UBTF

This gene encodes a member of the HMG-box DNA-binding protein family. The encoded protein plays a critical role in ribosomal RNA transcription as a key component of the pre-initiation complex, mediating the recruitment of RNA polymerase I to rDNA promoter regions. The encoded protein may also play important roles in chromatin remodeling and pre-rRNA processing, and its activity is regulated by both phosphorylation and acetylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3, 11 and X and the long arm of chromosome 11. RefSeq, Aug 2011
Nucleolar transcription factor 1 is a protein that in humans is encoded by the UBTF gene.wikipedia

UBTF

PDB image
PDB 1K99

PDB 1K99 1L8Y 1L8Z 2HDZ
ENCODE experiments
Ensemble search
Entrez 7343
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia UBTF

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

K562 - Snyder - ENCSR000EFW

loading

K562 - Snyder - ENCSR000EFZ

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

K562 - Snyder - ENCSR000EFW

1.
45 / 500
1.0e-45
GCGAAGCCCCGGGCTCGCGTA
small heat map img p-value: 0.00
pct_center: 0.64
pct_ratio: 0.68
2.
184 / 500
2.2e-28
GGGAGGAG
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 0.57
3.
42 / 500
0.0000073
AGATAA
small heat map img p-value: 0.00
pct_center:
pct_ratio:
4.
9 / 500
31
AAAAGTCAGGACAGAGCTCCA
small heat map img p-value: 0.90
pct_center: 0.08
pct_ratio: 0.44
5.
6 / 500
3.5e+2
ACACAGCTGGAGACGACA
small heat map img p-value: 0.51
pct_center: 0.04
pct_ratio: 0.46
MEME output

K562 - Snyder - ENCSR000EFZ

1.
169 / 500
2.5e-46
GGAAGCGGCGGAGGCAGGAGG
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 0.82
2.
23 / 500
1.1e-15
TACGCGAGCCCGGGGCTT
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 0.66
3.
39 / 500
4.4e-9
AGATAA
small heat map img p-value: 0.00
pct_center:
pct_ratio:
4.
29 / 500
0.000012
GGTGAGTCA
small heat map img p-value: 0.00
pct_center: 0.09
pct_ratio: 1.10
5.
6 / 500
0.066
AGCTGTGTGACGGTGGAGCTTTGTCCTGA
small heat map img p-value: 1.00
pct_center: 0.14
pct_ratio: 0.60
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at UBTF peaks

K562 - Snyder - ENCSR000EFW

K562
Snyder
UBTF
ENCSR000EFW
r=1.00

small heat map img

K562
Snyder
UBTF
ENCSR000EFZ
r=0.94

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.46

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.45

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.44

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.44

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.44

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.42

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.41

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.39

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.22

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.21

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.11

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.09

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.05

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.04

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=0.01

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=0.00

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=-0.01

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=-0.05

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.06

small heat map img
6,002 peaks (download )

K562 - Snyder - ENCSR000EFZ

K562
Snyder
UBTF
ENCSR000EFZ
r=1.00

small heat map img

K562
Snyder
UBTF
ENCSR000EFW
r=0.93

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.43

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.42

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.41

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.40

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.40

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.38

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.37

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.36

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.23

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.21

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.11

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.11

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.05

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.05

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=0.02

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=-0.00

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=-0.01

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=-0.03

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.08

small heat map img
10,000 randomly-selected peaks from a total of 13,692 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at UBTF peaks

