STAT5A - Factorbook

The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated by, and mediates the responses of many cell ligands, such as IL2, IL3, IL7 GM-CSF, erythropoietin, thrombopoietin, and different growth hormones. Activation of this protein in myeloma and lymphoma associated with a TEL/JAK2 gene fusion is independent of cell stimulus and has been shown to be essential for tumorigenesis. The mouse counterpart of this gene is found to induce the expression of BCL2L1/BCL-X(L), which suggests the antiapoptotic function of this gene in cells. Alternatively spliced transcript variants have been found for this gene. RefSeq, Dec 2013

Signal transducer and activator of transcription 5A is a protein that in humans is encoded by the STAT5A gene. STAT5A orthologs have been identified in several placentals for which complete genome data are available.wikipedia

STAT5A

ENCODE	experiments
Ensemble	search
Entrez	6776
GO	search
Gene Card	search
HGNC	search
RefSeq	search
UCSC	browse
UniProt	search
Wikipedia	STAT5A

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

GM12878 - Myers - ENCSR000BQZ

K562 - Myers - ENCSR000BRR

Legend

Proximal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Distal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

GM12878 - Myers
K562 - Myers

GM12878 - Myers - ENCSR000BQZ

1. 58 / 500 2.5e-171 GTGTGTGTGTGTGTATGTGTGTGTGTGTG		p-value: 0.00 pct_center: 0.25 pct_ratio: 0.61
2. 219 / 500 5.9e-95 TGAGTCATAACGAAA		p-value: 0.00 pct_center: 0.19 pct_ratio: 1.55
3. 110 / 500 6.3e-57 AGGAAGTGAAA		p-value: 0.00 pct_center: 0.27 pct_ratio: 0.70
4. 165 / 500 4.4e-32 TGTGGT		p-value: 0.00 pct_center: pct_ratio:
5. 29 / 500 1.2e-10 GTGTGTGTGTG		p-value: 0.00 pct_center: 0.21 pct_ratio: 0.66

MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Myers - ENCSR000BRR

1. 71 / 500 9.5e-346 GAAAGGGGTGGGCAATTCCCGG		p-value: 0.00 pct_center: 0.17 pct_ratio: 0.71
2. 43 / 500 3.0e-309 ATGGTCTAAAAAGGGGAGGAACCCTCAGTT		p-value: 0.00 pct_center: 0.13 pct_ratio: 0.67
3. 40 / 500 1.3e-303 AAACAAGGGGTGGATTATTCATGAGTTTTC		p-value: 0.00 pct_center: 0.09 pct_ratio: 0.61
4. 382 / 500 1.1e-195 GACAGATAAGG		p-value: 0.00 pct_center: 0.35 pct_ratio: 2.94
5. 141 / 500 8.2e-119 TTCTTGGAAAT		p-value: 0.00 pct_center: 0.23 pct_ratio: 1.48

MEME output

Notes

Binding of other histone marks at STAT5A peaks

GM12878 - Myers
K562 - Myers

GM12878 - Myers - ENCSR000BQZ

GM12878 Myers STAT5A ENCSR000BQZ r=1.00
GM12878 Myers H3K27ac ENCSR000AKC r=0.27
GM12878 Myers H3K4me2 ENCSR000AKG r=0.26
GM12878 Myers H3K9ac ENCSR000AKH r=0.24
GM12878 Myers H3K4me3 ENCSR000AKA r=0.23
GM12878 Myers H2AFZ ENCSR000AOV r=0.21
GM12878 Myers H3K4me1 ENCSR000AKF r=0.20
GM12878 Myers H3K4me3 ENCSR000DRY r=0.15
GM12878 Myers H3K79me2 ENCSR000AOW r=0.11
GM12878 Myers H3K9me3 ENCSR000AOX r=0.02
GM12878 Myers H4K20me1 ENCSR000AKI r=0.01
GM12878 Myers H3K36me3 ENCSR000DRW r=0.01
GM12878 Myers H3K36me3 ENCSR000AKE r=0.00
GM12878 Myers H3K27me3 ENCSR000DRX r=-0.05
GM12878 Myers H3K27me3 ENCSR000AKD r=-0.06

