STAT1

The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. Two alternatively spliced transcript variants encoding distinct isoforms have been described. RefSeq, Jul 2008
STAT1 is a member of the Signal Transducers and Activators of Transcription family of transcription factors. STAT1 is involved in upregulating genes due to a signal by either type I, type II, or type III interferons.wikipedia

STAT1

PDB image
PDB 1BF5

PDB 1BF5 1YVL 2KA6 3WWT
ENCODE experiments
Ensemble search
Entrez 6772
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia STAT1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZM

loading

HeLa-S3 - Weissman - ENCSR000EZK

loading

K562 - Snyder - ENCSR000EHJ

loading

K562 - Snyder - ENCSR000EHK

loading

K562 - Weissman - ENCSR000FAU

loading

K562 - Weissman - ENCSR000FAV

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZM

1.
194 / 500
2.9e-79
GGGGCAGGGGGGGGAGGGAGAGGGGCGGGG
small heat map img p-value: 0.00
pct_center: 0.68
pct_ratio: 0.52
2.
119 / 500
2.5e-41
TTAAAAAAATAAAAAGAAAAAAAAAATAT
small heat map img p-value: 0.98
pct_center: 0.17
pct_ratio: 0.44
3.
9 / 500
8.4e-14
GTGTGTGTGTGTGTGTGTGTGTGTGTG
small heat map img p-value: 0.68
pct_center: 0.13
pct_ratio: 0.46
4.
43 / 500
3.7e-10
GGGGCGGGGCCGGCGGGGCCGGGGCCGGG
small heat map img p-value: 0.00
pct_center: 0.55
pct_ratio: 0.54
5.
9 / 500
0.0013
GCTGGGATTACAGGCAGATGCCACCATGC
small heat map img p-value: 1.00
pct_center: 0.17
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Weissman - ENCSR000EZK

1.
444 / 500
4.8e-832
TTTCCGGGAAATGGG
small heat map img p-value: 0.00
pct_center: 0.44
pct_ratio: 2.12
2.
41 / 500
1.4e-299
TTACCCTATATGGTCTAAAAAGGGGAGGAA
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.63
3.
36 / 500
2.8e-118
GGCAATTCCCGGAACTGAGGG
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 1.61
4.
27 / 500
3.7e-56
TGCCATGGCAATGTCAGGAAG
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.63
5.
30 / 500
2.1e-50
TGGATTATTCATGAG
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.95
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Snyder - ENCSR000EHK

1.
479 / 500
3.3e-970
TTTCCGGGAAA
small heat map img p-value: 0.00
pct_center: 0.69
pct_ratio: 3.07
2.
90 / 500
5.3e-445
GGCAATTCCCGGAACTGAGGG
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 2.24
3.
101 / 500
1.0e-248
CTATATGGTCTAAAA
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 1.33
4.
50 / 500
8.4e-206
AGGGGTGGATTATTCATGAGT
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 1.23
5.
17 / 500
2.1e-88
GGTAACTTCTGGACGTTGCCATGGCATTT
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 1.33
MEME output

K562 - Snyder - ENCSR000EHJ

1.
474 / 500
1.9e-934
GATTTCCGGGAAA
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 2.86
2.
58 / 500
6.2e-296
ACCCTATATGGTCTAAAAAGGG
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 1.03
3.
46 / 500
4.2e-162
GCAATTCCCGGAACTGAG
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 1.90
4.
39 / 500
6.2e-148
ACAAGGGGTGGATTATTCATG
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 1.19
5.
28 / 500
2.4e-76
CCATGGCAACGTCAGGAAGTT
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 1.13
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Weissman - ENCSR000FAU

1.
408 / 500
2.4e-929
GGGAAAATGAAACT
small heat map img p-value: 0.00
pct_center: 0.44
pct_ratio: 1.31
2.
16 / 500
5.8e-102
AGCCCATAAAAGGGAAGAAAGTTTCGTTAT
small heat map img p-value: 0.79
pct_center: 0.07
pct_ratio: 0.32
3.
18 / 500
2.5e-93
GGAAGGGGACCGGGGTATAACCTTATAAGG
small heat map img p-value: 0.17
pct_center: 0.17
pct_ratio: 0.60
4.
176 / 500
6.2e-37
GGGAGGGG
small heat map img p-value: 0.00
pct_center: 0.41
pct_ratio: 0.69
5.
56 / 500
1.8e-32
GAAAATGAAACTTAA
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 0.90
MEME output

K562 - Weissman - ENCSR000FAV

1.
373 / 500
3.2e-408
TTTCCGGGAAATGGA
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 1.62
2.
30 / 500
1.5e-174
ACCCTATATGGTCTAAAAAGGGGAGGAAC
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.59
3.
125 / 500
5.0e-165
AGAAGGGAAAACGAAACTGAA
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.68
4.
14 / 500
9.3e-65
TGCTAAACAAGGGGTGGATTATTCATGAG
small heat map img p-value: 0.00
pct_center: 0.09
pct_ratio: 0.75
5.
19 / 500
5.7e-69
TGGGCAATTCCCGGAACTGAG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.93
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at STAT1 peaks

GM12878 - Snyder - ENCSR000DZM

GM12878
Snyder
STAT1
ENCSR000DZM
r=1.00

small heat map img

GM12878
Snyder
H3K9ac
ENCSR000AKH
r=0.36

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000AKA
r=0.36

small heat map img

GM12878
Snyder
H2AFZ
ENCSR000AOV
r=0.36

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000DRY
r=0.34

small heat map img

GM12878
Snyder
H3K4me2
ENCSR000AKG
r=0.30

small heat map img

GM12878
Snyder
H3K27ac
ENCSR000AKC
r=0.30

small heat map img

GM12878
Snyder
H3K79me2
ENCSR000AOW
r=0.18

small heat map img

GM12878
Snyder
H3K4me1
ENCSR000AKF
r=0.10

small heat map img

GM12878
Snyder
H3K9me3
ENCSR000AOX
r=0.07

small heat map img

GM12878
Snyder
H4K20me1
ENCSR000AKI
r=0.02

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000AKD
r=-0.02

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000DRW
r=-0.03

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000DRX
r=-0.03

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000AKE
r=-0.05

small heat map img
1,769 peaks (download )

HeLa-S3 - Weissman - ENCSR000EZK

HeLa-S3
Weissman
STAT1
ENCSR000EZK
r=1.00

small heat map img

HeLa-S3
Weissman
H3K27ac
ENCSR000AOC
r=0.27

small heat map img

HeLa-S3
Weissman
H3K4me2
ENCSR000AOE
r=0.26

small heat map img

HeLa-S3
Weissman
H2AFZ
ENCSR000AQN
r=0.25

small heat map img

HeLa-S3
Weissman
H3K4me3
ENCSR000AOF
r=0.23

small heat map img

HeLa-S3
Weissman
H3K9ac
ENCSR000AOH
r=0.23

small heat map img

HeLa-S3
Weissman
H3K4me1
ENCSR000APW
r=0.22

small heat map img

HeLa-S3
Weissman
H3K4me3
ENCSR000DUA
r=0.17

small heat map img

HeLa-S3
Weissman
H3K79me2
ENCSR000AOG
r=0.05

small heat map img

HeLa-S3
Weissman
H3K27me3
ENCSR000DTY
r=0.03

small heat map img

HeLa-S3
Weissman
H3K36me3
ENCSR000DTZ
r=0.01

small heat map img

HeLa-S3
Weissman
H4K20me1
ENCSR000AOI
r=0.01

small heat map img

HeLa-S3
Weissman
H3K9me3
ENCSR000AQO
r=-0.00

small heat map img

HeLa-S3
Weissman
H3K27me3
ENCSR000APB
r=-0.03

small heat map img

HeLa-S3
Weissman
H3K36me3
ENCSR000AOD
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 16,158 (download )

K562 - Snyder - ENCSR000EHJ

K562
Snyder
STAT1
ENCSR000EHJ
r=1.00

small heat map img

K562
Snyder
STAT1
ENCSR000EHK
r=0.90

small heat map img

K562
Snyder
STAT1
ENCSR000FAV
r=0.76

small heat map img

K562
Snyder
STAT1
ENCSR000FAU
r=0.58

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.33

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.31

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.30

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.27

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.27

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.23

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.23

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.19

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.18

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.18

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.11

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.09

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.06

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.06

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=0.03

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=0.01

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=0.01

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=-0.02

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.02

small heat map img
2,333 peaks (download )