K562 - Snyder - ENCSR000EFW

K562
Snyder
UBTF
ENCSR000EFW
r=1.00

small heat map img

K562
Snyder
UBTF
ENCSR000EFZ
r=0.94

small heat map img

K562
Snyder
RBBP5
ENCSR000AQI
r=0.65

small heat map img

K562
Snyder
HMGN3
ENCSR000DOB
r=0.62

small heat map img

K562
Snyder
CCNT2
ENCSR000DOA
r=0.60

small heat map img

K562
Snyder
KDM5B
ENCSR000AQA
r=0.53

small heat map img

K562
Snyder
ZMIZ1
ENCSR000EFQ
r=0.53

small heat map img

K562
Snyder
PHF8
ENCSR000AQH
r=0.50

small heat map img

K562
Snyder
MYC
ENCSR000EGJ
r=0.50

small heat map img

K562
Snyder
MAX
ENCSR000EFV
r=0.49

small heat map img

K562
Snyder
POLR2A
ENCSR000BMR
r=0.49

small heat map img

K562
Snyder
RCOR1
ENCSR000EGG
r=0.48

small heat map img

K562
Snyder
POLR2A
ENCSR000FAJ
r=0.48

small heat map img

K562
Snyder
HDAC1
ENCSR000AQF
r=0.47

small heat map img

K562
Snyder
E2F4
ENCSR000EWL
r=0.47

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGA
r=0.47

small heat map img

K562
Snyder
CHD1
ENCSR000AQD
r=0.46

small heat map img

K562
Snyder
MYC
ENCSR000DLZ
r=0.46

small heat map img

K562
Snyder
POLR2A
ENCSR000DLY
r=0.46

small heat map img

K562
Snyder
MYC
ENCSR000EGS
r=0.46

small heat map img

K562
Snyder
TAF1
ENCSR000BKS
r=0.45

small heat map img

K562
Snyder
SETDB1
ENCSR000AUT
r=0.45

small heat map img

K562
Snyder
POLR2A
ENCSR000FAW
r=0.43

small heat map img

K562
Snyder
SAP30
ENCSR000AQJ
r=0.43

small heat map img

K562
Snyder
MYC
ENCSR000FAG
r=0.43

small heat map img

K562
Snyder
HDAC2
ENCSR000AQG
r=0.42

small heat map img

K562
Snyder
SMC3
ENCSR000EGW
r=0.42

small heat map img

K562
Snyder
JUN
ENCSR000EFS
r=0.42

small heat map img

K562
Snyder
POLR2A
ENCSR000FAY
r=0.42

small heat map img

K562
Snyder
ZNF263
ENCSR000EWN
r=0.42

small heat map img

K562
Snyder
IRF1
ENCSR000EGK
r=0.41

small heat map img

K562
Snyder
RCOR1
ENCSR000EGC
r=0.41

small heat map img

K562
Snyder
POLR2A
ENCSR000EHP
r=0.41

small heat map img

K562
Snyder
JUND
ENCSR000EGN
r=0.40

small heat map img

K562
Snyder
POLR2A
ENCSR000FAX
r=0.40

small heat map img

K562
Snyder
CHD7
ENCSR000AVD
r=0.40

small heat map img

K562
Snyder
YY1
ENCSR000BKU
r=0.40

small heat map img

K562
Snyder
SETDB1
ENCSR000EWI
r=0.40

small heat map img

K562
Snyder
MAX
ENCSR000BLP
r=0.40

small heat map img

K562
Snyder
E2F6
ENCSR000EWJ
r=0.40

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGB
r=0.39

small heat map img

K562
Snyder
HDAC6
ENCSR000ATJ
r=0.39

small heat map img

K562
Snyder
IRF1
ENCSR000EGL
r=0.39

small heat map img

K562
Snyder
ELK1
ENCSR000EFU
r=0.39

small heat map img

K562
Snyder
MYC
ENCSR000EZU
r=0.39

small heat map img

K562
Snyder
MXI1
ENCSR000EGZ
r=0.38

small heat map img

K562
Snyder
MYC
ENCSR000FAZ
r=0.38

small heat map img

K562
Snyder
JUN
ENCSR000FAH
r=0.37

small heat map img

K562
Snyder
MYC
ENCSR000EZV
r=0.37

small heat map img

K562
Snyder
EP300
ENCSR000EGE
r=0.37

small heat map img

K562
Snyder
STAT1
ENCSR000EHJ
r=0.37

small heat map img

K562
Snyder
KAT2B
ENCSR000ATZ
r=0.36

small heat map img

K562
Snyder
STAT2
ENCSR000FAT
r=0.36

small heat map img

K562
Snyder
GTF2B
ENCSR000DOE
r=0.36