7,423 peaks (download )

K562 - Myers - ENCSR000BRR

K562 Myers STAT5A ENCSR000BRR r=1.00
K562 Myers H3K27ac ENCSR000AKP r=0.35
K562 Myers H3K4me1 ENCSR000AKS r=0.32
K562 Myers H3K4me2 ENCSR000AKT r=0.32
K562 Myers H3K4me3 ENCSR000AKU r=0.29
K562 Myers H3K9ac ENCSR000AKV r=0.28
K562 Myers H2AFZ ENCSR000APC r=0.25
K562 Myers H3K4me1 ENCSR000EWC r=0.21
K562 Myers H3K9ac ENCSR000EVZ r=0.18
K562 Myers H4K20me1 ENCSR000AKX r=0.16
K562 Myers H3K9me1 ENCSR000AKW r=0.15
K562 Myers H3K4me3 ENCSR000DWD r=0.14
K562 Myers H3K4me3 ENCSR000EWA r=0.11
K562 Myers H3K9me3 ENCSR000APE r=0.07
K562 Myers H3K79me2 ENCSR000APD r=0.07
K562 Myers H3K36me3 ENCSR000AKR r=0.05
K562 Myers H3K27me3 ENCSR000AKQ r=0.03
K562 Myers H3K27me3 ENCSR000DWC r=0.00
K562 Myers H3K36me3 ENCSR000DWB r=-0.02
K562 Myers H3K27me3 ENCSR000EWB r=-0.04

