TCF7L2

This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.RefSeq, Oct 2010
Transcription factor 7-like 2 (T-cell specific, HMG-box) also known as TCF7L2 or TCF4 is a protein acting as a transcription factor. In humans this protein is encoded by the TCF7L2 gene.wikipedia

TCF7L2

PDB image
PDB 1JDH

PDB 1JDH 1JPW 2GL7
ENCODE experiments
Ensemble search
Entrez 6934
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia TCF7L2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

HCT116 - Farnham - ENCSR000EUV

loading

HeLa-S3 - Farnham - ENCSR000EVE

loading

HeLa-S3 - Farnham - ENCSR000EVF

loading

HepG2 - Farnham - ENCSR000EVQ

loading

MCF-7 - Farnham - ENCSR000EWT

loading

Panc1 - Farnham - ENCSR000EXL

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

HCT116 - Farnham - ENCSR000EUV

1.
476 / 500
1.4e-549
AGATCAAAGGGACCG
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 2.20
2.
112 / 500
2.3e-55
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 2.50
3.
70 / 500
1.5e-21
GGGCGGGGGGGGCGCGGGGGGCGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 0.70
4.
73 / 500
0.0044
AGCAGGAA
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.55
5.
21 / 500
1.8e+2
CTTTGAAG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 1.17
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HEK293 - Farnham - ENCSR000EUY

1.
423 / 500
5.2e-346
GGAGAGATCAAAGGG
small heat map img p-value: 0.00
pct_center: 0.38
pct_ratio: 1.90
2.
63 / 500
4.1e-52
CCGGCGGGCGCGGGGGGGCGCGCCGCGGG
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.52
3.
44 / 500
1.7e-14
TGTTTGTTTTTTTT
small heat map img p-value: 0.05
pct_center: 0.30
pct_ratio: 0.53
4.
55 / 500
0.050
GAGATAAG
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 1.31
5.
29 / 500
2.3
CAGGGGCCGGGGCTG
small heat map img p-value: 0.49
pct_center: 0.18
pct_ratio: 0.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Farnham - ENCSR000EVF

1.
444 / 500
2.1e-535
AACATCAAAGGGA
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 1.95
2.
77 / 500
4.1e-28
ATGAGTCA
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 1.48
3.
32 / 500
1.2e-18
AAAAAAAAAAAAAAAAAGCA
small heat map img p-value: 0.88
pct_center: 0.27
pct_ratio: 0.44
4.
57 / 500
1.2e-25
GGCGGGCGCGGGCCGGGGGGG
small heat map img p-value: 0.07
pct_center: 0.33
pct_ratio: 0.53
5.
6 / 500
7.0e+4
GCACTGCATTCTGGGAGGCGTAGTTCCAG
small heat map img p-value: 0.47
pct_center: 0.11
pct_ratio: 0.53
MEME output

HeLa-S3 - Farnham - ENCSR000EVE

1.
496 / 500
2.8e-559
GGTGCCTTTGATCTT
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 1.55
2.
72 / 500
2.5e-15
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 1.84
3.
11 / 500
0.000015
AGAAAAAATAAAAAAACAAG
small heat map img p-value: 1.00
pct_center: 0.19
pct_ratio: 0.33
4.
112 / 500
2.0e+2
CCTGGGGC
small heat map img p-value: 1.00
pct_center: 0.32
pct_ratio: 0.55
5.
16 / 500
2.0e+2
GGAGGGCAGGAGGC
small heat map img p-value: 0.09
pct_center: 0.36
pct_ratio: 0.57
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Farnham - ENCSR000EVQ

1.
421 / 500
3.2e-443
AAGATCAAAGG
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 1.90
2.
160 / 500
6.4e-39
AAAGTAAACA
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 1.04
3.
26 / 500
3.0e-18
GGGCGTTGCCCCGAGAGCAGTGGGGCAGC
small heat map img p-value: 0.89
pct_center: 0.13
pct_ratio: 0.43
4.
43 / 500
1.1e-8
AGAGAAAACAAAAGAAAACAGAAAAGCA
small heat map img p-value: 0.66
pct_center: 0.33
pct_ratio: 0.48
5.
26 / 500
0.52
GGCAAAGGTCA
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.68
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF-7 - Farnham - ENCSR000EWT

1.
441 / 500
1.4e-469
GAAAGATCAAAGGGACC
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 1.97
2.
36 / 500
4.2e-20
AAGAAAACAAAAAAA
small heat map img p-value: 1.00
pct_center: 0.28
pct_ratio: 0.44
3.
46 / 500
9.8e-18
GCCGGCGGGCGGGGCGGGGGC
small heat map img p-value: 0.01
pct_center: 0.21
pct_ratio: 0.54
4.
44 / 500
1.7e-7
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 1.48
5.
88 / 500
0.00011
AGTAAACA
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 1.17
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Panc1 - Farnham - ENCSR000EXL