small heat map img

K562
Snyder
JUN
ENCSR000EGH
r=0.36

small heat map img

K562
Snyder
TRIM28
ENCSR000BRW
r=0.36

small heat map img

K562
Snyder
BHLHE40
ENCSR000EGV
r=0.35

small heat map img

K562
Snyder
GATA1
ENCSR000EFT
r=0.35

small heat map img

K562
Snyder
ELF1
ENCSR000BMD
r=0.34

small heat map img

K562
Snyder
TBP
ENCSR000EHA
r=0.34

small heat map img

K562
Snyder
CBX3
ENCSR000BRT
r=0.34

small heat map img

K562
Snyder
HCFC1
ENCSR000EFN
r=0.33

small heat map img

K562
Snyder
CEBPD
ENCSR000BVY
r=0.33

small heat map img

K562
Snyder
WHSC1
ENCSR000AVE
r=0.32

small heat map img

K562
Snyder
STAT1
ENCSR000EHK
r=0.32

small heat map img

K562
Snyder
ETS1
ENCSR000BKQ
r=0.32

small heat map img

K562
Snyder
CREB1
ENCSR000BSO
r=0.31

small heat map img

K562
Snyder
CBX3
ENCSR000ATV
r=0.31

small heat map img

K562
Snyder
RNF2
ENCSR000AUA
r=0.31

small heat map img

K562
Snyder
POLR2A
ENCSR000EHL
r=0.31

small heat map img

K562
Snyder
REST
ENCSR000BMW
r=0.31

small heat map img

K562
Snyder
MAX
ENCSR000FAE
r=0.30

small heat map img

K562
Snyder
CTCF
ENCSR000EGM
r=0.30

small heat map img

K562
Snyder
ZNF384
ENCSR000EFP
r=0.30

small heat map img

K562
Snyder
SIRT6
ENCSR000AUB
r=0.29

small heat map img

K562
Snyder
NCOR1
ENCSR000ATY
r=0.29

small heat map img

K562
Snyder
ARID3A
ENCSR000EFY
r=0.29

small heat map img

K562
Snyder
CTCF
ENCSR000BPJ
r=0.28

small heat map img

K562
Snyder
GTF3C2
ENCSR000DOD
r=0.28

small heat map img

K562
Snyder
STAT5A
ENCSR000BRR
r=0.27

small heat map img

K562
Snyder
STAT1
ENCSR000FAU
r=0.27

small heat map img

K562
Snyder
HDAC2
ENCSR000BMG
r=0.26

small heat map img

K562
Snyder
PML
ENCSR000BQY
r=0.26

small heat map img

K562
Snyder
CTCFL
ENCSR000BNK
r=0.26

small heat map img

K562
Snyder
MAFK
ENCSR000EGX
r=0.26

small heat map img

K562
Snyder
EGR1
ENCSR000BNE
r=0.26

small heat map img

K562
Snyder
CTCF
ENCSR000AKO
r=0.26

small heat map img

K562
Snyder
GATA1
ENCSR000EWM
r=0.26

small heat map img

K562
Snyder
E2F6
ENCSR000BLI
r=0.26

small heat map img

K562
Snyder
TEAD4
ENCSR000BRK
r=0.26

small heat map img

K562
Snyder
CTCF
ENCSR000DWE
r=0.25

small heat map img

K562
Snyder
SUZ12
ENCSR000AUC
r=0.25

small heat map img

K562
Snyder
YY1
ENCSR000EWF
r=0.25

small heat map img

K562
Snyder
STAT1
ENCSR000FAV
r=0.25

small heat map img

K562
Snyder
KDM1A
ENCSR000ATX
r=0.25

small heat map img

K562
Snyder
CTCF
ENCSR000DMA
r=0.25

small heat map img

K562
Snyder
NR2F2
ENCSR000BRS
r=0.25

small heat map img

K562
Snyder
STAT2
ENCSR000FBC
r=0.24

small heat map img

K562
Snyder
ATF1
ENCSR000DNZ
r=0.24

small heat map img

K562
Snyder
TAL1
ENCSR000EHB
r=0.24

small heat map img

K562
Snyder
SMARCB1
ENCSR000EHN
r=0.24

small heat map img

K562
Snyder
ZNF274
ENCSR000EVX
r=0.23

small heat map img

K562
Snyder
ATF3
ENCSR000BNU
r=0.23

small heat map img

K562
Snyder
GATA2
ENCSR000EWG
r=0.23

small heat map img

K562
Snyder
CHD4
ENCSR000ATL
r=0.22

small heat map img

K562
Snyder
IRF1
ENCSR000EGT
r=0.22

small heat map img

K562
Snyder
ZBTB7A
ENCSR000BME
r=0.22

small heat map img

K562
Snyder
BACH1
ENCSR000EGD
r=0.22

small heat map img

