STAT3

The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. RefSeq, Sep 2015
Signal transducer and activator of transcription 3, also known as STAT3, is a transcription factor which in humans is encoded by the STAT3 gene.wikipedia

STAT3


ENCODE experiments
Ensemble search
Entrez 6774
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia STAT3

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZV

loading

HeLa-S3 - Snyder - ENCSR000EDC

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZV

1.
217 / 500
2.5e-95
AAGAGGAAGTGAAAG
small heat map img p-value: 0.00
pct_center: 0.44
pct_ratio: 0.65
2.
86 / 500
7.3e-15
TTGTGGTT
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.95
3.
23 / 500
3.7e-11
TATCTGTGTGTCTGTGTGTGTGTGTGTTTG
small heat map img p-value: 0.21
pct_center: 0.13
pct_ratio: 0.57
4.
38 / 500
7.5e-7
CATGTGATTTCTGGGAAATG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.64
5.
65 / 500
0.00016
ATGAGTCATAA
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 1.04
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Snyder - ENCSR000EDC

1.
467 / 500
5.1e-444
ATTTCCGGGAAATGA
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 1.30
2.
249 / 500
3.7e-117
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.45
pct_ratio: 3.26
3.
45 / 500
1.2e-17
AGGGAGGGGTGAGGG
small heat map img p-value: 0.41
pct_center: 0.25
pct_ratio: 0.48
4.
170 / 500
1.8e-14
ATTGTGCAATA
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 1.19
5.
19 / 500
0.66
AGGGGGAGGAA
small heat map img p-value: 0.92
pct_center: 0.22
pct_ratio: 0.45
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF 10A - Struhl - ENCSR000DOQ

1.
492 / 500
5.1e-501
CACTTCCGGGAAATG
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 1.92
2.
197 / 500
1.6e-90
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 3.46
3.
10 / 500
2.0e-35
GATGTTTGCACAATGATGAAATTGCCTAAT
small heat map img p-value: 0.00
pct_center: 0.07
pct_ratio: 0.76
4.
72 / 500
1.3e-27
GGGGGGGGGGAGGGA
small heat map img p-value: 0.67
pct_center: 0.33
pct_ratio: 0.48
5.
12 / 500
3.0e-19
TACAGTCATACGTTGCTTAATAACAGGGA
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.76
MEME output

MCF 10A - Struhl - ENCSR000DPB

1.
500 / 500
1.2e-455
TTCCGGGAAATG
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 1.84
2.
19 / 500
1.8e-95
ACAGTCATGCGTTGCTTAACGATGGGGATA
small heat map img p-value: 0.00
pct_center: 0.09
pct_ratio: 0.77
3.
191 / 500
7.8e-82
ATGAGTCA
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 3.10
4.
244 / 500
1.2e-67
ATTGTGCAATA
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 1.46
5.
104 / 500
4.7e-29
GGGGGTGGGGA
small heat map img p-value: 0.85
pct_center: 0.30
pct_ratio: 0.47
MEME output

MCF 10A - Struhl - ENCSR000DOZ

1.
495 / 500
6.2e-600
CTTCCGGGAAATGG
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 2.47
2.
19 / 500
2.1e-82
TGATGTTTGCACAATGATGAAATTGCCTA
small heat map img p-value: 0.01
pct_center: 0.07
pct_ratio: 0.74
3.
21 / 500
8.4e-86
TACAGTCATGCATTGCTTAACAATAGGGA
small heat map img p-value: 0.00
pct_center: 0.08
pct_ratio: 0.67
4.
138 / 500
6.4e-54
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 2.81
5.
131 / 500
1.6e-49
GGGGGAGGGGC
small heat map img p-value: 0.02
pct_center: 0.31
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at STAT3 peaks