1.
420 / 500
1.6e-396
ACATCAAAGGGACCG
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 1.58
2.
68 / 500
4.4e-35
GCGGGCGCGGGCGGCGGGGGCGCGCGGGGG
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 0.61
3.
79 / 500
2.8e-8
AAAAGTAAACA
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.60
4.
29 / 500
21
AGTGAGTCATG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.86
5.
7 / 500
4.3e+2
GCCTGCTGGGAATTGTAGTTC
small heat map img p-value: 0.56
pct_center: 0.11
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at TCF7L2 peaks

HCT116 - Farnham - ENCSR000EUV

HCT116
Farnham
TCF7L2
ENCSR000EUV
r=1.00

small heat map img

HCT116
Farnham
H3K27ac
ENCSR000EUT
r=0.33

small heat map img

HCT116
Farnham
H3K4me1
ENCSR000EUS
r=0.25

small heat map img

HCT116
Farnham
H3K4me3
ENCSR000DTQ
r=0.24

small heat map img
10,000 randomly-selected peaks from a total of 19,463 (download )

HEK293 - Farnham - ENCSR000EUY

HEK293
Farnham
TCF7L2
ENCSR000EUY
r=1.00

small heat map img

HEK293
Farnham
H3K4me3
ENCSR000DTU
r=0.14

small heat map img
8,961 peaks (download )

HeLa-S3 - Farnham - ENCSR000EVE

HeLa-S3
Farnham
TCF7L2
ENCSR000EVE
r=1.00

small heat map img

HeLa-S3
Farnham
TCF7L2
ENCSR000EVF
r=0.81

small heat map img

HeLa-S3
Farnham
H3K4me2
ENCSR000AOE
r=0.34

small heat map img

HeLa-S3
Farnham
H3K27ac
ENCSR000AOC
r=0.32

small heat map img

HeLa-S3
Farnham
H2AFZ
ENCSR000AQN
r=0.30

small heat map img

HeLa-S3
Farnham
H3K4me1
ENCSR000APW
r=0.30

small heat map img

HeLa-S3
Farnham
H3K4me3
ENCSR000AOF
r=0.28

small heat map img

HeLa-S3
Farnham
H3K9ac
ENCSR000AOH
r=0.27

small heat map img

HeLa-S3
Farnham
H3K4me3
ENCSR000DUA
r=0.21

small heat map img

HeLa-S3
Farnham
H3K79me2
ENCSR000AOG
r=0.05

small heat map img

HeLa-S3
Farnham
H3K27me3
ENCSR000DTY
r=0.04

small heat map img

HeLa-S3
Farnham
H4K20me1
ENCSR000AOI
r=0.02

small heat map img

HeLa-S3
Farnham
H3K36me3
ENCSR000DTZ
r=0.01

small heat map img

HeLa-S3
Farnham
H3K9me3
ENCSR000AQO
r=-0.01

small heat map img

HeLa-S3
Farnham
H3K27me3
ENCSR000APB
r=-0.01

small heat map img

HeLa-S3
Farnham
H3K36me3
ENCSR000AOD
r=-0.06

small heat map img
10,000 randomly-selected peaks from a total of 19,242 (download )

HeLa-S3 - Farnham - ENCSR000EVF

HeLa-S3
Farnham
TCF7L2
ENCSR000EVF
r=1.00

small heat map img

HeLa-S3
Farnham
TCF7L2
ENCSR000EVE
r=0.90

small heat map img

HeLa-S3
Farnham
H3K4me2
ENCSR000AOE
r=0.33

small heat map img

HeLa-S3
Farnham
H2AFZ
ENCSR000AQN
r=0.30

small heat map img

HeLa-S3
Farnham
H3K27ac
ENCSR000AOC
r=0.30

small heat map img

HeLa-S3
Farnham
H3K4me3
ENCSR000AOF
r=0.29

small heat map img

HeLa-S3
Farnham
H3K9ac
ENCSR000AOH
r=0.27

small heat map img

HeLa-S3
Farnham
H3K4me1
ENCSR000APW
r=0.27

small heat map img

HeLa-S3
Farnham
H3K4me3
ENCSR000DUA
r=0.23

small heat map img

HeLa-S3
Farnham
H3K27me3
ENCSR000DTY
r=0.04

small heat map img

HeLa-S3
Farnham
H4K20me1
ENCSR000AOI
r=0.02

small heat map img

HeLa-S3
Farnham
H3K79me2
ENCSR000AOG
r=0.02

small heat map img

HeLa-S3
Farnham
H3K36me3
ENCSR000DTZ
r=-0.02

small heat map img

HeLa-S3
Farnham
H3K27me3
ENCSR000APB
r=-0.02

small heat map img

HeLa-S3
Farnham
H3K9me3
ENCSR000AQO
r=-0.02

small heat map img

HeLa-S3
Farnham
H3K36me3
ENCSR000AOD
r=-0.09

small heat map img
3,198 peaks (download )

