THAP1 - Factorbook

The protein encoded by this gene contains a THAP domain, a conserved DNA-binding domain. This protein colocalizes with the apoptosis response protein PAWR/PAR-4 in promyelocytic leukemia (PML) nuclear bodies, and functions as a proapoptotic factor that links PAWR to PML nuclear bodies. Alternatively spliced transcript variants encoding distinct isoforms have been observed. RefSeq, Jul 2008

THAP domain-containing protein 1 is a protein that in humans is encoded by the THAP1 gene. The synonyme is DYT6 (Dystonia 6).wikipedia

THAP1
PDB 2JTG
PDB	2JTG 2KO0 2L1G
ENCODE	experiments
Ensemble	search
Entrez	55145
GO	search
Gene Card	search
HGNC	search
RefSeq	search
UCSC	browse
UniProt	search
Wikipedia	THAP1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

K562 - Myers - ENCSR000BNN

Legend

Proximal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Distal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

K562 - Myers

K562 - Myers - ENCSR000BNN

1. 191 / 500 3.5e-595 GCCATCTTGGTTGAGGGCAG		p-value: 0.00 pct_center: 0.12 pct_ratio: 0.76
2. 121 / 500 8.8e-134 TCCGGGCGGAAGTGG		p-value: 0.00 pct_center: 0.41 pct_ratio: 0.88
3. 94 / 500 2.8e-73 TGCGCATGCGCAGTG		p-value: 0.00 pct_center: 0.40 pct_ratio: 1.04
4. 33 / 500 2.9e-26 GCCGCCATCTTGGATGAGGGC		p-value: 0.00 pct_center: 0.22 pct_ratio: 0.82
5. 94 / 500 1.9e-19 TGAAGCCG		p-value: 0.00 pct_center: 0.14 pct_ratio: 0.81

MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at THAP1 peaks

K562 - Myers

K562 - Myers - ENCSR000BNN

K562 Myers THAP1 ENCSR000BNN r=1.00
K562 Myers H2AFZ ENCSR000APC r=0.26
K562 Myers H3K9ac ENCSR000EVZ r=0.25
K562 Myers H3K4me3 ENCSR000EWA r=0.24
K562 Myers H3K4me3 ENCSR000DWD r=0.24
K562 Myers H3K4me3 ENCSR000AKU r=0.23
K562 Myers H3K4me2 ENCSR000AKT r=0.23
K562 Myers H3K9ac ENCSR000AKV r=0.23
K562 Myers H3K27ac ENCSR000AKP r=0.23
K562 Myers H3K4me1 ENCSR000EWC r=0.10
K562 Myers H3K79me2 ENCSR000APD r=0.06
K562 Myers H3K9me3 ENCSR000APE r=0.03
K562 Myers H4K20me1 ENCSR000AKX r=0.03
K562 Myers H3K27me3 ENCSR000AKQ r=0.02
K562 Myers H3K27me3 ENCSR000DWC r=0.02
K562 Myers H3K9me1 ENCSR000AKW r=0.02
K562 Myers H3K4me1 ENCSR000AKS r=0.01
K562 Myers H3K27me3 ENCSR000EWB r=-0.00
K562 Myers H3K36me3 ENCSR000DWB r=-0.03
K562 Myers H3K36me3 ENCSR000AKR r=-0.04