9,811 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

Binding of other TFs at STAT5A peaks

GM12878 - Myers
K562 - Myers

GM12878 - Myers - ENCSR000BQZ

GM12878 Myers STAT5A ENCSR000BQZ r=1.00
GM12878 Myers FOXM1 ENCSR000BRU r=0.55
GM12878 Myers TBL1XR1 ENCSR000DYZ r=0.55
GM12878 Myers RUNX3 ENCSR000BRI r=0.54
GM12878 Myers ATF2 ENCSR000BQK r=0.54
GM12878 Myers RELA ENCSR000EAG r=0.53
GM12878 Myers NFIC ENCSR000BRN r=0.53
GM12878 Myers EP300 ENCSR000DZG r=0.51
GM12878 Myers RCOR1 ENCSR000DZC r=0.51
GM12878 Myers EP300 ENCSR000DZD r=0.50
GM12878 Myers NFATC1 ENCSR000BQL r=0.50
GM12878 Myers STAT3 ENCSR000DZV r=0.49
GM12878 Myers CEBPB ENCSR000BRX r=0.49
GM12878 Myers JUND ENCSR000DYS r=0.48
GM12878 Myers CUX1 ENCSR000DYR r=0.47
GM12878 Myers MTA3 ENCSR000BRH r=0.47
GM12878 Myers BCL3 ENCSR000BNQ r=0.47
GM12878 Myers PML ENCSR000BQM r=0.46
GM12878 Myers BHLHE40 ENCSR000DZJ r=0.45
GM12878 Myers SMC3 ENCSR000DZP r=0.43
GM12878 Myers SP1 ENCSR000BHK r=0.42
GM12878 Myers ESRRA ENCSR000DYQ r=0.42
GM12878 Myers MEF2A ENCSR000BKB r=0.42
GM12878 Myers MXI1 ENCSR000DZI r=0.42
GM12878 Myers SREBF1 ENCSR000DYU r=0.42
GM12878 Myers BCL11A ENCSR000BHA r=0.41
GM12878 Myers STAT1 ENCSR000DZM r=0.41
GM12878 Myers IKZF1 ENCSR000EUJ r=0.41
GM12878 Myers ELK1 ENCSR000DZB r=0.40
GM12878 Myers POU2F2 ENCSR000BGP r=0.40
GM12878 Myers MAFK ENCSR000DYV r=0.40
GM12878 Myers JUND ENCSR000EYV r=0.40
GM12878 Myers RAD21 ENCSR000EAC r=0.40
GM12878 Myers BATF ENCSR000BGT r=0.39
GM12878 Myers MAX ENCSR000DZF r=0.39
GM12878 Myers PAX5 ENCSR000BHD r=0.39
GM12878 Myers CHD1 ENCSR000DZE r=0.38
GM12878 Myers WRNIP1 ENCSR000EAA r=0.38
GM12878 Myers EP300 ENCSR000BHB r=0.38
GM12878 Myers IRF4 ENCSR000BGY r=0.37
GM12878 Myers TCF12 ENCSR000BGZ r=0.37
GM12878 Myers PAX5 ENCSR000BHJ r=0.36
GM12878 Myers CREB1 ENCSR000BUF r=0.35
GM12878 Myers BRCA1 ENCSR000DZS r=0.35
GM12878 Myers POLR2A ENCSR000EAD r=0.34
GM12878 Myers IRF3 ENCSR000DZX r=0.34
GM12878 Myers EBF1 ENCSR000DZQ r=0.33