HepG2 - Farnham - ENCSR000EVQ

HepG2
Farnham
TCF7L2
ENCSR000EVQ
r=1.00

small heat map img

HepG2
Farnham
H3K27ac
ENCSR000AMO
r=0.42

small heat map img

HepG2
Farnham
H3K4me1
ENCSR000APV
r=0.36

small heat map img

HepG2
Farnham
H3K4me2
ENCSR000AMC
r=0.36

small heat map img

HepG2
Farnham
H3K9ac
ENCSR000AMD
r=0.32

small heat map img

HepG2
Farnham
H3K4me3
ENCSR000AMP
r=0.25

small heat map img

HepG2
Farnham
H2AFZ
ENCSR000AOK
r=0.18

small heat map img

HepG2
Farnham
H3K27me3
ENCSR000AOL
r=0.13

small heat map img

HepG2
Farnham
H3K4me3
ENCSR000DUF
r=0.11

small heat map img

HepG2
Farnham
H4K20me1
ENCSR000AMQ
r=0.07

small heat map img

HepG2
Farnham
H3K79me2
ENCSR000AOM
r=0.03

small heat map img

HepG2
Farnham
H3K27me3
ENCSR000DUE
r=0.03

small heat map img

HepG2
Farnham
H3K9me3
ENCSR000ATD
r=-0.01

small heat map img

HepG2
Farnham
H3K36me3
ENCSR000DUD
r=-0.02

small heat map img

HepG2
Farnham
H3K36me3
ENCSR000AMB
r=-0.02

small heat map img
2,742 peaks (download )

MCF-7 - Farnham - ENCSR000EWT

MCF-7
Farnham
TCF7L2
ENCSR000EWT
r=1.00

small heat map img

MCF-7
Farnham
H3K27ac
ENCSR000EWR
r=0.26

small heat map img

MCF-7
Farnham
H3K4me3
ENCSR000DWJ
r=0.20

small heat map img

MCF-7
Farnham
H3K9me3
ENCSR000EWQ
r=0.01

small heat map img

MCF-7
Farnham
H3K36me3
ENCSR000EWO
r=-0.02

small heat map img

MCF-7
Farnham
H3K27me3
ENCSR000EWP
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 10,293 (download )

Panc1 - Farnham - ENCSR000EXL

Panc1
Farnham
TCF7L2
ENCSR000EXL
r=1.00

small heat map img

Panc1
Farnham
H3K27ac
ENCSR000EXK
r=0.33

small heat map img

Panc1
Farnham
H3K4me3
ENCSR000DXB
r=0.24

small heat map img

Panc1
Farnham
H3K4me1
ENCSR000EXJ
r=0.23

small heat map img

Panc1
Farnham
H3K4me3
ENCSR000EXI
r=0.22

small heat map img
10,000 randomly-selected peaks from a total of 13,366 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at TCF7L2 peaks

HCT116 - Farnham - ENCSR000EUV

HCT116
Farnham
TCF7L2
ENCSR000EUV
r=1.00

small heat map img

HCT116
Farnham
SP1
ENCSR000BSF
r=0.56

small heat map img

HCT116
Farnham
JUND
ENCSR000BSA
r=0.56

small heat map img

HCT116
Farnham
CEBPB
ENCSR000BSD
r=0.53

small heat map img

HCT116
Farnham
FOSL1
ENCSR000BTE
r=0.52

small heat map img

HCT116
Farnham
CBX3
ENCSR000BUH
r=0.51

small heat map img

HCT116
Farnham
TEAD4
ENCSR000BVJ
r=0.50

small heat map img

HCT116
Farnham
MAX
ENCSR000BSH
r=0.49

small heat map img

HCT116
Farnham
SRF
ENCSR000BSC
r=0.49

small heat map img

HCT116
Farnham
SIN3A
ENCSR000BSG
r=0.49

small heat map img

HCT116
Farnham
ATF3
ENCSR000BUG
r=0.47

small heat map img

HCT116
Farnham
USF1
ENCSR000BVK
r=0.43

small heat map img

HCT116
Farnham
RAD21
ENCSR000BSB
r=0.42

small heat map img

HCT116
Farnham
ELF1
ENCSR000BVH
r=0.40

small heat map img

HCT116
Farnham
EGR1
ENCSR000BRZ
r=0.39

small heat map img

HCT116
Farnham
REST
ENCSR000BVI
r=0.27

small heat map img

HCT116
Farnham
POLR2A
ENCSR000EUU
r=0.27

small heat map img

HCT116
Farnham
ZBTB33
ENCSR000BNY
r=0.26

small heat map img

HCT116
Farnham
CTCF
ENCSR000BSE
r=0.22

small heat map img

HCT116
Farnham
YY1
ENCSR000BNX
r=0.18

small heat map img

HCT116
Farnham
CTCF
ENCSR000DTO
r=0.14

small heat map img
10,000 randomly-selected peaks from a total of 19,463 (download )