3,506 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

Binding of other TFs at THAP1 peaks

K562 - Myers

K562 - Myers - ENCSR000BNN

K562 Myers THAP1 ENCSR000BNN r=1.00
K562 Myers YY1 ENCSR000EWF r=0.55
K562 Myers YY1 ENCSR000BKU r=0.54
K562 Myers HCFC1 ENCSR000EFN r=0.49
K562 Myers YY1 ENCSR000BMH r=0.49
K562 Myers ELF1 ENCSR000BMD r=0.33
K562 Myers IRF1 ENCSR000EGT r=0.32
K562 Myers SIX5 ENCSR000BGX r=0.32
K562 Myers JUN ENCSR000EGH r=0.31
K562 Myers E2F4 ENCSR000EWL r=0.30
K562 Myers MYC ENCSR000EGS r=0.30
K562 Myers JUN ENCSR000EFS r=0.30
K562 Myers JUND ENCSR000EGN r=0.29
K562 Myers MYC ENCSR000FAG r=0.29
K562 Myers JUN ENCSR000FAH r=0.29
K562 Myers ATF1 ENCSR000DNZ r=0.29
K562 Myers ELK1 ENCSR000EFU r=0.29
K562 Myers IRF1 ENCSR000EGL r=0.29
K562 Myers MYC ENCSR000EZU r=0.29
K562 Myers MYC ENCSR000EZV r=0.29
K562 Myers IRF1 ENCSR000EGK r=0.29
K562 Myers MYC ENCSR000FAZ r=0.29
K562 Myers ETS1 ENCSR000BKQ r=0.28
K562 Myers MYC ENCSR000EGJ r=0.28
K562 Myers MAX ENCSR000EFV r=0.28
K562 Myers CREB1 ENCSR000BSO r=0.28
K562 Myers STAT1 ENCSR000EHJ r=0.27
K562 Myers STAT2 ENCSR000FAT r=0.26
K562 Myers SETDB1 ENCSR000AUT r=0.26
K562 Myers TBL1XR1 ENCSR000EGB r=0.26
K562 Myers MXI1 ENCSR000EGZ r=0.25
K562 Myers MAX ENCSR000FAE r=0.25
K562 Myers MYC ENCSR000DLZ r=0.25
K562 Myers GABPA ENCSR000BLO r=0.25
K562 Myers HMGN3 ENCSR000DOB r=0.25
K562 Myers MAX ENCSR000BLP r=0.25
K562 Myers ATF3 ENCSR000BNU r=0.24
K562 Myers RCOR1 ENCSR000EGG r=0.24
K562 Myers CBX3 ENCSR000BRT r=0.23
K562 Myers POLR2A ENCSR000DLY r=0.23
K562 Myers CCNT2 ENCSR000DOA r=0.23
K562 Myers TAF1 ENCSR000BKS r=0.23
K562 Myers TBL1XR1 ENCSR000EGA r=0.23
K562 Myers SIX5 ENCSR000BNW r=0.23
K562 Myers ZMIZ1 ENCSR000EFQ r=0.23
K562 Myers STAT1 ENCSR000FAV r=0.22
K562 Myers STAT1 ENCSR000EHK r=0.22
K562 Myers SETDB1 ENCSR000EWI r=0.22
K562 Myers E2F6 ENCSR000EWJ r=0.22
K562 Myers EP300 ENCSR000EGE r=0.22
K562 Myers BHLHE40 ENCSR000EGV r=0.22
K562 Myers GATA1 ENCSR000EFT r=0.22
K562 Myers TRIM28 ENCSR000BRW r=0.21
K562 Myers MAFK ENCSR000EGX r=0.21
K562 Myers STAT1 ENCSR000FAU r=0.21
K562 Myers SAP30 ENCSR000AQJ r=0.21
K562 Myers KAT2B ENCSR000ATZ r=0.21
K562 Myers JUN ENCSR000EZX r=0.21
K562 Myers POLR2A ENCSR000FAW r=0.20
K562 Myers NRF1 ENCSR000EHH r=0.20
K562 Myers POLR2A ENCSR000FAY r=0.20
K562 Myers ATF3 ENCSR000DOG r=0.20
K562 Myers POLR2A ENCSR000FAJ r=0.20
K562 Myers GTF2B ENCSR000DOE r=0.20
K562 Myers KDM5B ENCSR000AQA r=0.19
K562 Myers STAT2 ENCSR000FBC r=0.19
K562 Myers RCOR1 ENCSR000EGC r=0.19
K562 Myers POLR2A ENCSR000FAX r=0.19
K562 Myers SRF ENCSR000BLK r=0.19
K562 Myers STAT5A ENCSR000BRR r=0.19
K562 Myers POLR2A ENCSR000EHP r=0.19
K562 Myers JUN ENCSR000EZT r=0.19
K562 Myers NFYA ENCSR000EGR r=0.19
K562 Myers CEBPD ENCSR000BVY r=0.18
K562 Myers USF1 ENCSR000BKT r=0.18
K562 Myers EGR1 ENCSR000BNE r=0.18
K562 Myers ARID3A ENCSR000EFY r=0.18
K562 Myers POLR2A ENCSR000BMR r=0.18
K562 Myers NFE2 ENCSR000FAF r=0.17
K562 Myers RBBP5 ENCSR000AQI r=0.17
K562 Myers ZNF263 ENCSR000EWN r=0.17