K562
Snyder
GABPA
ENCSR000BLO
r=0.22

small heat map img

K562
Snyder
SMARCA4
ENCSR000EHO
r=0.22

small heat map img

K562
Snyder
CUX1
ENCSR000EFO
r=0.22

small heat map img

K562
Snyder
THAP1
ENCSR000BNN
r=0.21

small heat map img

K562
Snyder
TAF7
ENCSR000BNM
r=0.21

small heat map img

K562
Snyder
SIN3A
ENCSR000BLR
r=0.20

small heat map img

K562
Snyder
NFE2
ENCSR000FAF
r=0.20

small heat map img

K562
Snyder
JUN
ENCSR000EZX
r=0.20

small heat map img

K562
Snyder
ZNF143
ENCSR000EGP
r=0.20

small heat map img

K562
Snyder
EP300
ENCSR000AQB
r=0.20

small heat map img

K562
Snyder
ATF3
ENCSR000DOG
r=0.20

small heat map img

K562
Snyder
RAD21
ENCSR000BKV
r=0.19

small heat map img

K562
Snyder
SRF
ENCSR000BLK
r=0.18

small heat map img

K562
Snyder
EP300
ENCSR000EGY
r=0.17

small heat map img

K562
Snyder
RAD21
ENCSR000FAD
r=0.17

small heat map img

K562
Snyder
CEBPB
ENCSR000BRQ
r=0.17

small heat map img

K562
Snyder
TRIM28
ENCSR000EVY
r=0.16

small heat map img

K562
Snyder
JUN
ENCSR000EZT
r=0.16

small heat map img

K562
Snyder
GATA2
ENCSR000BKM
r=0.16

small heat map img

K562
Snyder
REST
ENCSR000ATM
r=0.15

small heat map img

K562
Snyder
MEF2A
ENCSR000BNV
r=0.15

small heat map img

K562
Snyder
SPI1
ENCSR000BGW
r=0.15

small heat map img

K562
Snyder
USF1
ENCSR000BKT
r=0.14

small heat map img

K562
Snyder
RFX5
ENCSR000EGO
r=0.14

small heat map img

K562
Snyder
FOS
ENCSR000FAI
r=0.14

small heat map img

K562
Snyder
YY1
ENCSR000BMH
r=0.13

small heat map img

K562
Snyder
FOSL1
ENCSR000BMV
r=0.13

small heat map img

K562
Snyder
IRF1
ENCSR000EGU
r=0.12

small heat map img

K562
Snyder
NFYA
ENCSR000EGR
r=0.12

small heat map img

K562
Snyder
CEBPB
ENCSR000EHE
r=0.12

small heat map img

K562
Snyder
SP1
ENCSR000BKO
r=0.12

small heat map img

K562
Snyder
NRF1
ENCSR000EHH
r=0.11

small heat map img

K562
Snyder
SIRT6
ENCSR000DOH
r=0.11

small heat map img

K562
Snyder
JUN
ENCSR000EZW
r=0.11

small heat map img

K562
Snyder
BRF2
ENCSR000DOC
r=0.11

small heat map img

K562
Snyder
ZBTB33
ENCSR000BKF
r=0.11

small heat map img

K562
Snyder
SP2
ENCSR000BNL
r=0.11

small heat map img

K562
Snyder
CREBBP
ENCSR000ATT
r=0.10

small heat map img

K562
Snyder
SIX5
ENCSR000BGX
r=0.09

small heat map img

K562
Snyder
USF2
ENCSR000EHG
r=0.08

small heat map img

K562
Snyder
EZH2
ENCSR000AQE
r=0.07

small heat map img

K562
Snyder
XRCC4
ENCSR000FAC
r=0.07

small heat map img

K562
Snyder
NFYB
ENCSR000EGQ
r=0.07

small heat map img

K562
Snyder
SIX5
ENCSR000BNW
r=0.06

small heat map img

K562
Snyder
MAFF
ENCSR000EGI
r=0.06

small heat map img

K562
Snyder
SETDB1
ENCSR000EWD
r=0.05

small heat map img

K562
Snyder
NR2C2
ENCSR000EWH
r=0.05

small heat map img

K562
Snyder
POLR3A
ENCSR000DOI
r=0.05

small heat map img

K562
Snyder
CBX2
ENCSR000ATU
r=0.04

small heat map img

K562
Snyder
BRF1
ENCSR000DOJ
r=0.04

small heat map img

K562
Snyder
CBX8
ENCSR000ATW
r=0.04

small heat map img

K562
Snyder
BDP1
ENCSR000DOK
r=-0.00

small heat map img

K562
Snyder
POLR3G
ENCSR000EHQ
r=-0.02

small heat map img

K562
Snyder
ZNF274
ENCSR000EWE
r=-0.17

small heat map img
6,002 peaks (download )

