center: 0.23
pct_ratio: 0.59
5.
18 / 500
5.3e+4
TGGGGAACTGCACCT
small heat map img p-value: 0.36
pct_center: 0.14
pct_ratio: 0.76
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

cortical plate - Ren - ENCSR000CBO

1.
485 / 500
1.3e-991
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.87
pct_ratio: 3.40
2.
106 / 500
1.4e-39
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.95
3.
70 / 500
2.0e-32
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.79
pct_ratio: 3.78
4.
37 / 500
2.9e+3
CAGAGCTG
small heat map img p-value: 0.01
pct_center: 0.19
pct_ratio: 0.62
5.
53 / 500
5.6e+2
AGCCAGGA
small heat map img p-value: 0.46
pct_center: 0.14
pct_ratio: 0.49
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

embryonic fibroblast - Ren - ENCSR000CBW

1.
499 / 500
1.7e-970
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.67
pct_ratio: 2.06
2.
171 / 500
8.3e-16
GAGCAGCA
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.80
3.
29 / 500
0.000058
CCACCAGAGGGCGCTGTGGAC
small heat map img p-value: 0.00
pct_center: 0.54
pct_ratio: 1.99
4.
20 / 500
2.9e+3
TGGCCAGCAGTGCTG
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.66
5.
14 / 500
1.5e+5
GTGTGGGCACA
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.64
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

heart - Ren - ENCSR000CBI

1.
500 / 500
1.6e-1177
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.89
pct_ratio: 3.61
2.
113 / 500
0.000050
CTGCAGTG
small heat map img p-value: 0.07
pct_center: 0.16
pct_ratio: 0.68
3.
23 / 500
1.5e+4
TGGAGGAAGAGGAGA
small heat map img p-value: 1.00
pct_center: 0.26
pct_ratio: 0.53
4.
11 / 500
6.2e+4
CTTGGTTTTTG
small heat map img p-value: 0.80
pct_center: 0.12
pct_ratio: 0.51
5.
33 / 500
7.1e+5
AGGCTGGCCTG
small heat map img p-value: 0.03
pct_center: 0.18
pct_ratio: 0.44
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

kidney - Ren - ENCSR000CBJ

1.
500 / 500
7.0e-1001
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.89
pct_ratio: 3.12
2.
74 / 500
1.7e-28
TAGCGCCCTCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 3.20
3.
114 / 500
8.5e-8
GAGCTGCA
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.74
4.
26 / 500
1.2e+3
TGTCTGTG
small heat map img p-value: 0.67
pct_center: 0.14
pct_ratio: 0.48
5.
34 / 500
5.3e+4
CAGAGCCAAAGGCAG
small heat map img p-value: 1.00
pct_center: 0.27
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

limb - Ren - ENCSR000CEB

1.
478 / 500
2.5e-961
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.86
pct_ratio: 2.70
2.
76 / 500
1.8e-20
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.83
3.
38 / 500
1.6e-7
GACCACCAGAGGGCG
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 2.73
4.
16 / 500
8.0e+3
TGGAAAAGAAGAAAT
small heat map img p-value: 0.74
pct_center: 0.12
pct_ratio: 0.43
5.
19 / 500
6.1e+4
AGAGAAGGAACTGGA
small heat map img p-value: 0.76
pct_center: 0.12
pct_ratio: 0.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

liver - Ren - ENCSR000CBU

1.
477 / 500
2.7e-1028
TGTGGCCACCAGGGGGCGCC
small heat map img p-value: 0.00
pct_center: 0.94
pct_ratio: 3.23
2.
80 / 500
8.3e-57
GCCACCAGAGGGCGC
small heat map img p-value: 0.00
pct_center: 0.87
pct_ratio: 3.15
3.
88 / 500
1.7e-12
TGCAGCTG
small heat map img p-value: 0.01
pct_center: 0.17
pct_ratio: 0.68
4.
20 / 500
4.2e+3
AGAGAGGAAGAGCTG
small heat map img p-value: 0.66
pct_center: 0.14
pct_ratio: 0.54
5.
25 / 500
2.7e+4
TGGCTGCTGGGCTGG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.68
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

lung - Ren - ENCSR000CBV

1.
498 / 500
2.6e-868
CACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 3.50
2.
56 / 500
2.0e-8
AGAGGCTGCAGTGCC
small heat map img p-value: 0.03
pct_center: 0.24
pct_ratio: 0.91
3.
30 / 500
2.6
AGGAAGCAATGCTCA
small heat map img p-value: 0.60
pct_center: 0.14
pct_ratio: 0.59
4.
30 / 500
2.9e+2
GCAGAGAGCACAGAA
small heat map img p-value: 0.51
pct_center: 0.23
pct_ratio: 0.56
5.
32 / 500
4.7e+3
CAGGAGCCAGGAAA
small heat map img p-value: 0.95
pct_center: 0.17
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

olfactory bulb - Ren - ENCSR000CDX

1.
330 / 500
7.0e-537
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.87
pct_ratio: 2.02
2.
60 / 500
0.0070
GGGAGCTGCAG
small heat map img p-value: 0.01
pct_center: 0.37
pct_ratio: 0.75
3.
20 / 500
0.032
CTGCTAAAAAAGAAGACTTT
small heat map img p-value: 0.56
pct_center: 0.09
pct_ratio: 0.46
4.
17 / 500
0.069
ATAGGAGGTTTTTCCCGGTGTGATCTCT
small heat map img p-value: 0.10
pct_center: 0.09
pct_ratio: 0.43
5.
58 / 500
1.2e+2
CTGCAGAG
small heat map img p-value: 0.09
pct_center: 0.27
pct_ratio: 0.82
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

small intestine - Ren - ENCSR000CED

1.
493 / 500
1.0e-817
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.76
pct_ratio: 1.60
2.
6 / 500
1.8e-10
ATGAAGAAATCACGAAAAAACGTGAAAAAT
small heat map img p-value: 0.00
pct_center: 0.05
pct_ratio: 0.23
3.
4 / 500
0.0097
AAACTGAAAATCACGGAAAAT
small heat map img p-value: 0.00
pct_center: 0.03
pct_ratio: 0.24
4.
44 / 500
0.0000014
AGGAAGAGCAG
small heat map img p-value: 0.05
pct_center: 0.24
pct_ratio: 0.59
5.
11 / 500
2.4
TGACCACCAGAGGGCAGCA
small heat map img p-value: 0.00
pct_center: 0.48
pct_ratio: 1.36
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

spleen - Ren - ENCSR000CBY

1.
499 / 500
5.4e-1018
GGCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.91
pct_ratio: 2.64
2.
81 / 500
0.0000014
GGAACTGCAGG
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.81
3.
16 / 500
4.2e+4
ACAGACCAGAAGGTGGCAGAG
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.74
4.
4 / 500
4.3e+5
CTTCTGGGAGGAGGT
small heat map img p-value: 1.00
pct_center: 0.13
pct_ratio: 0.53
5.
9 / 500
2.2e+5
TTGTGTGTGAGGAAG
small heat map img p-value: 0.97
pct_center: 0.16
pct_ratio: 0.53
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

testis - Ren - ENCSR000CEF

1.
422 / 500
6.2e-891
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 1.56
2.
68 / 500
2.2e-26
ACATGTGGAACTGCA
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.89
3.
5 / 500
7.6e+2
AGAGCACGCCGGGAAAAACTT
small heat map img p-value: 0.21
pct_center: 0.07
pct_ratio: 0.48
4.
20 / 500
1.3e+3
AGAAGAAAAGGATGCAGAGG
small heat map img p-value: 1.00
pct_center: 0.18
pct_ratio: 0.52
5.
20 / 500
6.1e+2
AAACAATGAAT
small heat map img p-value: 0.53
pct_center: 0.07
pct_ratio: 0.31
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

thymus - Ren - ENCSR000CDZ

1.
384 / 500
1.8e-612
CACCAGGGGGCGCTG
small heat map img p-value: 0.00
pct_center: 0.45
pct_ratio: 1.18
2.
25 / 500
0.000017
GCAGTGCCGGGCGCGGCCACCGGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.47
pct_ratio: 1.02
3.
31 / 500
0.024
AAGGCTTGGGTTCTGCAGAAA
small heat map img p-value: 0.07
pct_center: 0.07
pct_ratio: 0.40
4.
13 / 500
25
GAGCAGAAAAAAACT
small heat map img p-value: 0.12
pct_center: 0.08
pct_ratio: 0.43
5.
27 / 500
2.0e+3
TGCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 1.08
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at CTCF peaks