GM12878 Myers TCF3 ENCSR000BQT r=0.33
GM12878 Myers SREBF2 ENCSR000DYT r=0.33
GM12878 Myers ELF1 ENCSR000BMB r=0.32
GM12878 Myers ZNF384 ENCSR000DYP r=0.32
GM12878 Myers POLR2A ENCSR000EYW r=0.32
GM12878 Myers ETS1 ENCSR000BKA r=0.32
GM12878 Myers EZH2 ENCSR000ARD r=0.32
GM12878 Myers SIN3A ENCSR000DYX r=0.31
GM12878 Myers EBF1 ENCSR000BGU r=0.30
GM12878 Myers POLR2A ENCSR000DKT r=0.30
GM12878 Myers E2F4 ENCSR000DYY r=0.30
GM12878 Myers TBP ENCSR000DZZ r=0.30
GM12878 Myers SRF ENCSR000BMI r=0.28
GM12878 Myers USF2 ENCSR000DZU r=0.28
GM12878 Myers RFX5 ENCSR000DZW r=0.28
GM12878 Myers NFE2 ENCSR000DZY r=0.27
GM12878 Myers KAT2A ENCSR000DNO r=0.27
GM12878 Myers FOS ENCSR000EYZ r=0.27
GM12878 Myers YY1 ENCSR000BNP r=0.27
GM12878 Myers POLR2A ENCSR000BGD r=0.25
GM12878 Myers YY1 ENCSR000EUM r=0.25
GM12878 Myers EGR1 ENCSR000BMQ r=0.24
GM12878 Myers SPI1 ENCSR000BGQ r=0.23
GM12878 Myers MYC ENCSR000DKU r=0.23
GM12878 Myers NRF1 ENCSR000DZO r=0.23
GM12878 Myers RXRA ENCSR000BJD r=0.22
GM12878 Myers SUPT20H ENCSR000DNP r=0.22
GM12878 Myers PBX3 ENCSR000BGR r=0.20
GM12878 Myers SIX5 ENCSR000BJE r=0.20
GM12878 Myers NFYA ENCSR000DNN r=0.20
GM12878 Myers TAF1 ENCSR000BGS r=0.19
GM12878 Myers MEF2C ENCSR000BNG r=0.19
GM12878 Myers ZNF143 ENCSR000DZL r=0.19
GM12878 Myers RAD21 ENCSR000BMY r=0.17
GM12878 Myers NR2C2 ENCSR000EUL r=0.15
GM12878 Myers ZBTB33 ENCSR000BHC r=0.15
GM12878 Myers CTCF ENCSR000DZN r=0.14
GM12878 Myers EGR1 ENCSR000BRG r=0.14
GM12878 Myers POLR3G ENCSR000EYU r=0.13
GM12878 Myers CTCF ENCSR000DKV r=0.13
GM12878 Myers CTCF ENCSR000AKB r=0.13
GM12878 Myers NFYB ENCSR000DNM r=0.12
GM12878 Myers GABPA ENCSR000BGC r=0.12
GM12878 Myers ZZZ3 ENCSR000DNQ r=0.12
GM12878 Myers ZEB1 ENCSR000BND r=0.10
GM12878 Myers CTCF ENCSR000DRZ r=0.09
GM12878 Myers SRF ENCSR000BGE r=0.09
GM12878 Myers ATF3 ENCSR000BJY r=0.08
GM12878 Myers USF1 ENCSR000BGI r=0.08
GM12878 Myers REST ENCSR000BQS r=0.07
GM12878 Myers REST ENCSR000BGF r=0.05
GM12878 Myers ZNF274 ENCSR000EUK r=0.02