K562 - Snyder - ENCSR000EHK

K562
Snyder
STAT1
ENCSR000EHK
r=1.00

small heat map img

K562
Snyder
STAT1
ENCSR000EHJ
r=0.91

small heat map img

K562
Snyder
STAT1
ENCSR000FAV
r=0.75

small heat map img

K562
Snyder
STAT1
ENCSR000FAU
r=0.54

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.29

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.29

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.26

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.24

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.24

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.24

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.18

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.17

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.14

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.12

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.10

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.08

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.05

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.04

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=0.02

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=0.01

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=0.00

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=-0.02

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.04

small heat map img
2,203 peaks (download )

K562 - Weissman - ENCSR000FAU

K562
Weissman
STAT1
ENCSR000FAU
r=1.00

small heat map img

K562
Weissman
STAT1
ENCSR000FAV
r=0.77

small heat map img

K562
Weissman
STAT1
ENCSR000EHJ
r=0.48

small heat map img

K562
Weissman
STAT1
ENCSR000EHK
r=0.40

small heat map img

K562
Weissman
H2AFZ
ENCSR000APC
r=0.29

small heat map img

K562
Weissman
H3K4me2
ENCSR000AKT
r=0.27

small heat map img

K562
Weissman
H3K4me3
ENCSR000AKU
r=0.26

small heat map img

K562
Weissman
H3K27ac
ENCSR000AKP
r=0.23

small heat map img

K562
Weissman
H3K9ac
ENCSR000AKV
r=0.23

small heat map img

K562
Weissman
H3K9ac
ENCSR000EVZ
r=0.19

small heat map img

K562
Weissman
H3K4me3
ENCSR000DWD
r=0.17

small heat map img

K562
Weissman
H3K4me3
ENCSR000EWA
r=0.16

small heat map img

K562
Weissman
H3K4me1
ENCSR000AKS
r=0.14

small heat map img

K562
Weissman
H3K4me1
ENCSR000EWC
r=0.14

small heat map img

K562
Weissman
H4K20me1
ENCSR000AKX
r=0.08

small heat map img

K562
Weissman
H3K9me1
ENCSR000AKW
r=0.08

small heat map img

K562
Weissman
H3K27me3
ENCSR000AKQ
r=0.04

small heat map img

K562
Weissman
H3K79me2
ENCSR000APD
r=0.04

small heat map img

K562
Weissman
H3K9me3
ENCSR000APE
r=0.03

small heat map img

K562
Weissman
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Weissman
H3K27me3
ENCSR000EWB
r=0.01

small heat map img

K562
Weissman
H3K36me3
ENCSR000AKR
r=-0.02

small heat map img

K562
Weissman
H3K36me3
ENCSR000DWB
r=-0.05

small heat map img
1,476 peaks (download )

K562 - Weissman - ENCSR000FAV

K562
Weissman
STAT1
ENCSR000FAV
r=1.00

small heat map img

K562
Weissman
STAT1
ENCSR000FAU
r=0.73

small heat map img

K562
Weissman
STAT1
ENCSR000EHJ
r=0.72

small heat map img

K562
Weissman
STAT1
ENCSR000EHK
r=0.69

small heat map img

K562
Weissman
H3K4me2
ENCSR000AKT
r=0.37

small heat map img

K562
Weissman
H3K27ac
ENCSR000AKP
r=0.37

small heat map img

K562
Weissman
H2AFZ
ENCSR000APC
r=0.36

small heat map img

K562
Weissman
H3K4me3
ENCSR000AKU
r=0.35

small heat map img

K562
Weissman
H3K9ac
ENCSR000AKV
r=0.33

small heat map img

K562
Weissman
H3K9ac
ENCSR000EVZ
r=0.26

small heat map img

K562
Weissman
H3K4me1
ENCSR000AKS
r=0.23

small heat map img

K562
Weissman
H3K4me3
ENCSR000DWD
r=0.22

small heat map img

K562
Weissman
H3K4me3
ENCSR000EWA
r=0.20

small heat map img

K562
Weissman
H3K4me1
ENCSR000EWC
r=0.20

small heat map img

K562
Weissman
H4K20me1
ENCSR000AKX
r=0.12

small heat map img

K562
Weissman
H3K9me1
ENCSR000AKW
r=0.11

small heat map img

K562
Weissman
H3K79me2
ENCSR000APD
r=0.07

small heat map img

K562
Weissman
H3K9me3
ENCSR000APE
r=0.04

small heat map img

K562
Weissman
H3K27me3
ENCSR000AKQ
r=0.04

small heat map img

K562
Weissman
H3K36me3
ENCSR000AKR
r=0.00

small heat map img

K562
Weissman
H3K27me3
ENCSR000DWC
r=-0.00

small heat map img

K562
Weissman
H3K27me3
ENCSR000EWB
r=-0.03

small heat map img

K562
Weissman
H3K36me3
ENCSR000DWB
r=-0.05

small heat map img
1,503 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at STAT1 peaks