GM12878 - Snyder - ENCSR000DZV

GM12878
Snyder
STAT3
ENCSR000DZV
r=1.00

small heat map img

GM12878
Snyder
H3K27ac
ENCSR000AKC
r=0.38

small heat map img

GM12878
Snyder
H3K4me2
ENCSR000AKG
r=0.36

small heat map img

GM12878
Snyder
H3K4me1
ENCSR000AKF
r=0.32

small heat map img

GM12878
Snyder
H2AFZ
ENCSR000AOV
r=0.32

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000AKA
r=0.32

small heat map img

GM12878
Snyder
H3K9ac
ENCSR000AKH
r=0.30

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000DRY
r=0.16

small heat map img

GM12878
Snyder
H3K79me2
ENCSR000AOW
r=0.11

small heat map img

GM12878
Snyder
H3K9me3
ENCSR000AOX
r=0.05

small heat map img

GM12878
Snyder
H4K20me1
ENCSR000AKI
r=-0.02

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000DRW
r=-0.03

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000AKE
r=-0.04

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000AKD
r=-0.06

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000DRX
r=-0.07

small heat map img
6,487 peaks (download )

HeLa-S3 - Snyder - ENCSR000EDC

HeLa-S3
Snyder
STAT3
ENCSR000EDC
r=1.00

small heat map img

HeLa-S3
Snyder
H3K4me1
ENCSR000APW
r=0.41

small heat map img

HeLa-S3
Snyder
H3K4me2
ENCSR000AOE
r=0.41

small heat map img

HeLa-S3
Snyder
H3K27ac
ENCSR000AOC
r=0.34

small heat map img

HeLa-S3
Snyder
H2AFZ
ENCSR000AQN
r=0.30

small heat map img

HeLa-S3
Snyder
H3K4me3
ENCSR000AOF
r=0.25

small heat map img

HeLa-S3
Snyder
H3K9ac
ENCSR000AOH
r=0.21

small heat map img

HeLa-S3
Snyder
H3K4me3
ENCSR000DUA
r=0.09

small heat map img

HeLa-S3
Snyder
H4K20me1
ENCSR000AOI
r=0.04

small heat map img

HeLa-S3
Snyder
H3K79me2
ENCSR000AOG
r=0.03

small heat map img

HeLa-S3
Snyder
H3K27me3
ENCSR000DTY
r=0.02

small heat map img

HeLa-S3
Snyder
H3K36me3
ENCSR000DTZ
r=0.01

small heat map img

HeLa-S3
Snyder
H3K9me3
ENCSR000AQO
r=0.00

small heat map img

HeLa-S3
Snyder
H3K36me3
ENCSR000AOD
r=-0.02

small heat map img

HeLa-S3
Snyder
H3K27me3
ENCSR000APB
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 13,834 (download )

MCF 10A - Struhl - ENCSR000DOQ

MCF 10A
Struhl
STAT3
ENCSR000DOQ
r=1.00

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DPB
r=0.93

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DOZ
r=0.76

small heat map img
10,000 randomly-selected peaks from a total of 39,908 (download )

MCF 10A - Struhl - ENCSR000DOZ

MCF 10A
Struhl
STAT3
ENCSR000DOZ
r=1.00

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DOQ
r=0.84

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DPB
r=0.83

small heat map img
10,000 randomly-selected peaks from a total of 12,334 (download )

MCF 10A - Struhl - ENCSR000DPB

MCF 10A
Struhl
STAT3
ENCSR000DPB
r=1.00

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DOQ
r=0.93

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DOZ
r=0.73

small heat map img
10,000 randomly-selected peaks from a total of 44,494 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at STAT3 peaks