C2C12 - Wold - ENCSR000AIJ

C2C12
Wold
CTCF
ENCSR000AIJ
r=1.00

small heat map img

C2C12
Wold
H3ac
ENCSR000AHP
r=0.20

small heat map img

C2C12
Wold
H3K4me3
ENCSR000AHO
r=0.13

small heat map img

C2C12
Wold
H3K79me2
ENCSR000AHQ
r=0.03

small heat map img

C2C12
Wold
H3K79me3
ENCSR000AHW
r=0.02

small heat map img

C2C12
Wold
H3K27me3
ENCSR000AHR
r=-0.01

small heat map img

C2C12
Wold
H3K36me3
ENCSR000AHL
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 21,117 (download )

CH12.LX - Hardison - ENCSR000DIU

CH12.LX
Hardison
CTCF
ENCSR000DIU
r=1.00

small heat map img

CH12.LX
Hardison
CTCF
ENCSR000ERM
r=0.83

small heat map img

CH12.LX
Hardison
H3K4me2
ENCSR000CGI
r=0.19

small heat map img

CH12.LX
Hardison
H3K4me1
ENCSR000DHQ
r=0.17

small heat map img

CH12.LX
Hardison
H3K9ac
ENCSR000CGL
r=0.14

small heat map img

CH12.LX
Hardison
H3K4me1
ENCSR000CGH
r=0.13

small heat map img

CH12.LX
Hardison
H3K4me3
ENCSR000ADI
r=0.10

small heat map img

CH12.LX
Hardison
H3K4me3
ENCSR000CGK
r=0.09

small heat map img

CH12.LX
Hardison
H3K4me3
ENCSR000DHU
r=0.07

small heat map img

CH12.LX
Hardison
H3K27ac
ENCSR000CGJ
r=0.07

small heat map img

CH12.LX
Hardison
H3K27me3
ENCSR000DHY
r=0.04

small heat map img

CH12.LX
Hardison
H3K79me2
ENCSR000CGM
r=0.04

small heat map img

CH12.LX
Hardison
H3K36me3
ENCSR000CFL
r=0.01

small heat map img

CH12.LX
Hardison
H3K36me3
ENCSR000DHW
r=-0.02

small heat map img

CH12.LX
Hardison
H3K9me3
ENCSR000DHO
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 17,602 (download )

CH12.LX - Snyder - ENCSR000ERM

CH12.LX
Snyder
CTCF
ENCSR000ERM
r=1.00

small heat map img

CH12.LX
Snyder
CTCF
ENCSR000DIU
r=0.68

small heat map img

CH12.LX
Snyder
H3K4me2
ENCSR000CGI
r=0.17

small heat map img

CH12.LX
Snyder
H3K9ac
ENCSR000CGL
r=0.14

small heat map img

CH12.LX
Snyder
H3K4me1
ENCSR000DHQ
r=0.14

small heat map img

CH12.LX
Snyder
H3K4me1
ENCSR000CGH
r=0.11

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000CGK
r=0.10

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000ADI
r=0.10

small heat map img

CH12.LX
Snyder
H3K27ac
ENCSR000CGJ
r=0.09

small heat map img

CH12.LX
Snyder
H3K4me3
ENCSR000DHU
r=0.07

small heat map img

CH12.LX
Snyder
H3K79me2
ENCSR000CGM
r=0.04

small heat map img

CH12.LX
Snyder
H3K27me3
ENCSR000DHY
r=0.03

small heat map img

CH12.LX
Snyder
H3K36me3
ENCSR000CFL
r=0.01

small heat map img

CH12.LX
Snyder
H3K36me3
ENCSR000DHW
r=-0.02

small heat map img

CH12.LX
Snyder
H3K9me3
ENCSR000DHO
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 79,989 (download )

ES-Bruce4 - Ren - ENCSR000CCB

ES-Bruce4
Ren
CTCF
ENCSR000CCB
r=1.00

small heat map img

ES-Bruce4
Ren
H3K9ac
ENCSR000CGS
r=0.24

small heat map img

ES-Bruce4
Ren
H3K4me1
ENCSR000CBF
r=0.21

small heat map img

ES-Bruce4
Ren
H3K4me3
ENCSR000CBG
r=0.18

small heat map img

ES-Bruce4
Ren
H3K27ac
ENCSR000CDE
r=0.16

small heat map img

ES-Bruce4
Ren
H3K27me3
ENCSR000CFN
r=0.11

small heat map img

ES-Bruce4
Ren
H3K36me3
ENCSR000CFO
r=0.07

small heat map img

ES-Bruce4
Ren
H3K9me3
ENCSR000CFZ
r=0.03

small heat map img
10,000 randomly-selected peaks from a total of 33,880 (download )

ES-E14 - Hardison - ENCSR362VNF

ES-E14
Hardison
CTCF
ENCSR362VNF
r=1.00

small heat map img

ES-E14
Hardison
H3K4me1
ENCSR000ADK
r=0.17

small heat map img

ES-E14
Hardison
H3K4me3
ENCSR000ADL
r=0.11

small heat map img

ES-E14
Hardison
H3K9me3
ENCSR000ADM
r=0.11

small heat map img

ES-E14
Hardison
H3K4me1
ENCSR000CGN
r=0.10

small heat map img

ES-E14
Hardison
H3K9ac
ENCSR000CGP
r=0.09

small heat map img

ES-E14
Hardison
H3K4me1
ENCSR032JUI
r=0.09

small heat map img

ES-E14
Hardison
H3K27ac
ENCSR000CGQ
r=0.07

small heat map img

ES-E14
Hardison
H3K4me3
ENCSR212KGS
r=0.06

small heat map img

ES-E14
Hardison
H3K4me3
ENCSR000CGO
r=0.05

small heat map img

ES-E14
Hardison
H3K36me3
ENCSR000CGR
r=0.03

small heat map img

ES-E14
Hardison
H3K36me3
ENCSR253QPK
r=-0.03

small heat map img

ES-E14
Hardison
H3K9me3
ENCSR857MYS
r=-0.05

small heat map img

ES-E14
Hardison
H3K27me3
ENCSR059MBO
r=-0.06

small heat map img
10,000 randomly-selected peaks from a total of 33,971 (download )

G1E - Hardison - ENCSR000DIS

G1E
Hardison
CTCF
ENCSR000DIS
r=1.00

small heat map img

G1E
Hardison
H3K4me1
ENCSR000DJB
r=0.12

small heat map img

G1E
Hardison
H3K4me3
ENCSR000DIX
r=0.07

small heat map img

G1E
Hardison
H3K36me3
ENCSR000DHV
r=-0.02

small heat map img

G1E
Hardison
H3K9me3
ENCSR000DHM
r=-0.03

small heat map img

G1E
Hardison
H3K27me3
ENCSR000DHX
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 12,601 (download )