GM12878 - Snyder - ENCSR000DZM

GM12878
Snyder
STAT1
ENCSR000DZM
r=1.00

small heat map img

GM12878
Snyder
MAX
ENCSR000DZF
r=0.73

small heat map img

GM12878
Snyder
RCOR1
ENCSR000DZC
r=0.72

small heat map img

GM12878
Snyder
MXI1
ENCSR000DZI
r=0.72

small heat map img

GM12878
Snyder
ELK1
ENCSR000DZB
r=0.72

small heat map img

GM12878
Snyder
TBL1XR1
ENCSR000DYZ
r=0.71

small heat map img

GM12878
Snyder
ESRRA
ENCSR000DYQ
r=0.65

small heat map img

GM12878
Snyder
SIN3A
ENCSR000DYX
r=0.65

small heat map img

GM12878
Snyder
RFX5
ENCSR000DZW
r=0.63

small heat map img

GM12878
Snyder
BHLHE40
ENCSR000DZJ
r=0.61

small heat map img

GM12878
Snyder
BRCA1
ENCSR000DZS
r=0.61

small heat map img

GM12878
Snyder
EP300
ENCSR000DZG
r=0.60

small heat map img

GM12878
Snyder
SREBF1
ENCSR000DYU
r=0.60

small heat map img

GM12878
Snyder
E2F4
ENCSR000DYY
r=0.60

small heat map img

GM12878
Snyder
JUND
ENCSR000DYS
r=0.58

small heat map img

GM12878
Snyder
NRF1
ENCSR000DZO
r=0.58

small heat map img

GM12878
Snyder
CREB1
ENCSR000BUF
r=0.58

small heat map img

GM12878
Snyder
EP300
ENCSR000DZD
r=0.56

small heat map img

GM12878
Snyder
MAFK
ENCSR000DYV
r=0.55

small heat map img

GM12878
Snyder
POLR2A
ENCSR000DKT
r=0.55

small heat map img

GM12878
Snyder
SMC3
ENCSR000DZP
r=0.55

small heat map img

GM12878
Snyder
CHD1
ENCSR000DZE
r=0.54

small heat map img

GM12878
Snyder
ELF1
ENCSR000BMB
r=0.54

small heat map img

GM12878
Snyder
STAT3
ENCSR000DZV
r=0.53

small heat map img

GM12878
Snyder
RELA
ENCSR000EAG
r=0.53

small heat map img

GM12878
Snyder
SREBF2
ENCSR000DYT
r=0.53

small heat map img

GM12878
Snyder
RUNX3
ENCSR000BRI
r=0.53

small heat map img

GM12878
Snyder
MYC
ENCSR000DKU
r=0.52

small heat map img

GM12878
Snyder
CUX1
ENCSR000DYR
r=0.52

small heat map img

GM12878
Snyder
WRNIP1
ENCSR000EAA
r=0.51

small heat map img

GM12878
Snyder
IRF3
ENCSR000DZX
r=0.51

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EAD
r=0.51

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHD
r=0.51

small heat map img

GM12878
Snyder
ZNF143
ENCSR000DZL
r=0.51

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EYW
r=0.50

small heat map img

GM12878
Snyder
USF2
ENCSR000DZU
r=0.50

small heat map img

GM12878
Snyder
SP1
ENCSR000BHK
r=0.48

small heat map img

GM12878
Snyder
TBP
ENCSR000DZZ
r=0.48

small heat map img

GM12878
Snyder
PML
ENCSR000BQM
r=0.47

small heat map img

GM12878
Snyder
POLR2A
ENCSR000BGD
r=0.46

small heat map img

GM12878
Snyder
YY1
ENCSR000BNP
r=0.46

small heat map img

GM12878
Snyder
FOS
ENCSR000EYZ
r=0.44

small heat map img

GM12878
Snyder
RAD21
ENCSR000EAC
r=0.44

small heat map img

GM12878
Snyder
TCF12
ENCSR000BGZ
r=0.43

small heat map img

GM12878
Snyder
NFE2
ENCSR000DZY
r=0.43

small heat map img

GM12878
Snyder
KAT2A
ENCSR000DNO
r=0.43

small heat map img

GM12878
Snyder
ZNF384
ENCSR000DYP
r=0.42

small heat map img

GM12878
Snyder
FOXM1
ENCSR000BRU
r=0.42

small heat map img

GM12878
Snyder
POU2F2
ENCSR000BGP
r=0.42

small heat map img

GM12878
Snyder
ATF2
ENCSR000BQK
r=0.41

small heat map img

GM12878
Snyder
ETS1
ENCSR000BKA
r=0.40

small heat map img

GM12878
Snyder
TCF3
ENCSR000BQT
r=0.40

small heat map img

GM12878
Snyder
CEBPB
ENCSR000BRX
r=0.37

small heat map img

GM12878
Snyder
SIX5
ENCSR000BJE
r=0.37

small heat map img

GM12878
Snyder
NFYA
ENCSR000DNN
r=0.37

small heat map img

GM12878
Snyder
BCL3
ENCSR000BNQ
r=0.37

small heat map img

GM12878
Snyder
NFIC
ENCSR000BRN
r=0.36

small heat map img

GM12878
Snyder
EGR1
ENCSR000BMQ
r=0.36

small heat map img

GM12878
Snyder
TAF1
ENCSR000BGS
r=0.35

small heat map img

GM12878
Snyder
CTCF
ENCSR000DZN
r=0.35

small heat map img

GM12878
Snyder
SRF
ENCSR000BMI
r=0.34

small heat map img

GM12878
Snyder
NFYB
ENCSR000DNM
r=0.34

small heat map img

GM12878
Snyder
EGR1
ENCSR000BRG
r=0.33

small heat map img

GM12878
Snyder
SUPT20H
ENCSR000DNP
r=0.33

small heat map img

GM12878
Snyder
STAT5A
ENCSR000BQZ
r=0.33

small heat map img

GM12878
Snyder
GABPA
ENCSR000BGC
r=0.32

small heat map img

GM12878
Snyder
CTCF
ENCSR000AKB
r=0.31

small heat map img

GM12878
Snyder
IKZF1
ENCSR000EUJ
r=0.30

small heat map img

GM12878
Snyder
IRF4
ENCSR000BGY
r=0.29

small heat map img

GM12878
Snyder
MEF2A
ENCSR000BKB
r=0.29

small heat map img

GM12878
Snyder
EBF1
ENCSR000DZQ
r=0.29

small heat map img

GM12878
Snyder
NFATC1
ENCSR000BQL
r=0.29

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHJ
r=0.29

small heat map img

GM12878
Snyder
CTCF
ENCSR000DKV
r=0.29

small heat map img

GM12878
Snyder
EP300
ENCSR000BHB
r=0.29

small heat map img

GM12878
Snyder
USF1
ENCSR000BGI
r=0.28

small heat map img

GM12878
Snyder
MTA3
ENCSR000BRH
r=0.27

small heat map img

GM12878
Snyder
CTCF
ENCSR000DRZ
r=0.27

small heat map img

GM12878
Snyder
NR2C2
ENCSR000EUL
r=0.27

small heat map img

GM12878
Snyder
SRF
ENCSR000BGE
r=0.25

small heat map img

GM12878
Snyder
EBF1
ENCSR000BGU
r=0.24

small heat map img

GM12878
Snyder
BCL11A
ENCSR000BHA
r=0.23

small heat map img

GM12878
Snyder
PBX3
ENCSR000BGR
r=0.23

small heat map img

GM12878
Snyder
RXRA
ENCSR000BJD
r=0.22

small heat map img

GM12878
Snyder
POLR3G
ENCSR000EYU
r=0.22

small heat map img

GM12878
Snyder
RAD21
ENCSR000BMY
r=0.20

small heat map img

GM12878
Snyder
ZBTB33
ENCSR000BHC
r=0.19

small heat map img

GM12878
Snyder
ZZZ3
ENCSR000DNQ
r=0.18

small heat map img

GM12878
Snyder
EZH2
ENCSR000ARD
r=0.18

small heat map img

GM12878
Snyder
JUND
ENCSR000EYV
r=0.17

small heat map img

GM12878
Snyder
SPI1
ENCSR000BGQ
r=0.17

small heat map img

GM12878
Snyder
YY1
ENCSR000EUM
r=0.16

small heat map img

GM12878
Snyder
ZEB1
ENCSR000BND
r=0.16

small heat map img

GM12878
Snyder
ATF3
ENCSR000BJY
r=0.16

small heat map img

GM12878
Snyder
MEF2C
ENCSR000BNG
r=0.16

small heat map img

GM12878
Snyder
REST
ENCSR000BGF
r=0.15

small heat map img

GM12878
Snyder
BATF
ENCSR000BGT
r=0.15

small heat map img

GM12878
Snyder
REST
ENCSR000BQS
r=0.13

small heat map img

GM12878
Snyder
ZNF274
ENCSR000EUK
r=-0.05

small heat map img
1,769 peaks (download )