GM12878 - Snyder - ENCSR000DZV

GM12878
Snyder
STAT3
ENCSR000DZV
r=1.00

small heat map img

GM12878
Snyder
TBL1XR1
ENCSR000DYZ
r=0.80

small heat map img

GM12878
Snyder
EP300
ENCSR000DZG
r=0.80

small heat map img

GM12878
Snyder
RCOR1
ENCSR000DZC
r=0.79

small heat map img

GM12878
Snyder
EP300
ENCSR000DZD
r=0.77

small heat map img

GM12878
Snyder
RELA
ENCSR000EAG
r=0.76

small heat map img

GM12878
Snyder
CUX1
ENCSR000DYR
r=0.75

small heat map img

GM12878
Snyder
RUNX3
ENCSR000BRI
r=0.70

small heat map img

GM12878
Snyder
BHLHE40
ENCSR000DZJ
r=0.67

small heat map img

GM12878
Snyder
IKZF1
ENCSR000EUJ
r=0.67

small heat map img

GM12878
Snyder
ESRRA
ENCSR000DYQ
r=0.67

small heat map img

GM12878
Snyder
NFIC
ENCSR000BRN
r=0.67

small heat map img

GM12878
Snyder
ATF2
ENCSR000BQK
r=0.66

small heat map img

GM12878
Snyder
SMC3
ENCSR000DZP
r=0.66

small heat map img

GM12878
Snyder
MXI1
ENCSR000DZI
r=0.66

small heat map img

GM12878
Snyder
FOXM1
ENCSR000BRU
r=0.66

small heat map img

GM12878
Snyder
STAT1
ENCSR000DZM
r=0.66

small heat map img

GM12878
Snyder
SREBF1
ENCSR000DYU
r=0.65

small heat map img

GM12878
Snyder
JUND
ENCSR000DYS
r=0.65

small heat map img

GM12878
Snyder
ELK1
ENCSR000DZB
r=0.63

small heat map img

GM12878
Snyder
CEBPB
ENCSR000BRX
r=0.61

small heat map img

GM12878
Snyder
JUND
ENCSR000EYV
r=0.60

small heat map img

GM12878
Snyder
MAX
ENCSR000DZF
r=0.60

small heat map img

GM12878
Snyder
IRF3
ENCSR000DZX
r=0.59

small heat map img

GM12878
Snyder
RAD21
ENCSR000EAC
r=0.59

small heat map img

GM12878
Snyder
MAFK
ENCSR000DYV
r=0.58

small heat map img

GM12878
Snyder
SP1
ENCSR000BHK
r=0.58

small heat map img

GM12878
Snyder
SREBF2
ENCSR000DYT
r=0.55

small heat map img

GM12878
Snyder
CHD1
ENCSR000DZE
r=0.55

small heat map img

GM12878
Snyder
WRNIP1
ENCSR000EAA
r=0.54

small heat map img

GM12878
Snyder
NFATC1
ENCSR000BQL
r=0.54

small heat map img

GM12878
Snyder
BCL3
ENCSR000BNQ
r=0.53

small heat map img

GM12878
Snyder
EZH2
ENCSR000ARD
r=0.52

small heat map img

GM12878
Snyder
MEF2A
ENCSR000BKB
r=0.51

small heat map img

GM12878
Snyder
BCL11A
ENCSR000BHA
r=0.50

small heat map img

GM12878
Snyder
NFE2
ENCSR000DZY
r=0.50

small heat map img

GM12878
Snyder
TBP
ENCSR000DZZ
r=0.50

small heat map img

GM12878
Snyder
CREB1
ENCSR000BUF
r=0.50

small heat map img

GM12878
Snyder
ZNF384
ENCSR000DYP
r=0.49

small heat map img

GM12878
Snyder
MTA3
ENCSR000BRH
r=0.49

small heat map img

GM12878
Snyder
SIN3A
ENCSR000DYX
r=0.49

small heat map img

GM12878
Snyder
STAT5A
ENCSR000BQZ
r=0.48

small heat map img

GM12878
Snyder
BATF
ENCSR000BGT
r=0.48

small heat map img

GM12878
Snyder
EBF1
ENCSR000DZQ
r=0.48

small heat map img

GM12878
Snyder
BRCA1
ENCSR000DZS
r=0.48

small heat map img

GM12878
Snyder
USF2
ENCSR000DZU
r=0.48

small heat map img

GM12878
Snyder
E2F4
ENCSR000DYY
r=0.48

small heat map img

GM12878
Snyder
RFX5
ENCSR000DZW
r=0.48

small heat map img

GM12878
Snyder
PML
ENCSR000BQM
r=0.47

small heat map img

GM12878
Snyder
IRF4
ENCSR000BGY