K562 - Snyder - ENCSR000EFZ

K562
Snyder
UBTF
ENCSR000EFZ
r=1.00

small heat map img

K562
Snyder
UBTF
ENCSR000EFW
r=0.93

small heat map img

K562
Snyder
HMGN3
ENCSR000DOB
r=0.66

small heat map img

K562
Snyder
CCNT2
ENCSR000DOA
r=0.65

small heat map img

K562
Snyder
RBBP5
ENCSR000AQI
r=0.65

small heat map img

K562
Snyder
KDM5B
ENCSR000AQA
r=0.57

small heat map img

K562
Snyder
ZMIZ1
ENCSR000EFQ
r=0.56

small heat map img

K562
Snyder
MAX
ENCSR000EFV
r=0.55

small heat map img

K562
Snyder
MYC
ENCSR000EGJ
r=0.55

small heat map img

K562
Snyder
POLR2A
ENCSR000BMR
r=0.53

small heat map img

K562
Snyder
POLR2A
ENCSR000FAJ
r=0.53

small heat map img

K562
Snyder
RCOR1
ENCSR000EGG
r=0.52

small heat map img

K562
Snyder
E2F4
ENCSR000EWL
r=0.52

small heat map img

K562
Snyder
MYC
ENCSR000DLZ
r=0.52

small heat map img

K562
Snyder
MYC
ENCSR000EGS
r=0.52

small heat map img

K562
Snyder
POLR2A
ENCSR000DLY
r=0.51

small heat map img

K562
Snyder
PHF8
ENCSR000AQH
r=0.51

small heat map img

K562
Snyder
HDAC1
ENCSR000AQF
r=0.50

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGA
r=0.50

small heat map img

K562
Snyder
MYC
ENCSR000FAG
r=0.48

small heat map img

K562
Snyder
POLR2A
ENCSR000FAW
r=0.48

small heat map img

K562
Snyder
TAF1
ENCSR000BKS
r=0.48

small heat map img

K562
Snyder
SETDB1
ENCSR000AUT
r=0.48

small heat map img

K562
Snyder
JUN
ENCSR000EFS
r=0.47

small heat map img

K562
Snyder
POLR2A
ENCSR000FAY
r=0.47

small heat map img

K562
Snyder
POLR2A
ENCSR000EHP
r=0.46

small heat map img

K562
Snyder
E2F6
ENCSR000EWJ
r=0.45

small heat map img

K562
Snyder
IRF1
ENCSR000EGK
r=0.45

small heat map img

K562
Snyder
SAP30
ENCSR000AQJ
r=0.45

small heat map img

K562
Snyder
CHD1
ENCSR000AQD
r=0.45

small heat map img

K562
Snyder
MYC
ENCSR000EZU
r=0.45

small heat map img

K562
Snyder
JUND
ENCSR000EGN
r=0.45

small heat map img

K562
Snyder
POLR2A
ENCSR000FAX
r=0.45

small heat map img

K562
Snyder
HDAC2
ENCSR000AQG
r=0.45

small heat map img

K562
Snyder
MAX
ENCSR000BLP
r=0.44

small heat map img

K562
Snyder
RCOR1
ENCSR000EGC
r=0.44

small heat map img

K562
Snyder
IRF1
ENCSR000EGL
r=0.44

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGB
r=0.43

small heat map img

K562
Snyder
MYC
ENCSR000FAZ
r=0.43

small heat map img

K562
Snyder
MXI1
ENCSR000EGZ
r=0.43

small heat map img

K562
Snyder
MYC
ENCSR000EZV
r=0.43

small heat map img

K562
