CEBPB

This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. Activity of this protein is important in the regulation of genes involved in immune and inflammatory responses, among other processes. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with distinct biological functions. RefSeq, Oct 2013
CCAAT/enhancer-binding protein beta is a protein that in humans is encoded by the CEBPB gene.wikipedia

CEBPB

PDB image
PDB 1GTW

PDB 1GTW 1GU4 1GU5 1H88 1H89 1H8A 1HJB 1IO4 2E42 2E43
ENCODE experiments
Ensemble search
Entrez 1051
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia CEBPB

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

C2C12 - Wold - ENCSR000AIV

loading

myocyte - Wold - ENCSR000AIB

loading

Legend

Proximal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac
Distal:
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K79me3
  • H3K9ac
  • H3K9me3
  • H3ac

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

C2C12 - Wold - ENCSR000AIV

1.
500 / 500
8.3e-680
AGTATTGCACAATA
small heat map img p-value: 0.00
pct_center: 0.45
pct_ratio: 7.12
2.
157 / 500
1.0e-84
GTGACTCA
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 1.86
3.
32 / 500
0.000080
GGGGGTGGGGGGGGG
small heat map img p-value: 1.00
pct_center: 0.28
pct_ratio: 0.46
4.
90 / 500
0.027
TGTGGTTT
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.87
5.
13 / 500
3.9e+3
TGGATGGGAGTGTGTGTGTGT
small heat map img p-value: 0.90
pct_center: 0.17
pct_ratio: 0.42
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

myocyte - Wold - ENCSR000AIB

1.
452 / 500
9.0e-547
GATGATGCAAT
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 6.63
2.
79 / 500
1.4e-20
ATGAGTCA
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 1.50
3.
37 / 500
0.000058
GGGGTGGGGGAGGGAGGAGAG
small heat map img p-value: 0.99
pct_center: 0.32
pct_ratio: 0.49
4.
59 / 500
0.24
CAGCAGCAGTCAGGG
small heat map img p-value: 0.06
pct_center: 0.24
pct_ratio: 0.66
5.
30 / 500
6.8e+3
TGAGCACAGAGGCAG
small heat map img p-value: 0.02
pct_center: 0.17
pct_ratio: 0.61
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at CEBPB peaks

C2C12 - Wold - ENCSR000AIV

C2C12
Wold
CEBPB
ENCSR000AIV
r=1.00

small heat map img

C2C12
Wold
H3ac
ENCSR000AHP
r=0.13

small heat map img

C2C12
Wold
H3K4me3
ENCSR000AHO
r=0.08

small heat map img

C2C12
Wold
H3K79me2
ENCSR000AHQ
r=-0.01

small heat map img

C2C12
Wold
H3K79me3
ENCSR000AHW
r=-0.01

small heat map img

C2C12
Wold
H3K36me3
ENCSR000AHL
r=-0.03

small heat map img

C2C12
Wold
H3K27me3
ENCSR000AHR
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 11,434 (download )

myocyte - Wold - ENCSR000AIB

myocyte
Wold
CEBPB
ENCSR000AIB
r=1.00

small heat map img

myocyte
Wold
H3K4me2
ENCSR000AHS
r=0.28

small heat map img

myocyte
Wold
H3K4me3
ENCSR000AHT
r=0.11

small heat map img

myocyte
Wold
H3ac
ENCSR000AHU
r=0.08

small heat map img

myocyte
Wold
H3K79me2
ENCSR000AHN
r=-0.02

small heat map img

myocyte
Wold
H3K27me3
ENCSR000AHM
r=-0.02

small heat map img

myocyte
Wold
H3K36me3
ENCSR000AHV
r=-0.03

small heat map img
4,863 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at CEBPB peaks

C2C12 - Wold - ENCSR000AIV

C2C12
Wold
CEBPB
ENCSR000AIV
r=1.00

small heat map img

C2C12
Wold
MAX
ENCSR000AIO
r=0.35

small heat map img

C2C12
Wold
FOSL1
ENCSR000AIK
r=0.33

small heat map img

C2C12
Wold
MYOD1
ENCSR000AIG
r=0.30

small heat map img

C2C12
Wold
USF1
ENCSR000AIQ
r=0.22

small heat map img

C2C12
Wold
CTCF
ENCSR000AIJ
r=0.07

small heat map img

C2C12
Wold
MYOG
ENCSR000AIF
r=0.05

small heat map img
10,000 randomly-selected peaks from a total of 11,434 (download )

myocyte - Wold - ENCSR000AIB

myocyte
Wold
CEBPB
ENCSR000AIB
r=1.00

small heat map img

myocyte
Wold
TCF12
ENCSR000AIN
r=0.35

small heat map img

myocyte
Wold
MAX
ENCSR000AIL
r=0.34

small heat map img

myocyte
Wold
TCF3
ENCSR000AIP
r=0.24

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIH
r=0.23

small heat map img

myocyte
Wold
USF1
ENCSR000AIE
r=0.23

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIR
r=0.22

small heat map img

myocyte
Wold
MYOG
ENCSR000AIW
r=0.21

small heat map img

myocyte
Wold
MYOG
ENCSR000AIC
r=0.21

small heat map img

myocyte
Wold
SRF
ENCSR000AIM
r=0.18

small heat map img

myocyte
Wold
MYOD1
ENCSR000AIT
r=0.18

small heat map img

myocyte
Wold
E2F4
ENCSR000AII
r=0.14

small heat map img

myocyte
Wold
MYOG
ENCSR000AID
r=0.12

small heat map img

myocyte
Wold
POLR2A
ENCSR000AIX
r=0.10

small heat map img

myocyte
Wold
REST
ENCSR000AIS
r=0.07

small heat map img
4,863 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend
Help