r=0.47

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHD
r=0.46

small heat map img

GM12878
Snyder
FOS
ENCSR000EYZ
r=0.45

small heat map img

GM12878
Snyder
YY1
ENCSR000EUM
r=0.45

small heat map img

GM12878
Snyder
EP300
ENCSR000BHB
r=0.43

small heat map img

GM12878
Snyder
TCF12
ENCSR000BGZ
r=0.43

small heat map img

GM12878
Snyder
NRF1
ENCSR000DZO
r=0.43

small heat map img

GM12878
Snyder
POU2F2
ENCSR000BGP
r=0.41

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHJ
r=0.41

small heat map img

GM12878
Snyder
EBF1
ENCSR000BGU
r=0.40

small heat map img

GM12878
Snyder
ELF1
ENCSR000BMB
r=0.36

small heat map img

GM12878
Snyder
ETS1
ENCSR000BKA
r=0.35

small heat map img

GM12878
Snyder
TCF3
ENCSR000BQT
r=0.35

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EAD
r=0.34

small heat map img

GM12878
Snyder
NFYA
ENCSR000DNN
r=0.34

small heat map img

GM12878
Snyder
SPI1
ENCSR000BGQ
r=0.33

small heat map img

GM12878
Snyder
KAT2A
ENCSR000DNO
r=0.33

small heat map img

GM12878
Snyder
SUPT20H
ENCSR000DNP
r=0.33

small heat map img

GM12878
Snyder
POLR2A
ENCSR000DKT
r=0.32

small heat map img

GM12878
Snyder
SRF
ENCSR000BMI
r=0.30

small heat map img

GM12878
Snyder
ZNF143
ENCSR000DZL
r=0.29

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EYW
r=0.29

small heat map img

GM12878
Snyder
YY1
ENCSR000BNP
r=0.28

small heat map img

GM12878
Snyder
MYC
ENCSR000DKU
r=0.27

small heat map img

GM12878
Snyder
SIX5
ENCSR000BJE
r=0.26

small heat map img

GM12878
Snyder
RXRA
ENCSR000BJD
r=0.25

small heat map img

GM12878
Snyder
NFYB
ENCSR000DNM
r=0.25

small heat map img

GM12878
Snyder
CTCF
ENCSR000DZN
r=0.25

small heat map img

GM12878
Snyder
RAD21
ENCSR000BMY
r=0.24

small heat map img

GM12878
Snyder
EGR1
ENCSR000BMQ
r=0.22

small heat map img

GM12878
Snyder
PBX3
ENCSR000BGR
r=0.21

small heat map img

GM12878
Snyder
CTCF
ENCSR000AKB
r=0.21

small heat map img

GM12878
Snyder
CTCF
ENCSR000DKV
r=0.21

small heat map img

GM12878
Snyder
MEF2C
ENCSR000BNG
r=0.20

small heat map img

GM12878
Snyder
TAF1
ENCSR000BGS
r=0.20

small heat map img

GM12878
Snyder
POLR3G
ENCSR000EYU
r=0.20

small heat map img

GM12878
Snyder
POLR2A
ENCSR000BGD
r=0.17

small heat map img

GM12878
Snyder
CTCF
ENCSR000DRZ
r=0.15

small heat map img

GM12878
Snyder
NR2C2
ENCSR000EUL
r=0.15

small heat map img

GM12878
Snyder
ZBTB33
ENCSR000BHC
r=0.13

small heat map img

GM12878
Snyder
ATF3
ENCSR000BJY
r=0.12

small heat map img

GM12878
Snyder
GABPA
ENCSR000BGC
r=0.11

small heat map img

GM12878
Snyder
ZNF274
ENCSR000EUK
r=0.11

small heat map img

GM12878
Snyder
ZZZ3
ENCSR000DNQ
r=0.10

small heat map img

GM12878
Snyder
USF1
ENCSR000BGI
r=0.09

small heat map img

GM12878
Snyder
EGR1
ENCSR000BRG
r=0.08

small heat map img

GM12878
Snyder
ZEB1
ENCSR000BND
r=0.08

small heat map img

GM12878
Snyder
REST
ENCSR000BQS
r=0.07

small heat map img

GM12878
Snyder
SRF
ENCSR000BGE
r=0.05

small heat map img

GM12878
Snyder
REST
ENCSR000BGF
r=0.04

small heat map img
6,487 peaks (download )