HEK293 - Farnham - ENCSR000EUY

HEK293
Farnham
TCF7L2
ENCSR000EUY
r=1.00

small heat map img

HEK293
Farnham
TRIM28
ENCSR000EUZ
r=0.57

small heat map img

HEK293
Farnham
ZNF263
ENCSR000EVD
r=0.32

small heat map img

HEK293
Farnham
ELK4
ENCSR000EVB
r=0.24

small heat map img

HEK293
Farnham
POLR2A
ENCSR000EZA
r=0.12

small heat map img

HEK293
Farnham
CTCF
ENCSR000DTW
r=0.10

small heat map img
8,961 peaks (download )

HeLa-S3 - Farnham - ENCSR000EVE

HeLa-S3
Farnham
TCF7L2
ENCSR000EVE
r=1.00

small heat map img

HeLa-S3
Farnham
TCF7L2
ENCSR000EVF
r=0.81

small heat map img

HeLa-S3
Farnham
RCOR1
ENCSR000ECM
r=0.60

small heat map img

HeLa-S3
Farnham
MAX
ENCSR000ECN
r=0.53

small heat map img

HeLa-S3
Farnham
SMC3
ENCSR000ECS
r=0.53

small heat map img

HeLa-S3
Farnham
MAFK
ENCSR000ECK
r=0.53

small heat map img

HeLa-S3
Farnham
MAX
ENCSR000EZF
r=0.51

small heat map img

HeLa-S3
Farnham
MXI1
ENCSR000ECU
r=0.51

small heat map img

HeLa-S3
Farnham
STAT3
ENCSR000EDC
r=0.51

small heat map img

HeLa-S3
Farnham
MYC
ENCSR000EZD
r=0.51

small heat map img

HeLa-S3
Farnham
ZKSCAN1
ENCSR000ECJ
r=0.50

small heat map img

HeLa-S3
Farnham
EP300
ENCSR000ECV
r=0.50

small heat map img

HeLa-S3
Farnham
RFX5
ENCSR000ECX
r=0.50

small heat map img

HeLa-S3
Farnham
JUND
ENCSR000EDH
r=0.50

small heat map img

HeLa-S3
Farnham
FOS
ENCSR000EZE
r=0.49

small heat map img

HeLa-S3
Farnham
MYC
ENCSR000DLN
r=0.49

small heat map img

HeLa-S3
Farnham
BRCA1
ENCSR000EDB
r=0.49

small heat map img

HeLa-S3
Farnham
JUN
ENCSR000EDG
r=0.48

small heat map img

HeLa-S3
Farnham
ELK1
ENCSR000ECI
r=0.48

small heat map img

HeLa-S3
Farnham
CEBPB
ENCSR000EDA
r=0.47

small heat map img

HeLa-S3
Farnham
STAT1
ENCSR000EZK
r=0.47

small heat map img

HeLa-S3
Farnham
RAD21
ENCSR000EDE
r=0.46

small heat map img

HeLa-S3
Farnham
PRDM1
ENCSR000ECY
r=0.43

small heat map img

HeLa-S3
Farnham
SMARCC1
ENCSR000EDM
r=0.43

small heat map img

HeLa-S3
Farnham
HCFC1
ENCSR000ECH
r=0.40

small heat map img

HeLa-S3
Farnham
SMARCC2
ENCSR000EDL
r=0.39

small heat map img

HeLa-S3
Farnham
USF2
ENCSR000ECW
r=0.38

small heat map img

HeLa-S3
Farnham
ELK4
ENCSR000EVI
r=0.37

small heat map img

HeLa-S3
Farnham
ZNF143
ENCSR000ECO
r=0.36

small heat map img

HeLa-S3
Farnham
IRF3
ENCSR000EDF
r=0.35

small heat map img

HeLa-S3
Farnham
TBP
ENCSR000EDD
r=0.35

small heat map img

HeLa-S3
Farnham
SMARCB1
ENCSR000EDK
r=0.33

small heat map img

HeLa-S3
Farnham
NFYA
ENCSR000DNS
r=0.32

small heat map img

HeLa-S3
Farnham
E2F4
ENCSR000EVL
r=0.31

small heat map img

HeLa-S3
Farnham
SMARCA4
ENCSR000EZC
r=0.30

small heat map img

HeLa-S3
Farnham
E2F6
ENCSR000EVK
r=0.30

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000DLM
r=0.28

small heat map img

HeLa-S3
Farnham
NFYB
ENCSR000DNR
r=0.28

small heat map img

HeLa-S3
Farnham
KAT2A
ENCSR000ECR
r=0.28

small heat map img

HeLa-S3
Farnham
NRF1
ENCSR000EDJ
r=0.26

small heat map img

HeLa-S3
Farnham
NR2C2
ENCSR000EVN
r=0.25

small heat map img

HeLa-S3
Farnham
E2F1
ENCSR000EVJ
r=0.24

small heat map img

HeLa-S3
Farnham
SUPT20H
ENCSR000ECQ
r=0.24

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000EZL
r=0.23

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000BGO
r=0.22

small heat map img

HeLa-S3
Farnham
EZH2
ENCSR000ATC
r=0.20

small heat map img

HeLa-S3
Farnham
ZNF274
ENCSR000EVG
r=0.20

small heat map img

HeLa-S3
Farnham
GTF3C2
ENCSR000DNY
r=0.17

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000AOA
r=0.17

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000DLO
r=0.17

small heat map img

HeLa-S3
Farnham
TAF1
ENCSR000BHT
r=0.15

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000DUB
r=0.15

small heat map img

HeLa-S3
Farnham
GABPA
ENCSR000BHS
r=0.12

small heat map img

HeLa-S3
Farnham
BRF2
ENCSR000DNV
r=0.10

small heat map img

HeLa-S3
Farnham
REST
ENCSR000BMN
r=0.07

small heat map img

HeLa-S3
Farnham
POLR3A
ENCSR000DNU
r=0.06

small heat map img

HeLa-S3
Farnham
BDP1
ENCSR000DNX
r=0.05

small heat map img

HeLa-S3
Farnham
ZZZ3
ENCSR000DNT
r=0.02

small heat map img

HeLa-S3
Farnham
BRF1
ENCSR000DNW
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 19,242 (download )