G1E-ER4 - Hardison - ENCSR000DIR

G1E-ER4
Hardison
CTCF
ENCSR000DIR
r=1.00

small heat map img

G1E-ER4
Hardison
H3K4me1
ENCSR000DIY
r=0.10

small heat map img

G1E-ER4
Hardison
H3K4me3
ENCSR000DIW
r=0.09

small heat map img

G1E-ER4
Hardison
H3K36me3
ENCSR000DHS
r=-0.01

small heat map img

G1E-ER4
Hardison
H3K9me3
ENCSR000DHJ
r=-0.03

small heat map img

G1E-ER4
Hardison
H3K27me3
ENCSR000DIZ
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 25,159 (download )

MEL cell line - Hardison - ENCSR000DIP

MEL cell line
Hardison
CTCF
ENCSR000DIP
r=1.00

small heat map img

MEL cell line
Hardison
CTCF
ENCSR000ETQ
r=0.77

small heat map img

MEL cell line
Hardison
CTCF
ENCSR000ETE
r=0.75

small heat map img

MEL cell line
Hardison
CTCF
ENCSR000CFH
r=0.66

small heat map img

MEL cell line
Hardison
H3K4me1
ENCSR000ADY
r=0.18

small heat map img

MEL cell line
Hardison
H3K4me1
ENCSR000ADQ
r=0.15

small heat map img

MEL cell line
Hardison
H3K36me3
ENCSR000CES
r=0.13

small heat map img

MEL cell line
Hardison
H3K4me1
ENCSR000CEW
r=0.13

small heat map img

MEL cell line
Hardison
H3K4me3
ENCSR000AEA
r=0.13

small heat map img

MEL cell line
Hardison
H3K9me3
ENCSR000AEB
r=0.11

small heat map img

MEL cell line
Hardison
H3K4me3
ENCSR000ADR
r=0.11

small heat map img

MEL cell line
Hardison
H3K9me3
ENCSR000ADT
r=0.10

small heat map img

MEL cell line
Hardison
H3K9ac
ENCSR000CEU
r=0.10

small heat map img

MEL cell line
Hardison
H3K4me3
ENCSR000CEX
r=0.09

small heat map img

MEL cell line
Hardison
H3K36me3
ENCSR000ADX
r=0.08

small heat map img

MEL cell line
Hardison
H3K27me3
ENCSR000ADW
r=0.07

small heat map img

MEL cell line
Hardison
H3K27ac
ENCSR000CEV
r=0.06

small heat map img

MEL cell line
Hardison
H3K79me2
ENCSR000CET
r=0.06

small heat map img

MEL cell line
Hardison
H3K27me3
ENCSR000ADP
r=0.05

small heat map img

MEL cell line
Hardison
H3K27me3
ENCSR000CER
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 27,567 (download )

MEL cell line - Ren - ENCSR000CFH

MEL cell line
Ren
CTCF
ENCSR000CFH
r=1.00

small heat map img

MEL cell line
Ren
CTCF
ENCSR000ETQ
r=0.70

small heat map img

MEL cell line
Ren
CTCF
ENCSR000ETE
r=0.69

small heat map img

MEL cell line
Ren
CTCF
ENCSR000DIP
r=0.64

small heat map img

MEL cell line
Ren
H3K4me1
ENCSR000ADY
r=0.16

small heat map img

MEL cell line
Ren
H3K4me3
ENCSR000AEA
r=0.15

small heat map img

MEL cell line
Ren
H3K4me1
ENCSR000CEW
r=0.15

small heat map img

MEL cell line
Ren
H3K4me1
ENCSR000ADQ
r=0.14

small heat map img

MEL cell line
Ren
H3K9ac
ENCSR000CEU
r=0.14

small heat map img

MEL cell line
Ren
H3K4me3
ENCSR000ADR
r=0.14

small heat map img

MEL cell line
Ren
H3K4me3
ENCSR000CEX
r=0.13

small heat map img

MEL cell line
Ren
H3K36me3
ENCSR000CES
r=0.13

small heat map img

MEL cell line
Ren
H3K27ac
ENCSR000CEV
r=0.11

small heat map img

MEL cell line
Ren
H3K79me2
ENCSR000CET
r=0.09

small heat map img

MEL cell line
Ren
H3K9me3
ENCSR000AEB
r=0.06

small heat map img

MEL cell line
Ren
H3K27me3
ENCSR000ADW
r=0.05

small heat map img

MEL cell line
Ren
H3K9me3
ENCSR000ADT
r=0.05

small heat map img

MEL cell line
Ren
H3K27me3
ENCSR000ADP
r=0.04

small heat map img

MEL cell line
Ren
H3K27me3
ENCSR000CER
r=0.04

small heat map img

MEL cell line
Ren
H3K36me3
ENCSR000ADX
r=0.04

small heat map img
10,000 randomly-selected peaks from a total of 43,901 (download )

MEL cell line - Snyder - ENCSR000ETE

MEL cell line
Snyder
CTCF
ENCSR000ETE
r=1.00

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETQ
r=0.98

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000DIP
r=0.69

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000CFH
r=0.69

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADY
r=0.18

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000AEA
r=0.16

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADQ
r=0.15

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000CEW
r=0.14

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000ADR
r=0.14

small heat map img

MEL cell line
Snyder
H3K9ac
ENCSR000CEU
r=0.13

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000CES
r=0.13

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000CEX
r=0.13

small heat map img

MEL cell line
Snyder
H3K27ac
ENCSR000CEV
r=0.10

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000AEB
r=0.09

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000ADT
r=0.07

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADW
r=0.07

small heat map img

MEL cell line
Snyder
H3K79me2
ENCSR000CET
r=0.07

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADP
r=0.06

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000ADX
r=0.04

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000CER
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 58,495 (download )

MEL cell line - Snyder - ENCSR000ETQ

MEL cell line
Snyder
CTCF
ENCSR000ETQ
r=1.00

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETE
r=0.98

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000DIP
r=0.71

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000CFH
r=0.70

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADY
r=0.19

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000AEA
r=0.17

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000ADQ
r=0.16

small heat map img

MEL cell line
Snyder
H3K4me1
ENCSR000CEW
r=0.15

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000ADR
r=0.15

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000CES
r=0.15

small heat map img

MEL cell line
Snyder
H3K9ac
ENCSR000CEU
r=0.14

small heat map img

MEL cell line
Snyder
H3K4me3
ENCSR000CEX
r=0.13

small heat map img

MEL cell line
Snyder
H3K27ac
ENCSR000CEV
r=0.10

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000AEB
r=0.09

small heat map img

MEL cell line
Snyder
H3K9me3
ENCSR000ADT
r=0.08

small heat map img

MEL cell line
Snyder
H3K79me2
ENCSR000CET
r=0.08

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADW
r=0.06

small heat map img

MEL cell line
Snyder
H3K36me3
ENCSR000ADX
r=0.05

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000ADP
r=0.05

small heat map img

MEL cell line
Snyder
H3K27me3
ENCSR000CER
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 59,328 (download )

bone marrow - Ren - ENCSR000CBL

bone marrow
Ren
CTCF
ENCSR000CBL
r=1.00

small heat map img

bone marrow
Ren
H3K4me3
ENCSR000CAH
r=0.18

small heat map img

bone marrow
Ren
H3K4me1
ENCSR000CAG
r=0.18

small heat map img

bone marrow
Ren
H3K27ac
ENCSR000CCL
r=0.18

small heat map img
10,000 randomly-selected peaks from a total of 15,611 (download )