HeLa-S3 - Snyder - ENCSR000EDC

HeLa-S3
Snyder
STAT3
ENCSR000EDC
r=1.00

small heat map img

HeLa-S3
Snyder
EP300
ENCSR000ECV
r=0.86

small heat map img

HeLa-S3
Snyder
JUN
ENCSR000EDG
r=0.80

small heat map img

HeLa-S3
Snyder
JUND
ENCSR000EDH
r=0.78

small heat map img

HeLa-S3
Snyder
RCOR1
ENCSR000ECM
r=0.76

small heat map img

HeLa-S3
Snyder
BRCA1
ENCSR000EDB
r=0.75

small heat map img

HeLa-S3
Snyder
CEBPB
ENCSR000EDA
r=0.73

small heat map img

HeLa-S3
Snyder
MAFK
ENCSR000ECK
r=0.72

small heat map img

HeLa-S3
Snyder
FOS
ENCSR000EZE
r=0.71

small heat map img

HeLa-S3
Snyder
MAX
ENCSR000ECN
r=0.70

small heat map img

HeLa-S3
Snyder
RAD21
ENCSR000EDE
r=0.67

small heat map img

HeLa-S3
Snyder
RFX5
ENCSR000ECX
r=0.67

small heat map img

HeLa-S3
Snyder
SMC3
ENCSR000ECS
r=0.66

small heat map img

HeLa-S3
Snyder
MXI1
ENCSR000ECU
r=0.65

small heat map img

HeLa-S3
Snyder
ELK1
ENCSR000ECI
r=0.62

small heat map img

HeLa-S3
Snyder
ZKSCAN1
ENCSR000ECJ
r=0.62

small heat map img

HeLa-S3
Snyder
HCFC1
ENCSR000ECH
r=0.62

small heat map img

HeLa-S3
Snyder
MYC
ENCSR000EZD
r=0.61

small heat map img

HeLa-S3
Snyder
PRDM1
ENCSR000ECY
r=0.61

small heat map img

HeLa-S3
Snyder
MYC
ENCSR000DLN
r=0.60

small heat map img

HeLa-S3
Snyder
MAX
ENCSR000EZF
r=0.60

small heat map img

HeLa-S3
Snyder
TCF7L2
ENCSR000EVE
r=0.59

small heat map img

HeLa-S3
Snyder
IRF3
ENCSR000EDF
r=0.57

small heat map img

HeLa-S3
Snyder
TBP
ENCSR000EDD
r=0.53

small heat map img

HeLa-S3
Snyder
USF2
ENCSR000ECW
r=0.52

small heat map img

HeLa-S3
Snyder
ZNF143
ENCSR000ECO
r=0.52

small heat map img

HeLa-S3
Snyder
STAT1
ENCSR000EZK
r=0.50

small heat map img

HeLa-S3
Snyder
SMARCC1
ENCSR000EDM
r=0.49

small heat map img

HeLa-S3
Snyder
TCF7L2
ENCSR000EVF
r=0.46

small heat map img

HeLa-S3
Snyder
SMARCC2
ENCSR000EDL
r=0.44

small heat map img

HeLa-S3
Snyder
NFYA
ENCSR000DNS
r=0.44

small heat map img

HeLa-S3
Snyder
NFYB
ENCSR000DNR
r=0.43

small heat map img

HeLa-S3
Snyder
ELK4
ENCSR000EVI
r=0.42

small heat map img

HeLa-S3
Snyder
SMARCA4
ENCSR000EZC
r=0.40

small heat map img

HeLa-S3
Snyder
NRF1
ENCSR000EDJ
r=0.38

small heat map img

HeLa-S3
Snyder
SUPT20H
ENCSR000ECQ
r=0.32

small heat map img

HeLa-S3
Snyder
GTF3C2
ENCSR000DNY
r=0.30

small heat map img

HeLa-S3
Snyder
KAT2A
ENCSR000ECR
r=0.30

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000DLM
r=0.27

small heat map img

HeLa-S3
Snyder
SMARCB1
ENCSR000EDK
r=0.23

small heat map img

HeLa-S3
Snyder
EZH2
ENCSR000ATC
r=0.22

small heat map img

HeLa-S3
Snyder
E2F4
ENCSR000EVL
r=0.21

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000DLO
r=0.19

small heat map img

HeLa-S3
Snyder
NR2C2
ENCSR000EVN
r=0.19

small heat map img

HeLa-S3
Snyder
E2F6
ENCSR000EVK
r=0.19

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000BGO
r=0.18

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000EZL
r=0.15

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000AOA
r=0.15

small heat map img

HeLa-S3
Snyder
BDP1
ENCSR000DNX
r=0.15

small heat map img

HeLa-S3
Snyder
E2F1
ENCSR000EVJ
r=0.13

small heat map img

HeLa-S3
Snyder
TAF1
ENCSR000BHT
r=0.12

small heat map img

HeLa-S3
Snyder
BRF2