7,423 peaks (download )

K562 - Myers - ENCSR000BRR

K562 Myers STAT5A ENCSR000BRR r=1.00
K562 Myers TEAD4 ENCSR000BRK r=0.77
K562 Myers EP300 ENCSR000EGE r=0.77
K562 Myers GATA2 ENCSR000BKM r=0.74
K562 Myers ZMIZ1 ENCSR000EFQ r=0.74
K562 Myers CEBPD ENCSR000BVY r=0.74
K562 Myers TAL1 ENCSR000EHB r=0.74
K562 Myers TBL1XR1 ENCSR000EGB r=0.73
K562 Myers GATA1 ENCSR000EFT r=0.73
K562 Myers GATA2 ENCSR000EWG r=0.72
K562 Myers TRIM28 ENCSR000BRW r=0.71
K562 Myers NR2F2 ENCSR000BRS r=0.71
K562 Myers RCOR1 ENCSR000EGG r=0.70
K562 Myers STAT2 ENCSR000FAT r=0.69
K562 Myers ATF1 ENCSR000DNZ r=0.66
K562 Myers EP300 ENCSR000EGY r=0.66
K562 Myers RCOR1 ENCSR000EGC r=0.66
K562 Myers CCNT2 ENCSR000DOA r=0.65
K562 Myers GATA1 ENCSR000EWM r=0.65
K562 Myers JUN ENCSR000EZT r=0.65
K562 Myers PML ENCSR000BQY r=0.63
K562 Myers STAT1 ENCSR000FAV r=0.63
K562 Myers MYC ENCSR000EZU r=0.63
K562 Myers MYC ENCSR000EZV r=0.62
K562 Myers STAT1 ENCSR000FAU r=0.62
K562 Myers STAT2 ENCSR000FBC r=0.62
K562 Myers ARID3A ENCSR000EFY r=0.62
K562 Myers TBL1XR1 ENCSR000EGA r=0.62
K562 Myers JUND ENCSR000EGN r=0.62
K562 Myers MYC ENCSR000EGS r=0.61
K562 Myers JUN ENCSR000EZW r=0.61
K562 Myers MYC ENCSR000FAZ r=0.61
K562 Myers JUN ENCSR000EGH r=0.61
K562 Myers JUN ENCSR000EZX r=0.61
K562 Myers IRF1 ENCSR000EGL r=0.61
K562 Myers IRF1 ENCSR000EGK r=0.60
K562 Myers IRF1 ENCSR000EGT r=0.60
K562 Myers STAT1 ENCSR000EHK r=0.60
K562 Myers STAT1 ENCSR000EHJ r=0.59
K562 Myers JUN ENCSR000EFS r=0.58
K562 Myers CEBPB ENCSR000BRQ r=0.58
K562 Myers JUN ENCSR000FAH r=0.57
K562 Myers EP300 ENCSR000AQB r=0.57
K562 Myers KDM1A ENCSR000ATX r=0.56
K562 Myers SIRT6 ENCSR000DOH r=0.56
K562 Myers MXI1 ENCSR000EGZ r=0.56
K562 Myers MYC ENCSR000FAG r=0.55
K562 Myers CUX1 ENCSR000EFO r=0.55
K562 Myers HMGN3 ENCSR000DOB r=0.54
K562 Myers MYC ENCSR000DLZ r=0.54
K562 Myers CBX3 ENCSR000BRT r=0.54
K562 Myers ZNF274 ENCSR000EVX r=0.54
K562 Myers BHLHE40 ENCSR000EGV r=0.54
K562 Myers SMARCA4 ENCSR000EHO r=0.53
K562 Myers REST ENCSR000BMW r=0.53
K562 Myers IRF1 ENCSR000EGU r=0.53
K562 Myers MYC ENCSR000EGJ r=0.52
K562 Myers POLR2A ENCSR000EHL r=0.52
K562 Myers GABPA ENCSR000BLO r=0.51
K562 Myers MAX ENCSR000EFV r=0.50
K562 Myers EZH2 ENCSR000AQE r=0.49
K562 Myers MAX ENCSR000FAE r=0.47
K562 Myers FOS ENCSR000FAI r=0.47
K562 Myers MAFK ENCSR000EGX r=0.46
K562 Myers CREB1 ENCSR000BSO r=0.45
K562 Myers MAFF ENCSR000EGI r=0.45
K562 Myers SMARCB1 ENCSR000EHN r=0.44
K562 Myers NCOR1 ENCSR000ATY r=0.43
K562 Myers HDAC2 ENCSR000BMG r=0.43
K562 Myers SMC3 ENCSR000EGW r=0.42
K562 Myers NFYA ENCSR000EGR r=0.42
K562 Myers ZNF384 ENCSR000EFP r=0.41
K562 Myers MAX ENCSR000BLP r=0.41
K562 Myers ELK1 ENCSR000EFU r=0.40
K562 Myers SETDB1 ENCSR000AUT r=0.39
K562 Myers CHD7 ENCSR000AVD r=0.39
K562 Myers EGR1 ENCSR000BNE r=0.38
K562 Myers CEBPB ENCSR000EHE r=0.38
K562 Myers RAD21 ENCSR000FAD r=0.38
K562 Myers BACH1 ENCSR000EGD r=0.37
K562 Myers E2F4 ENCSR000EWL r=0.37
K562 Myers RFX5 ENCSR000EGO r=0.37
K562 Myers MEF2A ENCSR000BNV r=0.37