bone marrow macrophage - Ren - ENCSR000CFJ

bone marrow macrophage
Ren
CTCF
ENCSR000CFJ
r=1.00

small heat map img

bone marrow macrophage
Ren
H3K4me3
ENCSR000CFF
r=0.16

small heat map img

bone marrow macrophage
Ren
H3K4me1
ENCSR000CFE
r=0.14

small heat map img

bone marrow macrophage
Ren
H3K27ac
ENCSR000CFD
r=0.12

small heat map img
10,000 randomly-selected peaks from a total of 26,083 (download )

brain - Ren - ENCSR000CEH

brain
Ren
CTCF
ENCSR000CEH
r=1.00

small heat map img

brain
Ren
H3K4me1
ENCSR000CCZ
r=0.22

small heat map img

brain
Ren
H3K9me3
ENCSR000CGE
r=0.22

small heat map img

brain
Ren
H3K27me3
ENCSR000CGD
r=0.19

small heat map img

brain
Ren
H3K27ac
ENCSR000CCY
r=0.18

small heat map img

brain
Ren
H3K4me3
ENCSR000CDA
r=0.16

small heat map img

brain
Ren
H3K36me3
ENCSR000CFW
r=0.07

small heat map img
10,000 randomly-selected peaks from a total of 42,042 (download )

cerebellum - Ren - ENCSR000CBN

cerebellum
Ren
CTCF
ENCSR000CBN
r=1.00

small heat map img

cerebellum
Ren
H3K27me3
ENCSR000CFM
r=0.23

small heat map img

cerebellum
Ren
H3K27ac
ENCSR000CDC
r=0.20

small heat map img

cerebellum
Ren
H3K4me3
ENCSR000CAK
r=0.19

small heat map img
10,000 randomly-selected peaks from a total of 23,680 (download )

cortical plate - Ren - ENCSR000CBO

cortical plate
Ren
CTCF
ENCSR000CBO
r=1.00

small heat map img

cortical plate
Ren
H3K4me1
ENCSR000CAI
r=0.19

small heat map img

cortical plate
Ren
H3K27ac
ENCSR000CDD
r=0.15

small heat map img

cortical plate
Ren
H3K4me3
ENCSR000CAJ
r=0.15

small heat map img
10,000 randomly-selected peaks from a total of 37,080 (download )

embryonic fibroblast - Ren - ENCSR000CBW

embryonic fibroblast
Ren
CTCF
ENCSR000CBW
r=1.00

small heat map img

embryonic fibroblast
Ren
H3K4me1
ENCSR000CAZ
r=0.15

small heat map img

embryonic fibroblast
Ren
H3K4me3
ENCSR000CBA
r=0.14

small heat map img

embryonic fibroblast
Ren
H3K27ac
ENCSR000CDI
r=0.12

small heat map img
10,000 randomly-selected peaks from a total of 41,385 (download )

heart - Ren - ENCSR000CBI

heart
Ren
CTCF
ENCSR000CBI
r=1.00

small heat map img

heart
Ren
H3K9ac
ENCSR000CEM
r=0.20

small heat map img

heart
Ren
H3K4me1
ENCSR000CAE
r=0.19

small heat map img

heart
Ren
H3K4me3
ENCSR000CAM
r=0.17

small heat map img

heart
Ren
H3K27me3
ENCSR000CEJ
r=0.16

small heat map img

heart
Ren
H3K79me2
ENCSR000CEL
r=0.14

small heat map img

heart
Ren
H3K27ac
ENCSR000CDF
r=0.13

small heat map img

heart
Ren
H3K36me3
ENCSR000CEK
r=0.09

small heat map img

heart
Ren
H3K4me1
ENCSR000CDL
r=0.03

small heat map img

heart
Ren
H3K4me3
ENCSR000CDM
r=0.03

small heat map img

heart
Ren
H3K27ac
ENCSR000CDK
r=0.03

small heat map img
10,000 randomly-selected peaks from a total of 33,172 (download )

kidney - Ren - ENCSR000CBJ

kidney
Ren
CTCF
ENCSR000CBJ
r=1.00

small heat map img

kidney
Ren
H3K27me3
ENCSR000CFP
r=0.21

small heat map img

kidney
Ren
H3K4me1
ENCSR000CAF
r=0.18

small heat map img

kidney
Ren
H3K4me3
ENCSR000CAN
r=0.15

small heat map img

kidney
Ren
H3K27ac
ENCSR000CDG
r=0.13

small heat map img

kidney
Ren
H3K36me3
ENCSR000CFQ
r=0.07

small heat map img
10,000 randomly-selected peaks from a total of 41,698 (download )

limb - Ren - ENCSR000CEB

limb
Ren
CTCF
ENCSR000CEB
r=1.00

small heat map img

limb
Ren
H3K4me1
ENCSR000CCN
r=0.23

small heat map img

limb
Ren
H3K4me3
ENCSR000CCO
r=0.22

small heat map img

limb
Ren
H3K27ac
ENCSR000CCM
r=0.21

small heat map img
10,000 randomly-selected peaks from a total of 31,556 (download )

liver - Ren - ENCSR000CBU

liver
Ren
CTCF
ENCSR000CBU
r=1.00

small heat map img

liver
Ren
H3K9ac
ENCSR000CEQ
r=0.22

small heat map img

liver
Ren
H3K4me1
ENCSR000CAO
r=0.22

small heat map img

liver
Ren
H3K27me3
ENCSR000CEN
r=0.20

small heat map img

liver
Ren
H3K4me3
ENCSR000CAP
r=0.19

small heat map img

liver
Ren
H3K79me2
ENCSR000CEP
r=0.18

small heat map img

liver
Ren
H3K27ac
ENCSR000CDH
r=0.15

small heat map img

liver
Ren
H3K27ac
ENCSR000CDU
r=0.03

small heat map img

liver
Ren
H3K4me1
ENCSR000CDW
r=0.03

small heat map img

liver
Ren
H3K4me3
ENCSR000CDV
r=0.03

small heat map img

liver
Ren
H3K36me3
ENCSR000CEO
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 30,378 (download )

lung - Ren - ENCSR000CBV

lung
Ren
CTCF
ENCSR000CBV
r=1.00

small heat map img

lung
Ren
H3K4me1
ENCSR000CAQ
r=0.22

small heat map img

lung
Ren
H3K4me3
ENCSR000CAR
r=0.18

small heat map img
10,000 randomly-selected peaks from a total of 24,582 (download )

olfactory bulb - Ren - ENCSR000CDX

olfactory bulb
Ren
CTCF
ENCSR000CDX
r=1.00

small heat map img

olfactory bulb
Ren
H3K4me1
ENCSR000CCF
r=0.26

small heat map img

olfactory bulb
Ren
H3K4me3
ENCSR000CDS
r=0.24

small heat map img

olfactory bulb
Ren
H3K27ac
ENCSR000CCE
r=0.24

small heat map img
10,000 randomly-selected peaks from a total of 14,512 (download )

small intestine - Ren - ENCSR000CED

small intestine
Ren
CTCF
ENCSR000CED
r=1.00

small heat map img

small intestine
Ren
H3K4me1
ENCSR000CCR
r=0.22

small heat map img

small intestine
Ren
H3K27me3
ENCSR000CFR
r=0.19

small heat map img

small intestine
Ren
H3K4me3
ENCSR000CCS
r=0.18

small heat map img

small intestine
Ren
H3K27ac
ENCSR000CCQ
r=0.18

small heat map img

small intestine
Ren
H3K36me3
ENCSR000CFS
r=0.07

small heat map img
10,000 randomly-selected peaks from a total of 17,170 (download )