HeLa-S3 - Farnham - ENCSR000EVF

HeLa-S3
Farnham
TCF7L2
ENCSR000EVF
r=1.00

small heat map img

HeLa-S3
Farnham
TCF7L2
ENCSR000EVE
r=0.90

small heat map img

HeLa-S3
Farnham
RCOR1
ENCSR000ECM
r=0.54

small heat map img

HeLa-S3
Farnham
MAFK
ENCSR000ECK
r=0.48

small heat map img

HeLa-S3
Farnham
JUND
ENCSR000EDH
r=0.48

small heat map img

HeLa-S3
Farnham
SMC3
ENCSR000ECS
r=0.48

small heat map img

HeLa-S3
Farnham
JUN
ENCSR000EDG
r=0.47

small heat map img

HeLa-S3
Farnham
MAX
ENCSR000ECN
r=0.47

small heat map img

HeLa-S3
Farnham
STAT3
ENCSR000EDC
r=0.47

small heat map img

HeLa-S3
Farnham
EP300
ENCSR000ECV
r=0.45

small heat map img

HeLa-S3
Farnham
FOS
ENCSR000EZE
r=0.45

small heat map img

HeLa-S3
Farnham
MXI1
ENCSR000ECU
r=0.44

small heat map img

HeLa-S3
Farnham
MYC
ENCSR000DLN
r=0.44

small heat map img

HeLa-S3
Farnham
ELK1
ENCSR000ECI
r=0.43

small heat map img

HeLa-S3
Farnham
BRCA1
ENCSR000EDB
r=0.43

small heat map img

HeLa-S3
Farnham
ZKSCAN1
ENCSR000ECJ
r=0.43

small heat map img

HeLa-S3
Farnham
MYC
ENCSR000EZD
r=0.42

small heat map img

HeLa-S3
Farnham
RAD21
ENCSR000EDE
r=0.42

small heat map img

HeLa-S3
Farnham
MAX
ENCSR000EZF
r=0.42

small heat map img

HeLa-S3
Farnham
CEBPB
ENCSR000EDA
r=0.41

small heat map img

HeLa-S3
Farnham
RFX5
ENCSR000ECX
r=0.40

small heat map img

HeLa-S3
Farnham
PRDM1
ENCSR000ECY
r=0.40

small heat map img

HeLa-S3
Farnham
STAT1
ENCSR000EZK
r=0.37

small heat map img

HeLa-S3
Farnham
HCFC1
ENCSR000ECH
r=0.36

small heat map img

HeLa-S3
Farnham
SMARCC1
ENCSR000EDM
r=0.35

small heat map img

HeLa-S3
Farnham
USF2
ENCSR000ECW
r=0.34

small heat map img

HeLa-S3
Farnham
IRF3
ENCSR000EDF
r=0.34

small heat map img

HeLa-S3
Farnham
ELK4
ENCSR000EVI
r=0.33

small heat map img

HeLa-S3
Farnham
ZNF143
ENCSR000ECO
r=0.32

small heat map img

HeLa-S3
Farnham
TBP
ENCSR000EDD
r=0.32

small heat map img

HeLa-S3
Farnham
SMARCC2
ENCSR000EDL
r=0.31

small heat map img

HeLa-S3
Farnham
NFYA
ENCSR000DNS
r=0.27

small heat map img

HeLa-S3
Farnham
NRF1
ENCSR000EDJ
r=0.26

small heat map img

HeLa-S3
Farnham
NFYB
ENCSR000DNR
r=0.26

small heat map img

HeLa-S3
Farnham
E2F4
ENCSR000EVL
r=0.24

small heat map img

HeLa-S3
Farnham
KAT2A
ENCSR000ECR
r=0.24

small heat map img

HeLa-S3
Farnham
SMARCA4
ENCSR000EZC
r=0.24

small heat map img

HeLa-S3
Farnham
SUPT20H
ENCSR000ECQ
r=0.23

small heat map img

HeLa-S3
Farnham
SMARCB1
ENCSR000EDK
r=0.22

small heat map img

HeLa-S3
Farnham
E2F6
ENCSR000EVK
r=0.21

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000DLM
r=0.21

small heat map img

HeLa-S3
Farnham
E2F1
ENCSR000EVJ
r=0.20

small heat map img

HeLa-S3
Farnham
NR2C2
ENCSR000EVN
r=0.19

small heat map img

HeLa-S3
Farnham
EZH2
ENCSR000ATC
r=0.17

small heat map img

HeLa-S3
Farnham
GTF3C2
ENCSR000DNY
r=0.16

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000AOA
r=0.15

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000DLO
r=0.15

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000EZL
r=0.15

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000DUB
r=0.13

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000BGO
r=0.13

small heat map img

HeLa-S3
Farnham
GABPA
ENCSR000BHS
r=0.13

small heat map img

HeLa-S3
Farnham
TAF1
ENCSR000BHT
r=0.11

small heat map img

HeLa-S3
Farnham
ZNF274
ENCSR000EVG
r=0.11

small heat map img

HeLa-S3
Farnham
BRF2
ENCSR000DNV
r=0.08

small heat map img

HeLa-S3
Farnham
BDP1
ENCSR000DNX
r=0.08

small heat map img

HeLa-S3
Farnham
REST
ENCSR000BMN
r=0.08

small heat map img

HeLa-S3
Farnham
ZZZ3
ENCSR000DNT
r=0.05

small heat map img

HeLa-S3
Farnham
POLR3A
ENCSR000DNU
r=0.05

small heat map img

HeLa-S3
Farnham
BRF1
ENCSR000DNW
r=0.02

small heat map img
3,198 peaks (download )