K562 Myers NFE2 ENCSR000FAF r=0.36
K562 Myers POLR2A ENCSR000DLY r=0.36
K562 Myers HDAC1 ENCSR000AQF r=0.36
K562 Myers KAT2B ENCSR000ATZ r=0.33
K562 Myers HDAC2 ENCSR000AQG r=0.33
K562 Myers FOSL1 ENCSR000BMV r=0.33
K562 Myers ZNF143 ENCSR000EGP r=0.33
K562 Myers POLR2A ENCSR000FAY r=0.33
K562 Myers POLR2A ENCSR000FAX r=0.33
K562 Myers USF1 ENCSR000BKT r=0.32
K562 Myers TRIM28 ENCSR000EVY r=0.32
K562 Myers SRF ENCSR000BLK r=0.32
K562 Myers POLR2A ENCSR000BMR r=0.32
K562 Myers HCFC1 ENCSR000EFN r=0.32
K562 Myers POLR2A ENCSR000FAJ r=0.32
K562 Myers GTF2B ENCSR000DOE r=0.31
K562 Myers E2F6 ENCSR000EWJ r=0.31
K562 Myers ETS1 ENCSR000BKQ r=0.30
K562 Myers RBBP5 ENCSR000AQI r=0.30
K562 Myers POLR2A ENCSR000EHP r=0.29
K562 Myers CREBBP ENCSR000ATT r=0.29
K562 Myers BRF2 ENCSR000DOC r=0.29
K562 Myers SP1 ENCSR000BKO r=0.29
K562 Myers SETDB1 ENCSR000EWI r=0.28
K562 Myers POLR2A ENCSR000FAW r=0.28
K562 Myers TBP ENCSR000EHA r=0.27
K562 Myers ATF3 ENCSR000DOG r=0.27
K562 Myers TAF1 ENCSR000BKS r=0.27
K562 Myers BDP1 ENCSR000DOK r=0.26
K562 Myers SPI1 ENCSR000BGW r=0.26
K562 Myers HDAC6 ENCSR000ATJ r=0.25
K562 Myers KDM5B ENCSR000AQA r=0.25
K562 Myers CTCF ENCSR000EGM r=0.25
K562 Myers NRF1 ENCSR000EHH r=0.25
K562 Myers ZBTB33 ENCSR000BKF r=0.24
K562 Myers USF2 ENCSR000EHG r=0.24
K562 Myers GTF3C2 ENCSR000DOD r=0.24
K562 Myers YY1 ENCSR000BKU r=0.24
K562 Myers ATF3 ENCSR000BNU r=0.23
K562 Myers RNF2 ENCSR000AUA r=0.23
K562 Myers SAP30 ENCSR000AQJ r=0.23
K562 Myers XRCC4 ENCSR000FAC r=0.23
K562 Myers CHD4 ENCSR000ATL r=0.22
K562 Myers CBX3 ENCSR000ATV r=0.21
K562 Myers YY1 ENCSR000EWF r=0.21
K562 Myers UBTF ENCSR000EFZ r=0.21
K562 Myers SIRT6 ENCSR000AUB r=0.21
K562 Myers WHSC1 ENCSR000AVE r=0.20
K562 Myers ZBTB7A ENCSR000BME r=0.19
K562 Myers ELF1 ENCSR000BMD r=0.19
K562 Myers SETDB1 ENCSR000EWD r=0.19
K562 Myers CTCF ENCSR000DMA r=0.17
K562 Myers TAF7 ENCSR000BNM r=0.17
K562 Myers RAD21 ENCSR000BKV r=0.17
K562 Myers SIN3A ENCSR000BLR r=0.17
K562 Myers CTCF ENCSR000AKO r=0.17
K562 Myers POLR3G ENCSR000EHQ r=0.17
K562 Myers E2F6 ENCSR000BLI r=0.17
K562 Myers UBTF ENCSR000EFW r=0.17
K562 Myers NFYB ENCSR000EGQ r=0.16
K562 Myers SUZ12 ENCSR000AUC r=0.16
K562 Myers BRF1 ENCSR000DOJ r=0.16
K562 Myers REST ENCSR000ATM r=0.15
K562 Myers YY1 ENCSR000BMH r=0.13
K562 Myers CHD1 ENCSR000AQD r=0.13
K562 Myers ZNF263 ENCSR000EWN r=0.13
K562 Myers CTCF ENCSR000DWE r=0.13
K562 Myers CTCF ENCSR000BPJ r=0.12
K562 Myers PHF8 ENCSR000AQH r=0.12
K562 Myers CTCFL ENCSR000BNK r=0.12
K562 Myers SIX5 ENCSR000BNW r=0.11
K562 Myers SIX5 ENCSR000BGX r=0.11
K562 Myers SP2 ENCSR000BNL r=0.11
K562 Myers POLR3A ENCSR000DOI r=0.10
K562 Myers THAP1 ENCSR000BNN r=0.10
K562 Myers NR2C2 ENCSR000EWH r=0.09
K562 Myers CBX8 ENCSR000ATW r=0.09
K562 Myers CBX2 ENCSR000ATU r=0.04
K562 Myers ZNF274 ENCSR000EWE r=0.01

9,811 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Myers - ENCSR000BQZ

K562 - Myers - ENCSR000BRR

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.