spleen - Ren - ENCSR000CBY

spleen
Ren
CTCF
ENCSR000CBY
r=1.00

small heat map img

spleen
Ren
H3K4me1
ENCSR000CBC
r=0.21

small heat map img

spleen
Ren
H3K27me3
ENCSR000CGA
r=0.21

small heat map img

spleen
Ren
H3K4me3
ENCSR000CBD
r=0.17

small heat map img

spleen
Ren
H3K27ac
ENCSR000CDJ
r=0.16

small heat map img

spleen
Ren
H3K36me3
ENCSR000CFT
r=0.08

small heat map img
10,000 randomly-selected peaks from a total of 24,217 (download )

testis - Ren - ENCSR000CEF

testis
Ren
CTCF
ENCSR000CEF
r=1.00

small heat map img

testis
Ren
H3K4me1
ENCSR000CCV
r=0.25

small heat map img

testis
Ren
H3K27me3
ENCSR000CGB
r=0.18

small heat map img

testis
Ren
H3K4me3
ENCSR000CCW
r=0.16

small heat map img

testis
Ren
H3K27ac
ENCSR000CCU
r=0.14

small heat map img

testis
Ren
H3K36me3
ENCSR000CFU
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 20,968 (download )

thymus - Ren - ENCSR000CDZ

thymus
Ren
CTCF
ENCSR000CDZ
r=1.00

small heat map img

thymus
Ren
H3K4me3
ENCSR000CCJ
r=0.35

small heat map img

thymus
Ren
H3K27ac
ENCSR000CCH
r=0.31

small heat map img

thymus
Ren
H3K4me1
ENCSR000CCI
r=0.28

small heat map img

thymus
Ren
H3K27me3
ENCSR000CGC
r=0.26

small heat map img

thymus
Ren
H3K36me3
ENCSR000CFV
r=0.14

small heat map img
10,000 randomly-selected peaks from a total of 53,124 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at CTCF peaks

C2C12 - Wold - ENCSR000AIJ

C2C12
Wold
CTCF
ENCSR000AIJ
r=1.00

small heat map img

C2C12
Wold
MAX
ENCSR000AIO
r=0.41

small heat map img

C2C12
Wold
MYOD1
ENCSR000AIG
r=0.25

small heat map img

C2C12
Wold
CEBPB
ENCSR000AIV
r=0.16

small heat map img

C2C12
Wold
MYOG
ENCSR000AIF
r=0.16

small heat map img

C2C12
Wold
USF1
ENCSR000AIQ
r=0.15

small heat map img

C2C12
Wold
FOSL1
ENCSR000AIK
r=0.10

small heat map img
10,000 randomly-selected peaks from a total of 21,117 (download )

CH12.LX - Hardison - ENCSR000DIU

CH12.LX
Hardison
CTCF
ENCSR000DIU
r=1.00

small heat map img

CH12.LX
Hardison
CTCF
ENCSR000ERM
r=0.83

small heat map img

CH12.LX
Hardison
SMC3
ENCSR000ERG
r=0.79

small heat map img

CH12.LX
Hardison
RAD21
ENCSR000ERK
r=0.76

small heat map img

CH12.LX
Hardison
ZC3H11A
ENCSR000EQQ
r=0.73

small heat map img

CH12.LX
Hardison
NELFE
ENCSR000ERD
r=0.70

small heat map img

CH12.LX
Hardison
JUND
ENCSR000ERR
r=0.66

small heat map img

CH12.LX
Hardison
MYC
ENCSR000ERN
r=0.62

small heat map img

CH12.LX
Hardison
MAZ
ENCSR000EQT
r=0.62

small heat map img

CH12.LX
Hardison
MAX
ENCSR000ERL
r=0.60

small heat map img

CH12.LX
Hardison
E2F4
ENCSR000ERU
r=0.60

small heat map img

CH12.LX
Hardison
RCOR1
ENCSR000EQZ
r=0.59

small heat map img

CH12.LX
Hardison
JUN
ENCSR000ERO
r=0.58

small heat map img

CH12.LX
Hardison
MAFK
ENCSR000ERB
r=0.56

small heat map img

CH12.LX
Hardison
USF2
ENCSR000ERJ
r=0.56

small heat map img

CH12.LX
Hardison
SIN3A
ENCSR000EQY
r=0.56

small heat map img

CH12.LX
Hardison
KAT2A
ENCSR000EQU
r=0.54

small heat map img

CH12.LX
Hardison
GABPA
ENCSR000EQS
r=0.52

small heat map img

CH12.LX
Hardison
ZKSCAN1
ENCSR000EQW
r=0.51

small heat map img

CH12.LX
Hardison
EP300
ENCSR000ERI
r=0.50

small heat map img

CH12.LX
Hardison
MXI1
ENCSR000ERE
r=0.50

small heat map img

CH12.LX
Hardison
BHLHE40
ENCSR000ERC
r=0.49

small heat map img

CH12.LX
Hardison
ETS1
ENCSR000ERA
r=0.45

small heat map img

CH12.LX
Hardison
UBTF
ENCSR000EQX
r=0.45

small heat map img

CH12.LX
Hardison
CHD1
ENCSR000EQV
r=0.44

small heat map img

CH12.LX
Hardison
CHD2
ENCSR000ERF
r=0.43

small heat map img

CH12.LX
Hardison
HCFC1
ENCSR000EQR
r=0.42

small heat map img

CH12.LX
Hardison
ZNF384
ENCSR000EQO
r=0.39

small heat map img

CH12.LX
Hardison
ZMIZ1
ENCSR000EQP
r=0.37

small heat map img

CH12.LX
Hardison
TBP
ENCSR000ERP
r=0.29

small heat map img

CH12.LX
Hardison
POLR2A
ENCSR000ERQ
r=0.26

small heat map img

CH12.LX
Hardison
PAX5
ENCSR000DIH
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 17,602 (download )