HepG2 - Farnham - ENCSR000EVQ

HepG2
Farnham
TCF7L2
ENCSR000EVQ
r=1.00

small heat map img

HepG2
Farnham
EP300
ENCSR000EDV
r=0.72

small heat map img

HepG2
Farnham
ARID3A
ENCSR000EDP
r=0.70

small heat map img

HepG2
Farnham
NR2F2
ENCSR000BVM
r=0.69

small heat map img

HepG2
Farnham
EP300
ENCSR000BLW
r=0.68

small heat map img

HepG2
Farnham
TEAD4
ENCSR000BRP
r=0.68

small heat map img

HepG2
Farnham
SP1
ENCSR000BJX
r=0.67

small heat map img

HepG2
Farnham
FOXA1
ENCSR000BMO
r=0.66

small heat map img

HepG2
Farnham
FOXA1
ENCSR000BLE
r=0.64

small heat map img

HepG2
Farnham
NFIC
ENCSR000BQX
r=0.64

small heat map img

HepG2
Farnham
HDAC2
ENCSR000BMC
r=0.63

small heat map img

HepG2
Farnham
RCOR1
ENCSR000EDQ
r=0.60

small heat map img

HepG2
Farnham
SMC3
ENCSR000EDW
r=0.59

small heat map img

HepG2
Farnham
HNF4G
ENCSR000BNJ
r=0.58

small heat map img

HepG2
Farnham
CREB1
ENCSR000BVL
r=0.58

small heat map img

HepG2
Farnham
HNF4A
ENCSR000EEU
r=0.57

small heat map img

HepG2
Farnham
TCF12
ENCSR000BJG
r=0.55

small heat map img

HepG2
Farnham
BHLHE40
ENCSR000EDT
r=0.55

small heat map img

HepG2
Farnham
HNF4A
ENCSR000BLF
r=0.55

small heat map img

HepG2
Farnham
MYBL2
ENCSR000BRO
r=0.54

small heat map img

HepG2
Farnham
MXI1
ENCSR000EDU
r=0.54

small heat map img

HepG2
Farnham
RAD21
ENCSR000EEG
r=0.53

small heat map img

HepG2
Farnham
JUN
ENCSR000EEK
r=0.53

small heat map img

HepG2
Farnham
ZEB1
ENCSR000BVN
r=0.52

small heat map img

HepG2
Farnham
JUND
ENCSR000EEI
r=0.52

small heat map img

HepG2
Farnham
MBD4
ENCSR000BQW
r=0.52

small heat map img

HepG2
Farnham
MAFF
ENCSR000EEC
r=0.51

small heat map img

HepG2
Farnham
TBP
ENCSR000EEL
r=0.51

small heat map img

HepG2
Farnham
CEBPB
ENCSR000EEE
r=0.49

small heat map img

HepG2
Farnham
RFX5
ENCSR000EEA
r=0.49

small heat map img

HepG2
Farnham
MAX
ENCSR000BTM
r=0.49

small heat map img

HepG2
Farnham
JUND
ENCSR000BGK
r=0.48

small heat map img

HepG2
Farnham
MYC
ENCSR000DLR
r=0.48

small heat map img

HepG2
Farnham
MAFK
ENCSR000EEB
r=0.47

small heat map img

HepG2
Farnham
MAFK
ENCSR000EDZ
r=0.47

small heat map img

HepG2
Farnham
MAX
ENCSR000EDS
r=0.47

small heat map img

HepG2
Farnham
FOSL2
ENCSR000BHP
r=0.46

small heat map img

HepG2
Farnham
CEBPB
ENCSR000EEX
r=0.46

small heat map img

HepG2
Farnham
FOXA2
ENCSR000BNI
r=0.43

small heat map img

HepG2
Farnham
BRCA1
ENCSR000EDY
r=0.42

small heat map img

HepG2
Farnham
RXRA
ENCSR000BHU
r=0.41

small heat map img

HepG2
Farnham
HSF1
ENCSR000EET
r=0.40

small heat map img

HepG2
Farnham
CEBPB
ENCSR000BQI