HeLa-S3 - Weissman - ENCSR000EZK

HeLa-S3
Weissman
STAT1
ENCSR000EZK
r=1.00

small heat map img

HeLa-S3
Weissman
STAT3
ENCSR000EDC
r=0.45

small heat map img

HeLa-S3
Weissman
MAX
ENCSR000EZF
r=0.41

small heat map img

HeLa-S3
Weissman
RCOR1
ENCSR000ECM
r=0.40

small heat map img

HeLa-S3
Weissman
MYC
ENCSR000EZD
r=0.40

small heat map img

HeLa-S3
Weissman
MAX
ENCSR000ECN
r=0.39

small heat map img

HeLa-S3
Weissman
MAFK
ENCSR000ECK
r=0.37

small heat map img

HeLa-S3
Weissman
SMC3
ENCSR000ECS
r=0.37

small heat map img

HeLa-S3
Weissman
ELK1
ENCSR000ECI
r=0.37

small heat map img

HeLa-S3
Weissman
ZKSCAN1
ENCSR000ECJ
r=0.37

small heat map img

HeLa-S3
Weissman
MXI1
ENCSR000ECU
r=0.36

small heat map img

HeLa-S3
Weissman
FOS
ENCSR000EZE
r=0.36

small heat map img

HeLa-S3
Weissman
MYC
ENCSR000DLN
r=0.36

small heat map img

HeLa-S3
Weissman
JUND
ENCSR000EDH
r=0.35

small heat map img

HeLa-S3
Weissman
BRCA1
ENCSR000EDB
r=0.35

small heat map img

HeLa-S3
Weissman
TCF7L2
ENCSR000EVE
r=0.34

small heat map img

HeLa-S3
Weissman
RFX5
ENCSR000ECX
r=0.34

small heat map img

HeLa-S3
Weissman
SMARCC1
ENCSR000EDM
r=0.34

small heat map img

HeLa-S3
Weissman
JUN
ENCSR000EDG
r=0.33

small heat map img

HeLa-S3
Weissman
EP300
ENCSR000ECV
r=0.32

small heat map img

HeLa-S3
Weissman
ELK4
ENCSR000EVI
r=0.32

small heat map img

HeLa-S3
Weissman
CEBPB
ENCSR000EDA
r=0.31

small heat map img

HeLa-S3
Weissman
SMARCC2
ENCSR000EDL
r=0.31

small heat map img

HeLa-S3
Weissman
HCFC1
ENCSR000ECH
r=0.31

small heat map img

HeLa-S3
Weissman
USF2
ENCSR000ECW
r=0.30

small heat map img

HeLa-S3
Weissman
RAD21
ENCSR000EDE
r=0.30

small heat map img

HeLa-S3
Weissman
ZNF143
ENCSR000ECO
r=0.29

small heat map img

HeLa-S3
Weissman
PRDM1
ENCSR000ECY
r=0.28

small heat map img

HeLa-S3
Weissman
IRF3
ENCSR000EDF
r=0.27

small heat map img

HeLa-S3
Weissman
SMARCB1
ENCSR000EDK
r=0.26

small heat map img

HeLa-S3
Weissman
TBP
ENCSR000EDD
r=0.26

small heat map img

HeLa-S3
Weissman
POLR2A
ENCSR000DLM
r=0.25

small heat map img

HeLa-S3
Weissman
E2F4
ENCSR000EVL
r=0.25

small heat map img

HeLa-S3
Weissman
E2F6
ENCSR000EVK
r=0.24

small heat map img

HeLa-S3
Weissman
NFYA
ENCSR000DNS
r=0.24

small heat map img

HeLa-S3
Weissman
SMARCA4
ENCSR000EZC
r=0.24

small heat map img

HeLa-S3
Weissman
TCF7L2
ENCSR000EVF
r=0.22

small heat map img

HeLa-S3
Weissman
POLR2A
ENCSR000EZL
r=0.21

small heat map img

HeLa-S3
Weissman
KAT2A
ENCSR000ECR
r=0.21

small heat map img

HeLa-S3
Weissman
E2F1
ENCSR000EVJ
r=0.20

small heat map img

HeLa-S3
Weissman
NRF1
ENCSR000EDJ
r=0.20

small heat map img

HeLa-S3
Weissman
POLR2A
ENCSR000BGO
r=0.20

small heat map img

HeLa-S3
Weissman
NR2C2
ENCSR000EVN
r=0.20

small heat map img

HeLa-S3
Weissman
NFYB
ENCSR000DNR
r=0.19

small heat map img

HeLa-S3
Weissman
CTCF
ENCSR000DLO
r=0.18

small heat map img

HeLa-S3
Weissman
CTCF
ENCSR000AOA
r=0.18

small heat map img

HeLa-S3
Weissman
ZNF274
ENCSR000EVG
r=0.17

small heat map img

HeLa-S3
Weissman
CTCF
ENCSR000DUB
r=0.17

small heat map img

HeLa-S3
Weissman
SUPT20H
ENCSR000ECQ
r=0.16

small heat map img

HeLa-S3
Weissman
EZH2
ENCSR000ATC
r=0.14

small heat map img

HeLa-S3
Weissman
GTF3C2
ENCSR000DNY
r=0.14

small heat map img

HeLa-S3
Weissman
TAF1
ENCSR000BHT
r=0.13

small heat map img

HeLa-S3
Weissman
GABPA
ENCSR000BHS
r=0.12

small heat map img

HeLa-S3
Weissman
BRF2
ENCSR000DNV
r=0.10

small heat map img

HeLa-S3
Weissman
BDP1
ENCSR000DNX
r=0.07

small heat map img

HeLa-S3
Weissman
POLR3A
ENCSR000DNU
r=0.06

small heat map img

HeLa-S3
Weissman
REST
ENCSR000BMN
r=0.05

small heat map img

HeLa-S3
Weissman
BRF1
ENCSR000DNW
r=0.02

small heat map img

HeLa-S3
Weissman
ZZZ3
ENCSR000DNT
r=-0.00

small heat map img
10,000 randomly-selected peaks from a total of 16,158 (download )