Snyder
SMC3
ENCSR000EGW
r=0.43

small heat map img

K562
Snyder
YY1
ENCSR000BKU
r=0.43

small heat map img

K562
Snyder
ZNF263
ENCSR000EWN
r=0.43

small heat map img

K562
Snyder
CHD7
ENCSR000AVD
r=0.42

small heat map img

K562
Snyder
JUN
ENCSR000FAH
r=0.42

small heat map img

K562
Snyder
ELK1
ENCSR000EFU
r=0.42

small heat map img

K562
Snyder
SETDB1
ENCSR000EWI
r=0.42

small heat map img

K562
Snyder
HDAC6
ENCSR000ATJ
r=0.41

small heat map img

K562
Snyder
STAT1
ENCSR000EHJ
r=0.41

small heat map img

K562
Snyder
BHLHE40
ENCSR000EGV
r=0.41

small heat map img

K562
Snyder
JUN
ENCSR000EGH
r=0.40

small heat map img

K562
Snyder
STAT2
ENCSR000FAT
r=0.40

small heat map img

K562
Snyder
GTF2B
ENCSR000DOE
r=0.40

small heat map img

K562
Snyder
TBP
ENCSR000EHA
r=0.40

small heat map img

K562
Snyder
TRIM28
ENCSR000BRW
r=0.39

small heat map img

K562
Snyder
EP300
ENCSR000EGE
r=0.39

small heat map img

K562
Snyder
CBX3
ENCSR000BRT
r=0.38

small heat map img

K562
Snyder
KAT2B
ENCSR000ATZ
r=0.38

small heat map img

K562
Snyder
ELF1
ENCSR000BMD
r=0.38

small heat map img

K562
Snyder
GATA1
ENCSR000EFT
r=0.37

small heat map img

K562
Snyder
CREB1
ENCSR000BSO
r=0.37

small heat map img

K562
Snyder
HCFC1
ENCSR000EFN
r=0.37

small heat map img

K562
Snyder
CEBPD
ENCSR000BVY
r=0.36

small heat map img

K562
Snyder
MAX
ENCSR000FAE
r=0.36

small heat map img

K562
Snyder
STAT1
ENCSR000EHK
r=0.35

small heat map img

K562
Snyder
POLR2A
ENCSR000EHL
r=0.35

small heat map img

K562
Snyder
ETS1
ENCSR000BKQ
r=0.33

small heat map img

K562
Snyder
RNF2
ENCSR000AUA
r=0.33

small heat map img

K562
Snyder
WHSC1
ENCSR000AVE
r=0.32

small heat map img

K562
Snyder
ZNF384
ENCSR000EFP
r=0.32

small heat map img

K562
Snyder
CBX3
ENCSR000ATV
r=0.32

small heat map img

K562
Snyder
ARID3A
ENCSR000EFY
r=0.32

small heat map img

K562
Snyder
EGR1
ENCSR000BNE
r=0.31

small heat map img

K562
Snyder
STAT1
ENCSR000FAU
r=0.31

small heat map img

K562
Snyder
CTCF
ENCSR000EGM
r=0.31

small heat map img

K562
Snyder
NCOR1
ENCSR000ATY
r=0.31

small heat map img

K562
Snyder
GTF3C2
ENCSR000DOD
r=0.30

small heat map img

K562
Snyder
ATF1
ENCSR000DNZ
r=0.30

small heat map img

K562
Snyder
STAT5A
ENCSR000BRR
r=0.30

small heat map img

K562
Snyder
SIRT6
ENCSR000AUB
r=0.30

small heat map img

K562
Snyder
IRF1
ENCSR000EGT
r=0.30

small heat map img

K562
Snyder
STAT1
ENCSR000FAV
r=0.29