K562 Myers SMC3 ENCSR000EGW r=0.17
K562 Myers FOS ENCSR000FAI r=0.17
K562 Myers IRF1 ENCSR000EGU r=0.17
K562 Myers PHF8 ENCSR000AQH r=0.17
K562 Myers NR2F2 ENCSR000BRS r=0.17
K562 Myers CHD7 ENCSR000AVD r=0.17
K562 Myers JUN ENCSR000EZW r=0.17
K562 Myers ZNF384 ENCSR000EFP r=0.17
K562 Myers HDAC6 ENCSR000ATJ r=0.16
K562 Myers GATA1 ENCSR000EWM r=0.16
K562 Myers ZNF143 ENCSR000EGP r=0.16
K562 Myers TEAD4 ENCSR000BRK r=0.16
K562 Myers EP300 ENCSR000EGY r=0.15
K562 Myers WHSC1 ENCSR000AVE r=0.15
K562 Myers RFX5 ENCSR000EGO r=0.15
K562 Myers SP2 ENCSR000BNL r=0.15
K562 Myers CEBPB ENCSR000BRQ r=0.15
K562 Myers SPI1 ENCSR000BGW r=0.15
K562 Myers CUX1 ENCSR000EFO r=0.15
K562 Myers HDAC1 ENCSR000AQF r=0.15
K562 Myers E2F6 ENCSR000BLI r=0.15
K562 Myers NFYB ENCSR000EGQ r=0.14
K562 Myers CTCFL ENCSR000BNK r=0.14
K562 Myers CBX3 ENCSR000ATV r=0.14
K562 Myers USF2 ENCSR000EHG r=0.14
K562 Myers PML ENCSR000BQY r=0.14
K562 Myers SIN3A ENCSR000BLR r=0.13
K562 Myers SETDB1 ENCSR000EWD r=0.13
K562 Myers SP1 ENCSR000BKO r=0.13
K562 Myers HDAC2 ENCSR000AQG r=0.12
K562 Myers CEBPB ENCSR000EHE r=0.12
K562 Myers BACH1 ENCSR000EGD r=0.12
K562 Myers CTCF ENCSR000EGM r=0.12
K562 Myers HDAC2 ENCSR000BMG r=0.12
K562 Myers POLR2A ENCSR000EHL r=0.12
K562 Myers EP300 ENCSR000AQB r=0.12
K562 Myers SIRT6 ENCSR000DOH r=0.11
K562 Myers MAFF ENCSR000EGI r=0.11
K562 Myers NCOR1 ENCSR000ATY r=0.11
K562 Myers ZBTB7A ENCSR000BME r=0.11
K562 Myers TAF7 ENCSR000BNM r=0.10
K562 Myers NR2C2 ENCSR000EWH r=0.10
K562 Myers TAL1 ENCSR000EHB r=0.10
K562 Myers FOSL1 ENCSR000BMV r=0.10
K562 Myers SIRT6 ENCSR000AUB r=0.10
K562 Myers TRIM28 ENCSR000EVY r=0.10
K562 Myers TBP ENCSR000EHA r=0.10
K562 Myers GATA2 ENCSR000EWG r=0.10
K562 Myers CTCF ENCSR000BPJ r=0.09
K562 Myers MEF2A ENCSR000BNV r=0.09
K562 Myers ZBTB33 ENCSR000BKF r=0.09
K562 Myers RAD21 ENCSR000FAD r=0.09
K562 Myers REST ENCSR000ATM r=0.09
K562 Myers SUZ12 ENCSR000AUC r=0.09
K562 Myers CREBBP ENCSR000ATT r=0.09
K562 Myers CTCF ENCSR000DWE r=0.09
K562 Myers CTCF ENCSR000AKO r=0.09
K562 Myers RNF2 ENCSR000AUA r=0.09
K562 Myers XRCC4 ENCSR000FAC r=0.09
K562 Myers REST ENCSR000BMW r=0.08
K562 Myers BRF2 ENCSR000DOC r=0.08
K562 Myers CTCF ENCSR000DMA r=0.08
K562 Myers KDM1A ENCSR000ATX r=0.08
K562 Myers UBTF ENCSR000EFZ r=0.08
K562 Myers RAD21 ENCSR000BKV r=0.07
K562 Myers SMARCA4 ENCSR000EHO r=0.07
K562 Myers SMARCB1 ENCSR000EHN r=0.07
K562 Myers UBTF ENCSR000EFW r=0.07
K562 Myers ZNF274 ENCSR000EVX r=0.06
K562 Myers GATA2 ENCSR000BKM r=0.06
K562 Myers GTF3C2 ENCSR000DOD r=0.06
K562 Myers CHD4 ENCSR000ATL r=0.06
K562 Myers CHD1 ENCSR000AQD r=0.05
K562 Myers EZH2 ENCSR000AQE r=0.04
K562 Myers CBX2 ENCSR000ATU r=0.03
K562 Myers CBX8 ENCSR000ATW r=0.03
K562 Myers POLR3G ENCSR000EHQ r=0.02
K562 Myers BRF1 ENCSR000DOJ r=0.02
K562 Myers BDP1 ENCSR000DOK r=0.01
K562 Myers POLR3A ENCSR000DOI r=-0.01
K562 Myers ZNF274 ENCSR000EWE r=-0.07

3,506 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

K562 - Myers - ENCSR000BNN

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.