K562 - Snyder - ENCSR000EHJ

K562
Snyder
STAT1
ENCSR000EHJ
r=1.00

small heat map img

K562
Snyder
STAT1
ENCSR000EHK
r=0.90

small heat map img

K562
Snyder
STAT1
ENCSR000FAV
r=0.76

small heat map img

K562
Snyder
STAT2
ENCSR000FAT
r=0.75

small heat map img

K562
Snyder
STAT1
ENCSR000FAU
r=0.58

small heat map img

K562
Snyder
STAT5A
ENCSR000BRR
r=0.55

small heat map img

K562
Snyder
IRF1
ENCSR000EGT
r=0.53

small heat map img

K562
Snyder
STAT2
ENCSR000FBC
r=0.53

small heat map img

K562
Snyder
MYC
ENCSR000EZU
r=0.52

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGB
r=0.52

small heat map img

K562
Snyder
RCOR1
ENCSR000EGG
r=0.52

small heat map img

K562
Snyder
JUN
ENCSR000EZT
r=0.52

small heat map img

K562
Snyder
IRF1
ENCSR000EGK
r=0.51

small heat map img

K562
Snyder
EP300
ENCSR000EGE
r=0.51

small heat map img

K562
Snyder
JUN
ENCSR000EGH
r=0.51

small heat map img

K562
Snyder
JUND
ENCSR000EGN
r=0.50

small heat map img

K562
Snyder
MYC
ENCSR000FAZ
r=0.50

small heat map img

K562
Snyder
ATF1
ENCSR000DNZ
r=0.50

small heat map img

K562
Snyder
MYC
ENCSR000EZV
r=0.49

small heat map img

K562
Snyder
JUN
ENCSR000EFS
r=0.49

small heat map img

K562
Snyder
JUN
ENCSR000EZX
r=0.49

small heat map img

K562
Snyder
IRF1
ENCSR000EGL
r=0.48

small heat map img

K562
Snyder
JUN
ENCSR000FAH
r=0.48

small heat map img

K562
Snyder
JUN
ENCSR000EZW
r=0.48

small heat map img

K562
Snyder
MYC
ENCSR000EGS
r=0.47

small heat map img

K562
Snyder
ARID3A
ENCSR000EFY
r=0.46

small heat map img

K562
Snyder
IRF1
ENCSR000EGU
r=0.45

small heat map img

K562
Snyder
GATA1
ENCSR000EFT
r=0.44

small heat map img

K562
Snyder
RCOR1
ENCSR000EGC
r=0.44

small heat map img

K562
Snyder
MYC
ENCSR000FAG
r=0.44

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGA
r=0.42

small heat map img

K562
Snyder
MAFK
ENCSR000EGX
r=0.42

small heat map img

K562
Snyder
MAX
ENCSR000EFV
r=0.41

small heat map img

K562
Snyder
MYC
ENCSR000EGJ
r=0.41

small heat map img

K562
Snyder
TRIM28
ENCSR000BRW
r=0.41

small heat map img

K562
Snyder
MYC
ENCSR000DLZ
r=0.40

small heat map img

K562
Snyder
CBX3
ENCSR000BRT
r=0.40

small heat map img

K562
Snyder
ZMIZ1
ENCSR000EFQ
r=0.40

small heat map img

K562
Snyder
BHLHE40
ENCSR000EGV
r=0.40

small heat map img

K562
Snyder
EP300
ENCSR000EGY
r=0.40

small heat map img

K562
Snyder
SIRT6
ENCSR000DOH
r=0.39

small heat map img

K562
Snyder
MXI1
ENCSR000EGZ
r=0.39

small heat map img

K562
Snyder
CCNT2
ENCSR000DOA
r=0.39

small heat map img

K562
Snyder
CUX1
ENCSR000EFO
r=0.39

small heat map img

K562
Snyder
GATA2
ENCSR000EWG
r=0.38

small heat map img

K562
Snyder
FOS
ENCSR000FAI
r=0.38

small heat map img

K562
Snyder
ELK1
ENCSR000EFU
r=0.38

small heat map img

K562
Snyder
MAX
ENCSR000FAE
r=0.38

small heat map img

K562
Snyder
EP300
ENCSR000AQB
r=0.37

small heat map img

K562
Snyder
NR2F2
ENCSR000BRS
r=0.37

small heat map img

K562
Snyder
CEBPD
ENCSR000BVY
r=0.36

small heat map img

K562
Snyder
TEAD4
ENCSR000BRK
r=0.36

small heat map img

K562
Snyder
KDM1A
ENCSR000ATX
r=0.36

small heat map img

K562
Snyder
SETDB1
ENCSR000AUT
r=0.36

small heat map img

K562
Snyder
UBTF
ENCSR000EFZ
r=0.35

small heat map img

K562
Snyder
MAFF
ENCSR000EGI
r=0.35

small heat map img

K562
Snyder
HMGN3
ENCSR000DOB
r=0.35

small heat map img

K562
Snyder
GATA2
ENCSR000BKM
r=0.34

small heat map img

K562
Snyder
E2F4
ENCSR000EWL
r=0.34

small heat map img

K562
Snyder
CEBPB
ENCSR000BRQ
r=0.34

small heat map img

K562
Snyder
GATA1
ENCSR000EWM
r=0.34

small heat map img

K562
Snyder
MAX
ENCSR000BLP
r=0.33

small heat map img

K562
Snyder
SMC3
ENCSR000EGW
r=0.33

small heat map img

K562
Snyder
CREB1
ENCSR000BSO
r=0.33

small heat map img

K562
Snyder
ZNF384
ENCSR000EFP
r=0.33

small heat map img

K562
Snyder
SRF
ENCSR000BLK
r=0.32

small heat map img

K562
Snyder
POLR2A
ENCSR000EHL
r=0.32

small heat map img

K562
Snyder
KAT2B
ENCSR000ATZ
r=0.32

small heat map img

K562
Snyder
UBTF
ENCSR000EFW
r=0.32

small heat map img

K562
Snyder
TAL1
ENCSR000EHB
r=0.32

small heat map img

K562
Snyder
NFE2
ENCSR000FAF
r=0.31

small heat map img

K562
Snyder
RAD21
ENCSR000FAD
r=0.30

small heat map img

K562
Snyder
BACH1
ENCSR000EGD
r=0.30

small heat map img

K562
Snyder
CHD7
ENCSR000AVD
r=0.30

small heat map img

K562
Snyder
SMARCA4
ENCSR000EHO
r=0.30

small heat map img

K562
Snyder
NFYA
ENCSR000EGR
r=0.30

small heat map img

K562
Snyder
USF1
ENCSR000BKT
r=0.29

small heat map img

K562
Snyder
POLR2A
ENCSR000FAY
r=0.29

small heat map img

K562
Snyder
EGR1
ENCSR000BNE
r=0.29

small heat map img

K562
Snyder
POLR2A
ENCSR000FAX
r=0.29

small heat map img

K562
Snyder
NCOR1
ENCSR000ATY
r=0.29

small heat map img

