ZNF217

Zinc finger protein 217, also known as ZNF217, is a protein which in humans is encoded by the ZNF217 gene.wikipedia

ZNF217

PDB image
PDB 2HU2

PDB 2HU2 3UK3 4F2J 4IS1
ENCODE experiments
Ensemble search
Entrez 7764
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia ZNF217

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

MCF-7 - Farnham - ENCSR000EWU

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

MCF-7 - Farnham - ENCSR000EWU

1.
212 / 500
5.8e-199
GAACTGGAAAAACAGGTTTTG
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 1.67
2.
71 / 500
8.2e-46
AGGTCAGGGTGACCT
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.64
3.
56 / 500
4.6e-13
AGAAAAAAAAAAGAA
small heat map img p-value: 1.00
pct_center: 0.27
pct_ratio: 0.42
4.
100 / 500
3.7e-7
CAGGGCAG
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.68
5.
85 / 500
9.9e-9
CCCTGGAG
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 0.71
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at ZNF217 peaks

MCF-7 - Farnham - ENCSR000EWU

MCF-7
Farnham
ZNF217
ENCSR000EWU
r=1.00

small heat map img

MCF-7
Farnham
H3K27ac
ENCSR000EWR
r=0.40

small heat map img

MCF-7
Farnham
H3K9me3
ENCSR000EWQ
r=0.22

small heat map img

MCF-7
Farnham
H3K4me3
ENCSR000DWJ
r=0.22

small heat map img

MCF-7
Farnham
H3K27me3
ENCSR000EWP
r=0.21

small heat map img

MCF-7
Farnham
H3K36me3
ENCSR000EWO
r=0.14

small heat map img
9,933 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at ZNF217 peaks

MCF-7 - Farnham - ENCSR000EWU

MCF-7
Farnham
ZNF217
ENCSR000EWU
r=1.00

small heat map img

MCF-7
Farnham
GATA3
ENCSR000EWV
r=0.75

small heat map img

MCF-7
Farnham
SIN3A
ENCSR000BUM
r=0.74

small heat map img

MCF-7
Farnham
GATA3
ENCSR000EWS
r=0.74

small heat map img

MCF-7
Farnham
TCF7L2
ENCSR000EWT
r=0.71

small heat map img

MCF-7
Farnham
GATA3
ENCSR000BST
r=0.70

small heat map img

MCF-7
Farnham
HDAC2
ENCSR000BTP
r=0.70

small heat map img

MCF-7
Farnham
NR2F2
ENCSR000BUY
r=0.66

small heat map img

MCF-7
Farnham
EP300
ENCSR000BTR
r=0.66

small heat map img

MCF-7
Farnham
TEAD4
ENCSR000BUO
r=0.66

small heat map img

MCF-7
Farnham
FOXM1
ENCSR000BUJ
r=0.65

small heat map img

MCF-7
Farnham
TCF12
ENCSR000BUN
r=0.63

small heat map img

MCF-7
Farnham
FOSL2
ENCSR000BUI
r=0.61

small heat map img

MCF-7
Farnham
JUND
ENCSR000BSU
r=0.57

small heat map img

MCF-7
Farnham
MAX
ENCSR000BUL
r=0.57

small heat map img

MCF-7
Farnham
RAD21
ENCSR000BTQ
r=0.55

small heat map img

MCF-7
Farnham
SRF
ENCSR000BVA
r=0.54

small heat map img

MCF-7
Farnham
CEBPB
ENCSR000BSR
r=0.53

small heat map img

MCF-7
Farnham
EGR1
ENCSR000BUX
r=0.49

small heat map img

MCF-7
Farnham
PML
ENCSR000BUZ
r=0.49

small heat map img

MCF-7
Farnham
GABPA
ENCSR000BUK
r=0.47

small heat map img

MCF-7
Farnham
TAF1
ENCSR000AHF
r=0.47

small heat map img

MCF-7
Farnham
ELF1
ENCSR000BSS
r=0.46

small heat map img

MCF-7
Farnham
REST
ENCSR000BSP
r=0.44

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMQ
r=0.42

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMP
r=0.37

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DWH
r=0.34

small heat map img

MCF-7
Farnham
CTCF
ENCSR000AHD
r=0.32

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMT
r=0.21

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMR
r=0.21

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMM
r=0.18

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMS
r=0.16

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DML
r=0.11

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMO
r=0.11

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMV
r=0.11

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMN
r=0.06

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMK
r=0.06

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMJ
r=0.05

small heat map img
9,933 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help