CH12.LX - Snyder - ENCSR000ERM

CH12.LX
Snyder
CTCF
ENCSR000ERM
r=1.00

small heat map img

CH12.LX
Snyder
SMC3
ENCSR000ERG
r=0.93

small heat map img

CH12.LX
Snyder
RAD21
ENCSR000ERK
r=0.93

small heat map img

CH12.LX
Snyder
ZC3H11A
ENCSR000EQQ
r=0.78

small heat map img

CH12.LX
Snyder
CTCF
ENCSR000DIU
r=0.68

small heat map img

CH12.LX
Snyder
NELFE
ENCSR000ERD
r=0.63

small heat map img

CH12.LX
Snyder
JUND
ENCSR000ERR
r=0.61

small heat map img

CH12.LX
Snyder
MYC
ENCSR000ERN
r=0.59

small heat map img

CH12.LX
Snyder
MAZ
ENCSR000EQT
r=0.57

small heat map img

CH12.LX
Snyder
E2F4
ENCSR000ERU
r=0.54

small heat map img

CH12.LX
Snyder
MAX
ENCSR000ERL
r=0.53

small heat map img

CH12.LX
Snyder
RCOR1
ENCSR000EQZ
r=0.52

small heat map img

CH12.LX
Snyder
JUN
ENCSR000ERO
r=0.52

small heat map img

CH12.LX
Snyder
MAFK
ENCSR000ERB
r=0.51

small heat map img

CH12.LX
Snyder
USF2
ENCSR000ERJ
r=0.48

small heat map img

CH12.LX
Snyder
SIN3A
ENCSR000EQY
r=0.47

small heat map img

CH12.LX
Snyder
KAT2A
ENCSR000EQU
r=0.46

small heat map img

CH12.LX
Snyder
ZNF384
ENCSR000EQO
r=0.45

small heat map img

CH12.LX
Snyder
ZKSCAN1
ENCSR000EQW
r=0.45

small heat map img

CH12.LX
Snyder
GABPA
ENCSR000EQS
r=0.44

small heat map img

CH12.LX
Snyder
EP300
ENCSR000ERI
r=0.44

small heat map img

CH12.LX
Snyder
MXI1
ENCSR000ERE
r=0.42

small heat map img

CH12.LX
Snyder
BHLHE40
ENCSR000ERC
r=0.41

small heat map img

CH12.LX
Snyder
CHD2
ENCSR000ERF
r=0.39

small heat map img

CH12.LX
Snyder
ETS1
ENCSR000ERA
r=0.39

small heat map img

CH12.LX
Snyder
CHD1
ENCSR000EQV
r=0.38

small heat map img

CH12.LX
Snyder
UBTF
ENCSR000EQX
r=0.37

small heat map img

CH12.LX
Snyder
HCFC1
ENCSR000EQR
r=0.35

small heat map img

CH12.LX
Snyder
ZMIZ1
ENCSR000EQP
r=0.30

small heat map img

CH12.LX
Snyder
TBP
ENCSR000ERP
r=0.28

small heat map img

CH12.LX
Snyder
POLR2A
ENCSR000ERQ
r=0.21

small heat map img

CH12.LX
Snyder
PAX5
ENCSR000DIH
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 79,989 (download )

ES-Bruce4 - Ren - ENCSR000CCB

ES-Bruce4
Ren
CTCF
ENCSR000CCB
r=1.00

small heat map img

ES-Bruce4
Ren
EP300
ENCSR000CCD
r=0.58

small heat map img

ES-Bruce4
Ren
POLR2A
ENCSR000CCC
r=0.39

small heat map img
10,000 randomly-selected peaks from a total of 33,880 (download )

ES-E14 - Hardison - ENCSR362VNF

ES-E14
Hardison
CTCF
ENCSR362VNF
r=1.00

small heat map img

ES-E14
Hardison
ZC3H11A
ENCSR000ERW
r=0.74

small heat map img

ES-E14
Hardison
HCFC1
ENCSR000ERX
r=0.48

small heat map img

ES-E14
Hardison
ZNF384
ENCSR000ERV
r=0.43

small heat map img

ES-E14
Hardison
NANOG
ENCSR779CZG
r=0.19

small heat map img
10,000 randomly-selected peaks from a total of 33,971 (download )

G1E - Hardison - ENCSR000DIS

G1E
Hardison
CTCF
ENCSR000DIS
r=1.00

small heat map img

G1E
Hardison
TAL1
ENCSR000DIN
r=0.04

small heat map img

G1E
Hardison
GATA2
ENCSR000DIE
r=0.04

small heat map img

G1E
Hardison
GATA1
ENCSR000DIC
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 12,601 (download )

G1E-ER4 - Hardison - ENCSR000DIR

G1E-ER4
Hardison
CTCF
ENCSR000DIR
r=1.00

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DIQ
r=0.14

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGZ
r=0.12

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHB
r=0.09

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGY
r=0.09

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DGX
r=0.08

small heat map img

G1E-ER4
Hardison
GATA2
ENCSR000DID
r=0.07

small heat map img

G1E-ER4
Hardison
TAL1
ENCSR000DIM
r=0.06

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHC
r=0.06

small heat map img

G1E-ER4
Hardison
GATA1
ENCSR000DHA
r=0.06

small heat map img
10,000 randomly-selected peaks from a total of 25,159 (download )

MEL cell line - Hardison - ENCSR000DIP

MEL cell line
Hardison
CTCF
ENCSR000DIP
r=1.00

small heat map img

MEL cell line
Hardison
CTCF
ENCSR000ETQ
r=0.77

small heat map img

MEL cell line
Hardison
CTCF
ENCSR000ETE
r=0.75

small heat map img

MEL cell line
Hardison
SMC3
ENCSR000ETL
r=0.73

small heat map img

MEL cell line
Hardison
RAD21
ENCSR000ETT
r=0.69

small heat map img

MEL cell line
Hardison
RAD21
ENCSR000ETS
r=0.69

small heat map img

MEL cell line
Hardison
ZC3H11A
ENCSR000ESF
r=0.67

small heat map img

MEL cell line
Hardison
CTCF
ENCSR000CFH
r=0.66

small heat map img

MEL cell line
Hardison
JUND
ENCSR000ETZ
r=0.57

small heat map img

MEL cell line
Hardison
BHLHE40
ENCSR000ESH
r=0.56

small heat map img

MEL cell line
Hardison
MAZ
ENCSR000ESL
r=0.52

small heat map img

MEL cell line
Hardison
MYC
ENCSR000EUA
r=0.50

small heat map img

MEL cell line
Hardison
RCOR1
ENCSR000ESI
r=0.50

small heat map img

MEL cell line
Hardison
MAFK
ENCSR000ETK
r=0.47

small heat map img

MEL cell line
Hardison
GABPA
ENCSR000ESK
r=0.47

small heat map img

MEL cell line
Hardison
MAX
ENCSR000ETX
r=0.47

small heat map img

MEL cell line
Hardison
E2F4
ENCSR000ETY
r=0.46

small heat map img

MEL cell line
Hardison
MYB
ENCSR000ETR
r=0.46

small heat map img

MEL cell line
Hardison
ZKSCAN1
ENCSR000ESX
r=0.46

small heat map img

MEL cell line
Hardison
GATA1
ENCSR000ETA
r=0.46

small heat map img

MEL cell line
Hardison
MAFK
ENCSR000ESY
r=0.45

small heat map img

MEL cell line
Hardison
KAT2A
ENCSR000ESM
r=0.44

small heat map img

MEL cell line
Hardison
SIN3A
ENCSR000ETC
r=0.43

small heat map img

MEL cell line
Hardison
USF2
ENCSR000ETF
r=0.40

small heat map img

MEL cell line
Hardison
CHD2
ENCSR000ETO
r=0.40

small heat map img

MEL cell line
Hardison
EP300
ENCSR000ETV
r=0.39

small heat map img

MEL cell line
Hardison
CHD1
ENCSR000ESN
r=0.39

small heat map img

MEL cell line
Hardison
GATA1
ENCSR000EUG
r=0.37

small heat map img

MEL cell line
Hardison
NELFE
ENCSR000ETU
r=0.37

small heat map img

MEL cell line
Hardison
EP300
ENCSR000ETP
r=0.37

small heat map img

MEL cell line
Hardison
MXI1
ENCSR000ETN
r=0.37

small heat map img

MEL cell line
Hardison
ZMIZ1
ENCSR000ESE
r=0.35

small heat map img

MEL cell line
Hardison
UBTF
ENCSR000ESJ
r=0.35

small heat map img

MEL cell line
Hardison
ZNF384
ENCSR000ESD
r=0.35

small heat map img

MEL cell line
Hardison
ETS1
ENCSR000ETB
r=0.33

small heat map img

MEL cell line
Hardison
USF2
ENCSR000ETW
r=0.32

small heat map img

MEL cell line
Hardison
HCFC1
ENCSR000ESG
r=0.29

small heat map img

MEL cell line
Hardison
TBP
ENCSR000EUB
r=0.29

small heat map img

MEL cell line
Hardison
POLR2A
ENCSR000CFI
r=0.19

small heat map img

MEL cell line
Hardison
POLR2A
ENCSR000ETG
r=0.14

small heat map img

MEL cell line
Hardison
POLR2A
ENCSR000EUC
r=0.13

small heat map img

MEL cell line
Hardison
TAL1
ENCSR000DIA
r=0.06

small heat map img
10,000 randomly-selected peaks from a total of 27,567 (download )