K562
Snyder
GTF2B
ENCSR000DOE
r=0.28

small heat map img

K562
Snyder
POLR2A
ENCSR000DLY
r=0.28

small heat map img

K562
Snyder
POLR2A
ENCSR000FAW
r=0.28

small heat map img

K562
Snyder
EZH2
ENCSR000AQE
r=0.28

small heat map img

K562
Snyder
REST
ENCSR000BMW
r=0.28

small heat map img

K562
Snyder
PML
ENCSR000BQY
r=0.27

small heat map img

K562
Snyder
SMARCB1
ENCSR000EHN
r=0.27

small heat map img

K562
Snyder
POLR2A
ENCSR000EHP
r=0.27

small heat map img

K562
Snyder
HCFC1
ENCSR000EFN
r=0.27

small heat map img

K562
Snyder
HDAC2
ENCSR000AQG
r=0.26

small heat map img

K562
Snyder
HDAC1
ENCSR000AQF
r=0.26

small heat map img

K562
Snyder
RFX5
ENCSR000EGO
r=0.26

small heat map img

K562
Snyder
HDAC2
ENCSR000BMG
r=0.26

small heat map img

K562
Snyder
E2F6
ENCSR000EWJ
r=0.26

small heat map img

K562
Snyder
GABPA
ENCSR000BLO
r=0.26

small heat map img

K562
Snyder
POLR2A
ENCSR000FAJ
r=0.26

small heat map img

K562
Snyder
SETDB1
ENCSR000EWI
r=0.26

small heat map img

K562
Snyder
CEBPB
ENCSR000EHE
r=0.26

small heat map img

K562
Snyder
ZNF143
ENCSR000EGP
r=0.26

small heat map img

K562
Snyder
MEF2A
ENCSR000BNV
r=0.26

small heat map img

K562
Snyder
ZNF274
ENCSR000EVX
r=0.25

small heat map img

K562
Snyder
ELF1
ENCSR000BMD
r=0.25

small heat map img

K562
Snyder
HDAC6
ENCSR000ATJ
r=0.25

small heat map img

K562
Snyder
ATF3
ENCSR000BNU
r=0.25

small heat map img

K562
Snyder
ETS1
ENCSR000BKQ
r=0.24

small heat map img

K562
Snyder
TAF1
ENCSR000BKS
r=0.24

small heat map img

K562
Snyder
SPI1
ENCSR000BGW
r=0.24

small heat map img

K562
Snyder
TBP
ENCSR000EHA
r=0.24

small heat map img

K562
Snyder
RBBP5
ENCSR000AQI
r=0.24

small heat map img

K562
Snyder
TRIM28
ENCSR000EVY
r=0.24

small heat map img

K562
Snyder
ATF3
ENCSR000DOG
r=0.24

small heat map img

K562
Snyder
USF2
ENCSR000EHG
r=0.23

small heat map img

K562
Snyder
CTCF
ENCSR000EGM
r=0.23

small heat map img

K562
Snyder
KDM5B
ENCSR000AQA
r=0.23

small heat map img

K562
Snyder
BRF2
ENCSR000DOC
r=0.23

small heat map img

K562
Snyder
POLR2A
ENCSR000BMR
r=0.23

small heat map img

K562
Snyder
FOSL1
ENCSR000BMV
r=0.23

small heat map img

K562
Snyder
YY1
ENCSR000BKU
r=0.22

small heat map img

K562
Snyder
NRF1
ENCSR000EHH
r=0.22

small heat map img

K562
Snyder
SP1
ENCSR000BKO
r=0.22

small heat map img

K562
Snyder
CBX3
ENCSR000ATV
r=0.22

small heat map img

K562
Snyder
GTF3C2
ENCSR000DOD
r=0.21

small heat map img

K562
Snyder
WHSC1
ENCSR000AVE
r=0.21

small heat map img

K562
Snyder
CREBBP
ENCSR000ATT
r=0.21

small heat map img

K562
Snyder
SAP30
ENCSR000AQJ
r=0.20

small heat map img

K562
Snyder
XRCC4
ENCSR000FAC
r=0.20

small heat map img

K562
Snyder
CTCF
ENCSR000DMA
r=0.20

small heat map img

K562
Snyder
RNF2
ENCSR000AUA
r=0.19

small heat map img

K562
Snyder
CTCF
ENCSR000AKO
r=0.19

small heat map img

K562
Snyder
RAD21
ENCSR000BKV
r=0.19

small heat map img

K562
Snyder
CHD4
ENCSR000ATL
r=0.19

small heat map img

K562
Snyder
YY1
ENCSR000EWF
r=0.18

small heat map img

K562
Snyder
SIRT6
ENCSR000AUB
r=0.18

small heat map img

K562
Snyder
ZNF263
ENCSR000EWN
r=0.18

small heat map img

K562
Snyder
CTCF
ENCSR000DWE
r=0.18

small heat map img

K562
Snyder
BDP1
ENCSR000DOK
r=0.18

small heat map img

K562
Snyder
NFYB
ENCSR000EGQ
r=0.17

small heat map img

K562
Snyder
CTCF
ENCSR000BPJ
r=0.17

small heat map img

K562
Snyder
SETDB1
ENCSR000EWD
r=0.17

small heat map img

K562
Snyder
SIN3A
ENCSR000BLR
r=0.17

small heat map img

K562
Snyder
ZBTB7A
ENCSR000BME
r=0.16

small heat map img

K562
Snyder
ZBTB33
ENCSR000BKF
r=0.16

small heat map img

K562
Snyder
E2F6
ENCSR000BLI
r=0.16

small heat map img

K562
Snyder
SIX5
ENCSR000BGX
r=0.16

small heat map img

K562
Snyder
POLR3G
ENCSR000EHQ
r=0.15

small heat map img

K562
Snyder
CTCFL
ENCSR000BNK
r=0.15

small heat map img

K562
Snyder
SUZ12
ENCSR000AUC
r=0.15

small heat map img

K562
Snyder
SIX5
ENCSR000BNW
r=0.14

small heat map img

K562
Snyder
PHF8
ENCSR000AQH
r=0.14

small heat map img

K562
Snyder
YY1
ENCSR000BMH
r=0.13

small heat map img

K562
Snyder
TAF7
ENCSR000BNM
r=0.13

small heat map img

K562
Snyder
THAP1
ENCSR000BNN
r=0.12

small heat map img

K562
Snyder
BRF1
ENCSR000DOJ
r=0.12

small heat map img

K562
Snyder
SP2
ENCSR000BNL
r=0.12

small heat map img

K562
Snyder
REST
ENCSR000ATM
r=0.12

small heat map img

K562
Snyder
POLR3A
ENCSR000DOI
r=0.10

small heat map img

K562
Snyder
NR2C2
ENCSR000EWH
r=0.09

small heat map img

K562
Snyder
CHD1
ENCSR000AQD
r=0.09

small heat map img

K562
Snyder
CBX8
ENCSR000ATW
r=0.08

small heat map img

K562
Snyder
CBX2
ENCSR000ATU
r=0.04

small heat map img

K562
Snyder
ZNF274
ENCSR000EWE
r=-0.01

small heat map img
2,333 peaks (download )