small heat map img

K562
Snyder
CTCF
ENCSR000BPJ
r=0.29

small heat map img

K562
Snyder
REST
ENCSR000BMW
r=0.29

small heat map img

K562
Snyder
E2F6
ENCSR000BLI
r=0.29

small heat map img

K562
Snyder
STAT2
ENCSR000FBC
r=0.29

small heat map img

K562
Snyder
PML
ENCSR000BQY
r=0.28

small heat map img

K562
Snyder
HDAC2
ENCSR000BMG
r=0.28

small heat map img

K562
Snyder
MAFK
ENCSR000EGX
r=0.28

small heat map img

K562
Snyder
TEAD4
ENCSR000BRK
r=0.28

small heat map img

K562
Snyder
YY1
ENCSR000EWF
r=0.28

small heat map img

K562
Snyder
NR2F2
ENCSR000BRS
r=0.28

small heat map img

K562
Snyder
KDM1A
ENCSR000ATX
r=0.28

small heat map img

K562
Snyder
GATA1
ENCSR000EWM
r=0.27

small heat map img

K562
Snyder
CTCFL
ENCSR000BNK
r=0.27

small heat map img

K562
Snyder
ATF3
ENCSR000BNU
r=0.26

small heat map img

K562
Snyder
SMARCB1
ENCSR000EHN
r=0.26

small heat map img

K562
Snyder
CTCF
ENCSR000DMA
r=0.26

small heat map img

K562
Snyder
CTCF
ENCSR000AKO
r=0.26

small heat map img

K562
Snyder
CTCF
ENCSR000DWE
r=0.26

small heat map img

K562
Snyder
SUZ12
ENCSR000AUC
r=0.25

small heat map img

K562
Snyder
CUX1
ENCSR000EFO
r=0.25

small heat map img

K562
Snyder
SMARCA4
ENCSR000EHO
r=0.25

small heat map img

K562
Snyder
BACH1
ENCSR000EGD
r=0.25

small heat map img

K562
Snyder
TAL1
ENCSR000EHB
r=0.25

small heat map img

K562
Snyder
GATA2
ENCSR000EWG
r=0.25

small heat map img

K562
Snyder
ZNF143
ENCSR000EGP
r=0.25

small heat map img

K562
Snyder
GABPA
ENCSR000BLO
r=0.24

small heat map img

K562
Snyder
JUN
ENCSR000EZX
r=0.24

small heat map img

K562
Snyder
ZBTB7A
ENCSR000BME
r=0.24

small heat map img

K562
Snyder
CHD4
ENCSR000ATL
r=0.24

small heat map img

K562
Snyder
EP300
ENCSR000AQB
r=0.23

small heat map img

K562
Snyder
ZNF274
ENCSR000EVX
r=0.23

small heat map img

K562
Snyder
NFE2
ENCSR000FAF
r=0.22

small heat map img

K562
Snyder
ATF3
ENCSR000DOG
r=0.22

small heat map img

K562
Snyder
SIN3A
ENCSR000BLR
r=0.22

small heat map img

K562
Snyder
THAP1
ENCSR000BNN
r=0.21

small heat map img

K562
Snyder
EP300
ENCSR000EGY
r=0.21

small heat map img

K562
Snyder
TAF7
ENCSR000BNM
r=0.21

small heat map img

K562
Snyder
JUN
ENCSR000EZT
r=0.20

small heat map img

K562
Snyder
SRF
ENCSR000BLK
r=0.20

small heat map img

K562
Snyder
CEBPB
ENCSR000BRQ
r=0.20

small heat map img

K562
Snyder
RAD21
ENCSR000BKV
r=0.20

small heat map img

K562
Snyder
RAD21