MEL cell line - Ren - ENCSR000CFH

MEL cell line
Ren
CTCF
ENCSR000CFH
r=1.00

small heat map img

MEL cell line
Ren
CTCF
ENCSR000ETQ
r=0.70

small heat map img

MEL cell line
Ren
CTCF
ENCSR000ETE
r=0.69

small heat map img

MEL cell line
Ren
SMC3
ENCSR000ETL
r=0.68

small heat map img

MEL cell line
Ren
RAD21
ENCSR000ETT
r=0.65

small heat map img

MEL cell line
Ren
CTCF
ENCSR000DIP
r=0.64

small heat map img

MEL cell line
Ren
RAD21
ENCSR000ETS
r=0.62

small heat map img

MEL cell line
Ren
ZC3H11A
ENCSR000ESF
r=0.57

small heat map img

MEL cell line
Ren
JUND
ENCSR000ETZ
r=0.45

small heat map img

MEL cell line
Ren
BHLHE40
ENCSR000ESH
r=0.44

small heat map img

MEL cell line
Ren
RCOR1
ENCSR000ESI
r=0.41

small heat map img

MEL cell line
Ren
MAZ
ENCSR000ESL
r=0.41

small heat map img

MEL cell line
Ren
MAFK
ENCSR000ESY
r=0.40

small heat map img

MEL cell line
Ren
GATA1
ENCSR000ETA
r=0.39

small heat map img

MEL cell line
Ren
MAFK
ENCSR000ETK
r=0.39

small heat map img

MEL cell line
Ren
ZKSCAN1
ENCSR000ESX
r=0.39

small heat map img

MEL cell line
Ren
MYB
ENCSR000ETR
r=0.39

small heat map img

MEL cell line
Ren
GABPA
ENCSR000ESK
r=0.39

small heat map img

MEL cell line
Ren
MYC
ENCSR000EUA
r=0.37

small heat map img

MEL cell line
Ren
MAX
ENCSR000ETX
r=0.36

small heat map img

MEL cell line
Ren
E2F4
ENCSR000ETY
r=0.35

small heat map img

MEL cell line
Ren
EP300
ENCSR000ETV
r=0.33

small heat map img

MEL cell line
Ren
EP300
ENCSR000ETP
r=0.32

small heat map img

MEL cell line
Ren
KAT2A
ENCSR000ESM
r=0.32

small heat map img

MEL cell line
Ren
SIN3A
ENCSR000ETC
r=0.32

small heat map img

MEL cell line
Ren
USF2
ENCSR000ETF
r=0.31

small heat map img

MEL cell line
Ren
ZNF384
ENCSR000ESD
r=0.29

small heat map img

MEL cell line
Ren
ZMIZ1
ENCSR000ESE
r=0.29

small heat map img

MEL cell line
Ren
CHD1
ENCSR000ESN
r=0.28

small heat map img

MEL cell line
Ren
MXI1
ENCSR000ETN
r=0.28

small heat map img

MEL cell line
Ren
UBTF
ENCSR000ESJ
r=0.28

small heat map img

MEL cell line
Ren
CHD2
ENCSR000ETO
r=0.28

small heat map img

MEL cell line
Ren
ETS1
ENCSR000ETB
r=0.28

small heat map img

MEL cell line
Ren
GATA1
ENCSR000EUG
r=0.27

small heat map img

MEL cell line
Ren
NELFE
ENCSR000ETU
r=0.26

small heat map img

MEL cell line
Ren
USF2
ENCSR000ETW
r=0.25

small heat map img

MEL cell line
Ren
TBP
ENCSR000EUB
r=0.22

small heat map img

MEL cell line
Ren
POLR2A
ENCSR000CFI
r=0.21

small heat map img

MEL cell line
Ren
HCFC1
ENCSR000ESG
r=0.20

small heat map img

MEL cell line
Ren
POLR2A
ENCSR000ETG
r=0.16

small heat map img

MEL cell line
Ren
POLR2A
ENCSR000EUC
r=0.16

small heat map img

MEL cell line
Ren
TAL1
ENCSR000DIA
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 43,901 (download )

MEL cell line - Snyder - ENCSR000ETE

MEL cell line
Snyder
CTCF
ENCSR000ETE
r=1.00

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETQ
r=0.98

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETT
r=0.94

small heat map img

MEL cell line
Snyder
SMC3
ENCSR000ETL
r=0.92

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETS
r=0.90

small heat map img

MEL cell line
Snyder
ZC3H11A
ENCSR000ESF
r=0.80

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000DIP
r=0.69

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000CFH
r=0.69

small heat map img

MEL cell line
Snyder
BHLHE40
ENCSR000ESH
r=0.62

small heat map img

MEL cell line
Snyder
JUND
ENCSR000ETZ
r=0.58

small heat map img

MEL cell line
Snyder
MAZ
ENCSR000ESL
r=0.55

small heat map img

MEL cell line
Snyder
MYC
ENCSR000EUA
r=0.54

small heat map img

MEL cell line
Snyder
RCOR1
ENCSR000ESI
r=0.52

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000ETA
r=0.50

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ETK
r=0.50

small heat map img

MEL cell line
Snyder
MAX
ENCSR000ETX
r=0.48

small heat map img

MEL cell line
Snyder
SIN3A
ENCSR000ETC
r=0.47

small heat map img

MEL cell line
Snyder
MYB
ENCSR000ETR
r=0.47

small heat map img

MEL cell line
Snyder
ZKSCAN1
ENCSR000ESX
r=0.46

small heat map img

MEL cell line
Snyder
E2F4
ENCSR000ETY
r=0.46

small heat map img

MEL cell line
Snyder
GABPA
ENCSR000ESK
r=0.46

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ESY
r=0.46

small heat map img

MEL cell line
Snyder
KAT2A
ENCSR000ESM
r=0.45

small heat map img

MEL cell line
Snyder
ZNF384
ENCSR000ESD
r=0.44

small heat map img

MEL cell line
Snyder
CHD2
ENCSR000ETO
r=0.41

small heat map img

MEL cell line
Snyder
MXI1
ENCSR000ETN
r=0.40

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETV
r=0.39

small heat map img

MEL cell line
Snyder
CHD1
ENCSR000ESN
r=0.39

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETF
r=0.39

small heat map img

MEL cell line
Snyder
NELFE
ENCSR000ETU
r=0.38

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETP
r=0.38

small heat map img

MEL cell line
Snyder
ZMIZ1
ENCSR000ESE
r=0.36

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000EUG
r=0.36

small heat map img

MEL cell line
Snyder
ETS1
ENCSR000ETB
r=0.35

small heat map img

MEL cell line
Snyder
HCFC1
ENCSR000ESG
r=0.35

small heat map img

MEL cell line
Snyder
UBTF
ENCSR000ESJ
r=0.34

small heat map img

MEL cell line
Snyder
TBP
ENCSR000EUB
r=0.32

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETW
r=0.27

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000ETG
r=0.20

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000CFI
r=0.19

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000EUC
r=0.17

small heat map img

MEL cell line
Snyder
TAL1
ENCSR000DIA
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 58,495 (download )