K562 - Snyder - ENCSR000EHK

K562
Snyder
STAT1
ENCSR000EHK
r=1.00

small heat map img

K562
Snyder
STAT1
ENCSR000EHJ
r=0.91

small heat map img

K562
Snyder
STAT1
ENCSR000FAV
r=0.75

small heat map img

K562
Snyder
STAT2
ENCSR000FAT
r=0.71

small heat map img

K562
Snyder
STAT5A
ENCSR000BRR
r=0.56

small heat map img

K562
Snyder
STAT1
ENCSR000FAU
r=0.54

small heat map img

K562
Snyder
IRF1
ENCSR000EGT
r=0.52

small heat map img

K562
Snyder
JUN
ENCSR000EZT
r=0.51

small heat map img

K562
Snyder
STAT2
ENCSR000FBC
r=0.50

small heat map img

K562
Snyder
ATF1
ENCSR000DNZ
r=0.50

small heat map img

K562
Snyder
EP300
ENCSR000EGE
r=0.49

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGB
r=0.48

small heat map img

K562
Snyder
MYC
ENCSR000EZU
r=0.48

small heat map img

K562
Snyder
JUN
ENCSR000EZW
r=0.48

small heat map img

K562
Snyder
JUN
ENCSR000EGH
r=0.48

small heat map img

K562
Snyder
RCOR1
ENCSR000EGG
r=0.47

small heat map img

K562
Snyder
JUND
ENCSR000EGN
r=0.47

small heat map img

K562
Snyder
JUN
ENCSR000EZX
r=0.46

small heat map img

K562
Snyder
IRF1
ENCSR000EGK
r=0.46

small heat map img

K562
Snyder
MYC
ENCSR000FAZ
r=0.46

small heat map img

K562
Snyder
MYC
ENCSR000EZV
r=0.45

small heat map img

K562
Snyder
JUN
ENCSR000FAH
r=0.44

small heat map img

K562
Snyder
JUN
ENCSR000EFS
r=0.44

small heat map img

K562
Snyder
ARID3A
ENCSR000EFY
r=0.44

small heat map img

K562
Snyder
MYC
ENCSR000EGS
r=0.43

small heat map img

K562
Snyder
IRF1
ENCSR000EGL
r=0.43

small heat map img

K562
Snyder
GATA1
ENCSR000EFT
r=0.41

small heat map img

K562
Snyder
IRF1
ENCSR000EGU
r=0.40

small heat map img

K562
Snyder
RCOR1
ENCSR000EGC
r=0.39

small heat map img

K562
Snyder
MYC
ENCSR000FAG
r=0.39

small heat map img

K562
Snyder
MAFK
ENCSR000EGX
r=0.39

small heat map img

K562
Snyder
FOS
ENCSR000FAI
r=0.38

small heat map img

K562
Snyder
SIRT6
ENCSR000DOH
r=0.38

small heat map img

K562
Snyder
EP300
ENCSR000EGY
r=0.37

small heat map img

K562
Snyder
MYC
ENCSR000EGJ
r=0.37

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGA
r=0.37

small heat map img

K562
Snyder
MYC
ENCSR000DLZ
r=0.36

small heat map img

K562
Snyder
GATA2
ENCSR000EWG
r=0.36

small heat map img

K562
Snyder
MAX
ENCSR000EFV
r=0.36

small heat map img

K562
Snyder
CUX1
ENCSR000EFO
r=0.36

small heat map img

K562
Snyder
BHLHE40
ENCSR000EGV
r=0.36

small heat map img

K562
Snyder
TRIM28
ENCSR000BRW
r=0.35

small heat map img

K562
Snyder
CCNT2
ENCSR000DOA
r=0.35

small heat map img

K562
Snyder
ZMIZ1
ENCSR000EFQ
r=0.35

small heat map img

K562
Snyder
MXI1
ENCSR000EGZ
r=0.35

small heat map img

K562
Snyder
CBX3
ENCSR000BRT
r=0.35

small heat map img

K562
Snyder
MAFF
ENCSR000EGI
r=0.34

small heat map img

K562
Snyder
KDM1A
ENCSR000ATX
r=0.34

small heat map img

K562
Snyder
GATA2
ENCSR000BKM
r=0.34

small heat map img

K562
Snyder
MAX
ENCSR000FAE
r=0.34

small heat map img

K562
Snyder
EP300
ENCSR000AQB
r=0.33

small heat map img

K562
Snyder
CEBPD
ENCSR000BVY
r=0.33

small heat map img

K562
Snyder
ELK1
ENCSR000EFU
r=0.33

small heat map img

K562
Snyder
TEAD4
ENCSR000BRK
r=0.33

small heat map img

K562
Snyder
NR2F2
ENCSR000BRS
r=0.33

small heat map img

K562
Snyder
TAL1
ENCSR000EHB
r=0.31

small heat map img

K562
Snyder
GATA1
ENCSR000EWM
r=0.31

small heat map img

K562
Snyder
CEBPB
ENCSR000BRQ
r=0.31

small heat map img

K562
Snyder
HMGN3
ENCSR000DOB
r=0.30

small heat map img

K562
Snyder
SRF
ENCSR000BLK
r=0.30

small heat map img

K562
Snyder
REST
ENCSR000BMW
r=0.30

small heat map img

K562
Snyder
SETDB1
ENCSR000AUT
r=0.29

small heat map img

K562
Snyder
NFYA
ENCSR000EGR
r=0.29

small heat map img

K562
Snyder
NFE2
ENCSR000FAF
r=0.29

small heat map img

K562
Snyder
CREB1
ENCSR000BSO
r=0.28

small heat map img

K562
Snyder
SMC3
ENCSR000EGW
r=0.28

small heat map img

K562
Snyder
RAD21
ENCSR000FAD
r=0.28

small heat map img

K562
Snyder
SMARCA4
ENCSR000EHO
r=0.28

small heat map img

K562
Snyder
E2F4
ENCSR000EWL
r=0.28

small heat map img

K562
Snyder
KAT2B
ENCSR000ATZ
r=0.27

small heat map img

K562
Snyder
POLR2A
ENCSR000EHL
r=0.27

small heat map img

K562
Snyder
EZH2
ENCSR000AQE
r=0.27

small heat map img

K562
Snyder
ZNF384
ENCSR000EFP
r=0.27

small heat map img

K562
Snyder
MAX
ENCSR000BLP
r=0.27

small heat map img

K562
Snyder
NCOR1
ENCSR000ATY
r=0.27

small heat map img

K562
Snyder
BACH1
ENCSR000EGD
r=0.26

small heat map img

K562
Snyder
UBTF
ENCSR000EFZ
r=0.26

small heat map img

K562
Snyder
CEBPB
ENCSR000EHE
r=0.26

small heat map img

K562
Snyder
SMARCB1
ENCSR000EHN
r=0.25

small heat map img

K562
Snyder
EGR1
ENCSR000BNE
r=0.25

small heat map img

K562
Snyder
UBTF
ENCSR000EFW
r=0.25

small heat map img

K562
Snyder
GTF2B
ENCSR000DOE
r=0.25

small heat map img

K562
Snyder
USF1
ENCSR000BKT
r=0.25

small heat map img

K562
Snyder
POLR2A
ENCSR000FAX
r=0.25

small heat map img

K562
Snyder
POLR2A
ENCSR000FAY
r=0.25

small heat map img

K562
Snyder
CHD7
ENCSR000AVD
r=0.24

small heat map img

K562
Snyder
E2F6
ENCSR000EWJ
r=0.24

small heat map img

K562
Snyder
ZNF143
ENCSR000EGP
r=0.24

small heat map img

K562
Snyder
MEF2A
ENCSR000BNV
r=0.24

small heat map img

K562
Snyder
PML
ENCSR000BQY
r=0.24

small heat map img

K562
Snyder
RFX5
ENCSR000EGO
r=0.24

small heat map img

K562
Snyder
ZNF274
ENCSR000EVX
r=0.23

small heat map img

K562
Snyder
POLR2A
ENCSR000DLY
r=0.23

small heat map img

K562
Snyder
SPI1
ENCSR000BGW
r=0.23

small heat map img

K562
Snyder
POLR2A
ENCSR000EHP
r=0.23

small heat map img

K562
Snyder
GABPA
ENCSR000BLO
r=0.23

small heat map img

K562
Snyder
HDAC2
ENCSR000BMG
r=0.23

small heat map img

K562
Snyder
POLR2A
ENCSR000FAW
r=0.23

small heat map img

K562
Snyder
HCFC1
ENCSR000EFN
r=0.22

small heat map img

K562
Snyder
HDAC1
ENCSR000AQF
r=0.22

small heat map img

K562
Snyder
POLR2A
ENCSR000FAJ
r=0.21

small heat map img

K562
Snyder
HDAC2
ENCSR000AQG
r=0.21

small heat map img

K562
Snyder
USF2
ENCSR000EHG
r=0.21

small heat map img

K562
Snyder
TRIM28
ENCSR000EVY
r=0.21

small heat map img

K562
Snyder
BRF2
ENCSR000DOC
r=0.21

small heat map img

K562
Snyder
CTCF
ENCSR000EGM
r=0.21

small heat map img

K562
Snyder
SETDB1
ENCSR000EWI
r=0.20

small heat map img

K562
Snyder
RBBP5
ENCSR000AQI
r=0.20

small heat map img

K562
Snyder
FOSL1
ENCSR000BMV
r=0.20

small heat map img

K562
Snyder
TBP
ENCSR000EHA
r=0.20

small heat map img

K562
Snyder
SP1
ENCSR000BKO
r=0.20

small heat map img

K562
Snyder
YY1
ENCSR000EWF
r=0.20

small heat map img

K562
Snyder
NRF1
ENCSR000EHH
r=0.20

small heat map img

K562
Snyder
GTF3C2
ENCSR000DOD
r=0.19

small heat map img

K562
Snyder
ELF1
ENCSR000BMD
r=0.19

small heat map img

K562
Snyder
ATF3
ENCSR000DOG
r=0.19

small heat map img

K562
Snyder
BDP1
ENCSR000DOK
r=0.18

small heat map img

K562
Snyder
TAF1
ENCSR000BKS
r=0.18

small heat map img

K562
Snyder
HDAC6
ENCSR000ATJ
r=0.18

small heat map img

K562
Snyder
ATF3
ENCSR000BNU
r=0.18

small heat map img

K562
Snyder
CREBBP
ENCSR000ATT
r=0.18

small heat map img

K562
Snyder
KDM5B
ENCSR000AQA
r=0.18

small heat map img

K562
Snyder
POLR2A
ENCSR000BMR
r=0.18

small heat map img

K562
Snyder
YY1
ENCSR000BKU
r=0.18

small heat map img

K562
Snyder
XRCC4
ENCSR000FAC
r=0.17

small heat map img

K562
Snyder
ETS1
ENCSR000BKQ
r=0.17

small heat map img

K562
Snyder
SAP30
ENCSR000AQJ
r=0.17

small heat map img

K562
Snyder
NFYB
ENCSR000EGQ
r=0.17

small heat map img

K562
Snyder
CTCF
ENCSR000DMA
r=0.16

small heat map img

K562
Snyder
CBX3
ENCSR000ATV
r=0.16

small heat map img

K562
Snyder
RNF2
ENCSR000AUA
r=0.16

small heat map img

K562
Snyder
CHD4
ENCSR000ATL
r=0.16

small heat map img

K562
Snyder
CTCF
ENCSR000AKO
r=0.16

small heat map img

K562
Snyder
WHSC1
ENCSR000AVE
r=0.15

small heat map img

K562
Snyder
RAD21
ENCSR000BKV
r=0.15

small heat map img

K562
Snyder
SETDB1
ENCSR000EWD
r=0.14

small heat map img

K562
Snyder
SIRT6
ENCSR000AUB
r=0.14

small heat map img

K562
Snyder
CTCF
ENCSR000DWE
r=0.14

small heat map img

K562
Snyder
ZBTB33
ENCSR000BKF
r=0.14

small heat map img

K562
Snyder
POLR3G
ENCSR000EHQ
r=0.14

small heat map img

K562
Snyder
CTCF
ENCSR000BPJ
r=0.13

small heat map img

K562
Snyder
E2F6
ENCSR000BLI
r=0.13

small heat map img

K562
Snyder
REST
ENCSR000ATM
r=0.12

small heat map img

K562
Snyder
SIN3A
ENCSR000BLR
r=0.12

small heat map img

K562
Snyder
ZBTB7A
ENCSR000BME
r=0.12

small heat map img

K562
Snyder
SIX5
ENCSR000BGX
r=0.12

small heat map img

K562
Snyder
SUZ12
ENCSR000AUC
r=0.12

small heat map img

K562
Snyder
ZNF263
ENCSR000EWN
r=0.12

small heat map img

K562
Snyder
SIX5
ENCSR000BNW
r=0.11

small heat map img

K562
Snyder
TAF7
ENCSR000BNM
r=0.11

small heat map img

K562
Snyder
BRF1
ENCSR000DOJ
r=0.11

small heat map img

K562
Snyder
CTCFL
ENCSR000BNK
r=0.10

small heat map img

K562
Snyder
PHF8
ENCSR000AQH
r=0.10

small heat map img

K562
Snyder
YY1
ENCSR000BMH
r=0.10

small heat map img

K562
Snyder
THAP1
ENCSR000BNN
r=0.08

small heat map img

K562
Snyder
SP2
ENCSR000BNL
r=0.08

small heat map img

K562
Snyder
POLR3A
ENCSR000DOI
r=0.08

small heat map img

K562
Snyder
NR2C2
ENCSR000EWH
r=0.08

small heat map img

K562
Snyder
CHD1
ENCSR000AQD
r=0.07

small heat map img

K562
Snyder
CBX8
ENCSR000ATW
r=0.06

small heat map img

K562
Snyder
CBX2
ENCSR000ATU
r=0.03

small heat map img

K562
Snyder
ZNF274
ENCSR000EWE
r=0.01

small heat map img
2,203 peaks (download )