r=0.40

small heat map img

HepG2
Farnham
REST
ENCSR000BOT
r=0.39

small heat map img

HepG2
Farnham
SREBF1
ENCSR000EZP
r=0.34

small heat map img

HepG2
Farnham
RAD21
ENCSR000BLS
r=0.33

small heat map img

HepG2
Farnham
ESRRA
ENCSR000EEW
r=0.30

small heat map img

HepG2
Farnham
BHLHE40
ENCSR000BID
r=0.29

small heat map img

HepG2
Farnham
IRF3
ENCSR000EEJ
r=0.28

small heat map img

HepG2
Farnham
ELF1
ENCSR000BMZ
r=0.28

small heat map img

HepG2
Farnham
USF2
ENCSR000EEF
r=0.28

small heat map img

HepG2
Farnham
CEBPD
ENCSR000BQJ
r=0.28

small heat map img

HepG2
Farnham
SIN3A
ENCSR000BGL
r=0.27

small heat map img

HepG2
Farnham
POLR2A
ENCSR000EEM
r=0.27

small heat map img

HepG2
Farnham
SREBF2
ENCSR000EZO
r=0.26

small heat map img

HepG2
Farnham
SRF
ENCSR000BLV
r=0.25

small heat map img

HepG2
Farnham
ZBTB7A
ENCSR000BQA
r=0.24

small heat map img

HepG2
Farnham
NRF1
ENCSR000EEH
r=0.24

small heat map img

HepG2
Farnham
NR2C2
ENCSR000EVS
r=0.24

small heat map img

HepG2
Farnham
POLR2A
ENCSR000EZQ
r=0.23

small heat map img

HepG2
Farnham
NR3C1
ENCSR000EEV
r=0.23

small heat map img

HepG2
Farnham
EZH2
ENCSR000ARI
r=0.22

small heat map img

HepG2
Farnham
SREBF1
ENCSR000EEO
r=0.21

small heat map img

HepG2
Farnham
USF1
ENCSR000BGM
r=0.21

small heat map img

HepG2
Farnham
YY1
ENCSR000BNT
r=0.20

small heat map img

HepG2
Farnham
POLR2A
ENCSR000EEP
r=0.19

small heat map img

HepG2
Farnham
ZBTB33
ENCSR000BHR
r=0.16

small heat map img

HepG2
Farnham
ZBTB33
ENCSR000BNA
r=0.14

small heat map img

HepG2
Farnham
POLR2A
ENCSR000DLQ
r=0.13

small heat map img

HepG2
Farnham
CTCF
ENCSR000AMA
r=0.13

small heat map img

HepG2
Farnham
CTCF
ENCSR000DLS
r=0.12

small heat map img

HepG2
Farnham
ATF3
ENCSR000BKE
r=0.12

small heat map img

HepG2
Farnham
CTCF
ENCSR000BIE
r=0.12

small heat map img

HepG2
Farnham
SP2
ENCSR000BOU
r=0.11

small heat map img

HepG2
Farnham
POLR2A
ENCSR000BJM
r=0.10

small heat map img

HepG2
Farnham
CTCF
ENCSR000DUG
r=0.08

small heat map img

HepG2
Farnham
TAF1
ENCSR000BJN
r=0.06

small heat map img

HepG2
Farnham
GABPA
ENCSR000BJK
r=0.05

small heat map img

HepG2
Farnham
ZNF274
ENCSR000EVR
r=0.05

small heat map img

HepG2
Farnham
REST
ENCSR000BJL
r=0.04

small heat map img
2,742 peaks (download )

MCF-7 - Farnham - ENCSR000EWT

MCF-7
Farnham
TCF7L2
ENCSR000EWT
r=1.00

small heat map img

MCF-7
Farnham
ZNF217
ENCSR000EWU
r=0.60

small heat map img

MCF-7
Farnham
SIN3A
ENCSR000BUM
r=0.58

small heat map img

MCF-7
Farnham
GATA3
ENCSR000BST
r=0.57

small heat map img

MCF-7
Farnham
GATA3