MEL cell line - Snyder - ENCSR000ETQ

MEL cell line
Snyder
CTCF
ENCSR000ETQ
r=1.00

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000ETE
r=0.98

small heat map img

MEL cell line
Snyder
SMC3
ENCSR000ETL
r=0.94

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETT
r=0.92

small heat map img

MEL cell line
Snyder
RAD21
ENCSR000ETS
r=0.92

small heat map img

MEL cell line
Snyder
ZC3H11A
ENCSR000ESF
r=0.82

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000DIP
r=0.71

small heat map img

MEL cell line
Snyder
CTCF
ENCSR000CFH
r=0.70

small heat map img

MEL cell line
Snyder
BHLHE40
ENCSR000ESH
r=0.65

small heat map img

MEL cell line
Snyder
JUND
ENCSR000ETZ
r=0.60

small heat map img

MEL cell line
Snyder
MYC
ENCSR000EUA
r=0.57

small heat map img

MEL cell line
Snyder
MAZ
ENCSR000ESL
r=0.57

small heat map img

MEL cell line
Snyder
RCOR1
ENCSR000ESI
r=0.56

small heat map img

MEL cell line
Snyder
MAX
ENCSR000ETX
r=0.53

small heat map img

MEL cell line
Snyder
SIN3A
ENCSR000ETC
r=0.52

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000ETA
r=0.52

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ETK
r=0.52

small heat map img

MEL cell line
Snyder
MYB
ENCSR000ETR
r=0.50

small heat map img

MEL cell line
Snyder
E2F4
ENCSR000ETY
r=0.48

small heat map img

MEL cell line
Snyder
ZKSCAN1
ENCSR000ESX
r=0.48

small heat map img

MEL cell line
Snyder
KAT2A
ENCSR000ESM
r=0.47

small heat map img

MEL cell line
Snyder
GABPA
ENCSR000ESK
r=0.46

small heat map img

MEL cell line
Snyder
ZNF384
ENCSR000ESD
r=0.46

small heat map img

MEL cell line
Snyder
CHD2
ENCSR000ETO
r=0.45

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETP
r=0.45

small heat map img

MEL cell line
Snyder
MAFK
ENCSR000ESY
r=0.45

small heat map img

MEL cell line
Snyder
MXI1
ENCSR000ETN
r=0.44

small heat map img

MEL cell line
Snyder
NELFE
ENCSR000ETU
r=0.43

small heat map img

MEL cell line
Snyder
EP300
ENCSR000ETV
r=0.43

small heat map img

MEL cell line
Snyder
CHD1
ENCSR000ESN
r=0.42

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETF
r=0.42

small heat map img

MEL cell line
Snyder
GATA1
ENCSR000EUG
r=0.42

small heat map img

MEL cell line
Snyder
ZMIZ1
ENCSR000ESE
r=0.41

small heat map img

MEL cell line
Snyder
ETS1
ENCSR000ETB
r=0.40

small heat map img

MEL cell line
Snyder
TBP
ENCSR000EUB
r=0.39

small heat map img

MEL cell line
Snyder
HCFC1
ENCSR000ESG
r=0.38

small heat map img

MEL cell line
Snyder
UBTF
ENCSR000ESJ
r=0.35

small heat map img

MEL cell line
Snyder
USF2
ENCSR000ETW
r=0.28

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000ETG
r=0.21

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000CFI
r=0.20

small heat map img

MEL cell line
Snyder
POLR2A
ENCSR000EUC
r=0.20

small heat map img

MEL cell line
Snyder
TAL1
ENCSR000DIA
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 59,328 (download )

bone marrow - Ren - ENCSR000CBL

bone marrow
Ren
CTCF
ENCSR000CBL
r=1.00

small heat map img

bone marrow
Ren
POLR2A
ENCSR000CBM
r=0.40

small heat map img
10,000 randomly-selected peaks from a total of 15,611 (download )

bone marrow macrophage - Ren - ENCSR000CFJ

bone marrow macrophage
Ren
CTCF
ENCSR000CFJ
r=1.00

small heat map img

bone marrow macrophage
Ren
POLR2A
ENCSR000CFK
r=0.59

small heat map img
10,000 randomly-selected peaks from a total of 26,083 (download )

brain - Ren - ENCSR000CEH

brain
Ren
CTCF
ENCSR000CEH
r=1.00

small heat map img

brain
Ren
POLR2A
ENCSR000CEI
r=0.22

small heat map img
10,000 randomly-selected peaks from a total of 42,042 (download )

cerebellum - Ren - ENCSR000CBN

cerebellum
Ren
CTCF
ENCSR000CBN
r=1.00

small heat map img

cerebellum
Ren
POLR2A
ENCSR000CBQ
r=0.36

small heat map img
10,000 randomly-selected peaks from a total of 23,680 (download )

cortical plate - Ren - ENCSR000CBO

cortical plate
Ren
CTCF
ENCSR000CBO
r=1.00

small heat map img

cortical plate
Ren
POLR2A
ENCSR000CBP
r=0.31

small heat map img
10,000 randomly-selected peaks from a total of 37,080 (download )

embryonic fibroblast - Ren - ENCSR000CBW

embryonic fibroblast
Ren
CTCF
ENCSR000CBW
r=1.00

small heat map img

embryonic fibroblast
Ren
POLR2A
ENCSR000CBX
r=0.26

small heat map img
10,000 randomly-selected peaks from a total of 41,385 (download )

heart - Ren - ENCSR000CBI

heart
Ren
CTCF
ENCSR000CBI
r=1.00

small heat map img

heart
Ren
EP300
ENCSR000CCA
r=0.64

small heat map img

heart
Ren
POLR2A
ENCSR000CBS
r=0.30

small heat map img
10,000 randomly-selected peaks from a total of 33,172 (download )

kidney - Ren - ENCSR000CBJ

kidney
Ren
CTCF
ENCSR000CBJ
r=1.00

small heat map img

kidney
Ren
POLR2A
ENCSR000CBK
r=0.35

small heat map img
10,000 randomly-selected peaks from a total of 41,698 (download )

limb - Ren - ENCSR000CEB

limb
Ren
CTCF
ENCSR000CEB
r=1.00

small heat map img

limb
Ren
POLR2A
ENCSR000CEC
r=0.52

small heat map img
10,000 randomly-selected peaks from a total of 31,556 (download )

liver - Ren - ENCSR000CBU

liver
Ren
CTCF
ENCSR000CBU
r=1.00

small heat map img

liver
Ren
POLR2A
ENCSR000CBR
r=0.43

small heat map img
10,000 randomly-selected peaks from a total of 30,378 (download )

lung - Ren - ENCSR000CBV

lung
Ren
CTCF
ENCSR000CBV
r=1.00

small heat map img

lung
Ren
POLR2A
ENCSR000CBT
r=0.33

small heat map img
10,000 randomly-selected peaks from a total of 24,582 (download )

olfactory bulb - Ren - ENCSR000CDX

olfactory bulb
Ren
CTCF
ENCSR000CDX
r=1.00

small heat map img

olfactory bulb
Ren
POLR2A
ENCSR000CDY
r=0.48

small heat map img
10,000 randomly-selected peaks from a total of 14,512 (download )

small intestine - Ren - ENCSR000CED

small intestine
Ren
CTCF
ENCSR000CED
r=1.00

small heat map img

small intestine
Ren
POLR2A
ENCSR000CEE
r=0.39

small heat map img
10,000 randomly-selected peaks from a total of 17,170 (download )

spleen - Ren - ENCSR000CBY

spleen
Ren
CTCF
ENCSR000CBY
r=1.00

small heat map img

spleen
Ren
POLR2A
ENCSR000CBZ
r=0.34

small heat map img
10,000 randomly-selected peaks from a total of 24,217 (download )

testis - Ren - ENCSR000CEF

testis
Ren
CTCF
ENCSR000CEF
r=1.00

small heat map img

testis
Ren
POLR2A
ENCSR000CEG
r=0.28

small heat map img
10,000 randomly-selected peaks from a total of 20,968 (download )

thymus - Ren - ENCSR000CDZ

thymus
Ren
CTCF
ENCSR000CDZ
r=1.00

small heat map img

thymus
Ren
POLR2A
ENCSR000CEA
r=0.73

small heat map img
10,000 randomly-selected peaks from a total of 53,124 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help