ENCSR000DNV
r=0.12

small heat map img

HeLa-S3
Snyder
ZZZ3
ENCSR000DNT
r=0.12

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000DUB
r=0.12

small heat map img

HeLa-S3
Snyder
BRF1
ENCSR000DNW
r=0.09

small heat map img

HeLa-S3
Snyder
POLR3A
ENCSR000DNU
r=0.09

small heat map img

HeLa-S3
Snyder
ZNF274
ENCSR000EVG
r=0.09

small heat map img

HeLa-S3
Snyder
GABPA
ENCSR000BHS
r=0.08

small heat map img

HeLa-S3
Snyder
REST
ENCSR000BMN
r=0.08

small heat map img
10,000 randomly-selected peaks from a total of 13,834 (download )

MCF 10A - Struhl - ENCSR000DOQ

MCF 10A
Struhl
STAT3
ENCSR000DOQ
r=1.00

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DPB
r=0.93

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DOZ
r=0.76

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DOP
r=0.73

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DOO
r=0.71

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DON
r=0.71

small heat map img

MCF 10A
Struhl
MYC
ENCSR000DOM
r=0.68

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DOT
r=0.60

small heat map img

MCF 10A
Struhl
MYC
ENCSR000DOS
r=0.55

small heat map img

MCF 10A
Struhl
E2F4
ENCSR000DOR
r=0.43

small heat map img

MCF 10A
Struhl
POLR2A
ENCSR000DPC
r=0.28

small heat map img

MCF 10A
Struhl
POLR2A
ENCSR000DPA
r=0.27

small heat map img
10,000 randomly-selected peaks from a total of 39,908 (download )

MCF 10A - Struhl - ENCSR000DOZ

MCF 10A
Struhl
STAT3
ENCSR000DOZ
r=1.00

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DOQ
r=0.84

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DPB
r=0.83

small heat map img

MCF 10A
Struhl
MYC
ENCSR000DOM
r=0.73

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DOO
r=0.71

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DON
r=0.69

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DOP
r=0.69

small heat map img

MCF 10A
Struhl
MYC
ENCSR000DOS
r=0.66

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DOT
r=0.66

small heat map img

MCF 10A
Struhl
E2F4
ENCSR000DOR
r=0.42

small heat map img

MCF 10A
Struhl
POLR2A
ENCSR000DPA
r=0.27

small heat map img

MCF 10A
Struhl
POLR2A
ENCSR000DPC
r=0.22

small heat map img
10,000 randomly-selected peaks from a total of 12,334 (download )

MCF 10A - Struhl - ENCSR000DPB

MCF 10A
Struhl
STAT3
ENCSR000DPB
r=1.00

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DOQ
r=0.93

small heat map img

MCF 10A
Struhl
STAT3
ENCSR000DOZ
r=0.73

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DON
r=0.71

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DOP
r=0.71

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DOO
r=0.69

small heat map img

MCF 10A
Struhl
MYC
ENCSR000DOM
r=0.64

small heat map img

MCF 10A
Struhl
FOS
ENCSR000DOT
r=0.57

small heat map img

MCF 10A
Struhl
MYC
ENCSR000DOS
r=0.51

small heat map img

MCF 10A
Struhl
E2F4
ENCSR000DOR
r=0.36

small heat map img

MCF 10A
Struhl
POLR2A
ENCSR000DPC
r=0.22

small heat map img

MCF 10A
Struhl
POLR2A
ENCSR000DPA
r=0.21

small heat map img
10,000 randomly-selected peaks from a total of 44,494 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZV

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help