ENCSR000EWS
r=0.55

small heat map img

MCF-7
Farnham
NR2F2
ENCSR000BUY
r=0.54

small heat map img

MCF-7
Farnham
HDAC2
ENCSR000BTP
r=0.52

small heat map img

MCF-7
Farnham
GATA3
ENCSR000EWV
r=0.49

small heat map img

MCF-7
Farnham
EP300
ENCSR000BTR
r=0.46

small heat map img

MCF-7
Farnham
FOSL2
ENCSR000BUI
r=0.46

small heat map img

MCF-7
Farnham
TEAD4
ENCSR000BUO
r=0.46

small heat map img

MCF-7
Farnham
TCF12
ENCSR000BUN
r=0.46

small heat map img

MCF-7
Farnham
FOXM1
ENCSR000BUJ
r=0.45

small heat map img

MCF-7
Farnham
CEBPB
ENCSR000BSR
r=0.42

small heat map img

MCF-7
Farnham
JUND
ENCSR000BSU
r=0.41

small heat map img

MCF-7
Farnham
MAX
ENCSR000BUL
r=0.41

small heat map img

MCF-7
Farnham
RAD21
ENCSR000BTQ
r=0.40

small heat map img

MCF-7
Farnham
SRF
ENCSR000BVA
r=0.39

small heat map img

MCF-7
Farnham
GABPA
ENCSR000BUK
r=0.34

small heat map img

MCF-7
Farnham
ELF1
ENCSR000BSS
r=0.33

small heat map img

MCF-7
Farnham
EGR1
ENCSR000BUX
r=0.32

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMQ
r=0.32

small heat map img

MCF-7
Farnham
PML
ENCSR000BUZ
r=0.32

small heat map img

MCF-7
Farnham
REST
ENCSR000BSP
r=0.30

small heat map img

MCF-7
Farnham
TAF1
ENCSR000AHF
r=0.29

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMP
r=0.28

small heat map img

MCF-7
Farnham
CTCF
ENCSR000AHD
r=0.21

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMT
r=0.18

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DWH
r=0.18

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMR
r=0.17

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMM
r=0.16

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMS
r=0.12

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DML
r=0.12

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMO
r=0.12

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMV
r=0.11

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMK
r=0.11

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMN
r=0.11

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMJ
r=0.08

small heat map img
10,000 randomly-selected peaks from a total of 10,293 (download )

Panc1 - Farnham - ENCSR000EXL

Panc1
Farnham
TCF7L2
ENCSR000EXL
r=1.00

small heat map img

Panc1
Farnham
REST
ENCSR000BUP
r=0.25

small heat map img

Panc1
Farnham
SIN3A
ENCSR000BOW
r=0.19

small heat map img

Panc1
Farnham
REST
ENCSR000BJO
r=0.14

small heat map img

Panc1
Farnham
REST
ENCSR000BPK
r=0.04

small heat map img
10,000 randomly-selected peaks from a total of 13,366 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help