ENCSR000FAD
r=0.19

small heat map img

K562
Snyder
FOS
ENCSR000FAI
r=0.19

small heat map img

K562
Snyder
RFX5
ENCSR000EGO
r=0.18

small heat map img

K562
Snyder
USF1
ENCSR000BKT
r=0.18

small heat map img

K562
Snyder
TRIM28
ENCSR000EVY
r=0.18

small heat map img

K562
Snyder
GATA2
ENCSR000BKM
r=0.17

small heat map img

K562
Snyder
NFYA
ENCSR000EGR
r=0.17

small heat map img

K562
Snyder
SPI1
ENCSR000BGW
r=0.16

small heat map img

K562
Snyder
IRF1
ENCSR000EGU
r=0.16

small heat map img

K562
Snyder
MEF2A
ENCSR000BNV
r=0.16

small heat map img

K562
Snyder
NRF1
ENCSR000EHH
r=0.16

small heat map img

K562
Snyder
CEBPB
ENCSR000EHE
r=0.15

small heat map img

K562
Snyder
SIRT6
ENCSR000DOH
r=0.15

small heat map img

K562
Snyder
JUN
ENCSR000EZW
r=0.15

small heat map img

K562
Snyder
FOSL1
ENCSR000BMV
r=0.14

small heat map img

K562
Snyder
YY1
ENCSR000BMH
r=0.14

small heat map img

K562
Snyder
REST
ENCSR000ATM
r=0.13

small heat map img

K562
Snyder
SP1
ENCSR000BKO
r=0.13

small heat map img

K562
Snyder
BRF2
ENCSR000DOC
r=0.12

small heat map img

K562
Snyder
CREBBP
ENCSR000ATT
r=0.12

small heat map img

K562
Snyder
SP2
ENCSR000BNL
r=0.12

small heat map img

K562
Snyder
ZBTB33
ENCSR000BKF
r=0.11

small heat map img

K562
Snyder
USF2
ENCSR000EHG
r=0.11

small heat map img

K562
Snyder
NFYB
ENCSR000EGQ
r=0.10

small heat map img

K562
Snyder
MAFF
ENCSR000EGI
r=0.10

small heat map img

K562
Snyder
SIX5
ENCSR000BGX
r=0.10

small heat map img

K562
Snyder
EZH2
ENCSR000AQE
r=0.09

small heat map img

K562
Snyder
XRCC4
ENCSR000FAC
r=0.08

small heat map img

K562
Snyder
SIX5
ENCSR000BNW
r=0.07

small heat map img

K562
Snyder
SETDB1
ENCSR000EWD
r=0.06

small heat map img

K562
Snyder
POLR3A
ENCSR000DOI
r=0.06

small heat map img

K562
Snyder
NR2C2
ENCSR000EWH
r=0.05

small heat map img

K562
Snyder
BRF1
ENCSR000DOJ
r=0.04

small heat map img

K562
Snyder
CBX2
ENCSR000ATU
r=0.03

small heat map img

K562
Snyder
CBX8
ENCSR000ATW
r=0.03

small heat map img

K562
Snyder
BDP1
ENCSR000DOK
r=0.01

small heat map img

K562
Snyder
POLR3G
ENCSR000EHQ
r=-0.01

small heat map img

K562
Snyder
ZNF274
ENCSR000EWE
r=-0.17

small heat map img
10,000 randomly-selected peaks from a total of 13,692 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

K562 - Snyder - ENCSR000EFW

loading

K562 - Snyder - ENCSR000EFZ

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help