K562 - Weissman - ENCSR000FAU

K562
Weissman
STAT1
ENCSR000FAU
r=1.00

small heat map img

K562
Weissman
STAT2
ENCSR000FBC
r=0.95

small heat map img

K562
Weissman
STAT2
ENCSR000FAT
r=0.82

small heat map img

K562
Weissman
STAT1
ENCSR000FAV
r=0.77

small heat map img

K562
Weissman
IRF1
ENCSR000EGL
r=0.66

small heat map img

K562
Weissman
IRF1
ENCSR000EGU
r=0.59

small heat map img

K562
Weissman
IRF1
ENCSR000EGK
r=0.58

small heat map img

K562
Weissman
STAT1
ENCSR000EHJ
r=0.48

small heat map img

K562
Weissman
MYC
ENCSR000EZV
r=0.44

small heat map img

K562
Weissman
MYC
ENCSR000EZU
r=0.43

small heat map img

K562
Weissman
IRF1
ENCSR000EGT
r=0.43

small heat map img

K562
Weissman
JUN
ENCSR000EZX
r=0.41

small heat map img

K562
Weissman
STAT1
ENCSR000EHK
r=0.40

small heat map img

K562
Weissman
MYC
ENCSR000FAZ
r=0.40

small heat map img

K562
Weissman
ATF1
ENCSR000DNZ
r=0.40

small heat map img

K562
Weissman
JUN
ENCSR000EZT
r=0.39

small heat map img

K562
Weissman
JUN
ENCSR000EGH
r=0.39

small heat map img

K562
Weissman
RCOR1
ENCSR000EGG
r=0.39

small heat map img

K562
Weissman
JUN
ENCSR000EFS
r=0.37

small heat map img

K562
Weissman
JUND
ENCSR000EGN
r=0.37

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGB
r=0.37

small heat map img

K562
Weissman
JUN
ENCSR000FAH
r=0.36

small heat map img

K562
Weissman
JUN
ENCSR000EZW
r=0.36

small heat map img

K562
Weissman
GATA1
ENCSR000EFT
r=0.35

small heat map img

K562
Weissman
MYC
ENCSR000EGS
r=0.35

small heat map img

K562
Weissman
EP300
ENCSR000EGE
r=0.34

small heat map img

K562
Weissman
MAX
ENCSR000EFV
r=0.34

small heat map img

K562
Weissman
RCOR1
ENCSR000EGC
r=0.33

small heat map img

K562
Weissman
ARID3A
ENCSR000EFY
r=0.33

small heat map img

K562
Weissman
MXI1
ENCSR000EGZ
r=0.33

small heat map img

K562
Weissman
MYC
ENCSR000FAG
r=0.33

small heat map img

K562
Weissman
MYC
ENCSR000EGJ
r=0.33

small heat map img

K562
Weissman
ZMIZ1
ENCSR000EFQ
r=0.33

small heat map img

K562
Weissman
BHLHE40
ENCSR000EGV
r=0.33

small heat map img

K562
Weissman
MAFK
ENCSR000EGX
r=0.33

small heat map img

K562
Weissman
SIRT6
ENCSR000DOH
r=0.32

small heat map img

K562
Weissman
CUX1
ENCSR000EFO
r=0.32

small heat map img

K562
Weissman
FOS
ENCSR000FAI
r=0.32

small heat map img

K562
Weissman
TRIM28
ENCSR000BRW
r=0.32

small heat map img

K562
Weissman
MYC
ENCSR000DLZ
r=0.31

small heat map img

K562
Weissman
STAT5A
ENCSR000BRR
r=0.31

small heat map img

K562
Weissman
EP300
ENCSR000AQB
r=0.31

small heat map img

K562
Weissman
CCNT2
ENCSR000DOA
r=0.31

small heat map img

K562
Weissman
EP300
ENCSR000EGY
r=0.31

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGA
r=0.31

small heat map img

K562
Weissman
CEBPD
ENCSR000BVY
r=0.31

small heat map img

K562
Weissman
GATA2
ENCSR000EWG
r=0.30

small heat map img

K562
Weissman
CBX3
ENCSR000BRT
r=0.30

small heat map img

K562
Weissman
MAX
ENCSR000FAE
r=0.30

small heat map img

K562
Weissman
NR2F2
ENCSR000BRS
r=0.30

small heat map img

K562
Weissman
KDM1A
ENCSR000ATX
r=0.29

small heat map img

K562
Weissman
TEAD4
ENCSR000BRK
r=0.29

small heat map img

K562
Weissman
POLR2A
ENCSR000FAX
r=0.29

small heat map img

K562
Weissman
SETDB1
ENCSR000AUT
r=0.29

small heat map img

K562
Weissman
NFYA
ENCSR000EGR
r=0.29

small heat map img

K562
Weissman
UBTF
ENCSR000EFZ
r=0.28

small heat map img

K562
Weissman
GATA2
ENCSR000BKM
r=0.28

small heat map img

K562
Weissman
GATA1
ENCSR000EWM
r=0.28

small heat map img

K562
Weissman
POLR2A
ENCSR000FAY
r=0.28

small heat map img

K562
Weissman
HMGN3
ENCSR000DOB
r=0.28

small heat map img

K562
Weissman
CEBPB
ENCSR000BRQ
r=0.28

small heat map img

K562
Weissman
MAFF
ENCSR000EGI
r=0.27

small heat map img

K562
Weissman
SMC3
ENCSR000EGW
r=0.27

small heat map img

K562
Weissman
KAT2B
ENCSR000ATZ
r=0.27

small heat map img

K562
Weissman
ELK1
ENCSR000EFU
r=0.27

small heat map img

K562
Weissman
REST
ENCSR000BMW
r=0.26

small heat map img

K562
Weissman
UBTF
ENCSR000EFW
r=0.26

small heat map img

K562
Weissman
TAL1
ENCSR000EHB
r=0.26

small heat map img

K562
Weissman
CREB1
ENCSR000BSO
r=0.26

small heat map img

K562
Weissman
EZH2
ENCSR000AQE
r=0.26

small heat map img

K562
Weissman
POLR2A
ENCSR000FAW
r=0.26

small heat map img

K562
Weissman
MAX
ENCSR000BLP
r=0.26

small heat map img

K562
Weissman
PML
ENCSR000BQY
r=0.25

small heat map img

K562
Weissman
E2F4
ENCSR000EWL
r=0.25

small heat map img

K562
Weissman
NFE2
ENCSR000FAF
r=0.25

small heat map img

K562
Weissman
RAD21
ENCSR000FAD
r=0.24

small heat map img

K562
Weissman
ZNF384
ENCSR000EFP
r=0.24

small heat map img

K562
Weissman
SMARCA4
ENCSR000EHO
r=0.24

small heat map img

K562
Weissman
POLR2A
ENCSR000EHL
r=0.23

small heat map img

K562
Weissman
HDAC1
ENCSR000AQF
r=0.23

small heat map img

K562
Weissman
CHD7
ENCSR000AVD
r=0.23

small heat map img

K562
Weissman
POLR2A
ENCSR000DLY
r=0.23

small heat map img

K562
Weissman
NCOR1
ENCSR000ATY
r=0.23

small heat map img

K562
Weissman
GTF2B
ENCSR000DOE
r=0.23

small heat map img

K562
Weissman
USF1
ENCSR000BKT
r=0.22

small heat map img

K562
Weissman
RBBP5
ENCSR000AQI
r=0.22

small heat map img

K562
Weissman
SPI1
ENCSR000BGW
r=0.22

small heat map img

K562
Weissman
SMARCB1
ENCSR000EHN
r=0.22

small heat map img

K562
Weissman
POLR2A
ENCSR000FAJ
r=0.22

small heat map img

K562
Weissman
POLR2A
ENCSR000EHP
r=0.22

small heat map img

K562
Weissman
BACH1
ENCSR000EGD
r=0.21

small heat map img

K562
Weissman
MEF2A
ENCSR000BNV
r=0.21

small heat map img

K562
Weissman
ZNF274
ENCSR000EVX
r=0.21

small heat map img

K562
Weissman
GABPA
ENCSR000BLO
r=0.21

small heat map img

K562
Weissman
E2F6
ENCSR000EWJ
r=0.21

small heat map img

K562
Weissman
CEBPB
ENCSR000EHE
r=0.21

small heat map img

K562
Weissman
RFX5
ENCSR000EGO
r=0.21

small heat map img

K562
Weissman
EGR1
ENCSR000BNE
r=0.21

small heat map img

K562
Weissman
HDAC2
ENCSR000BMG
r=0.20

small heat map img

K562
Weissman
SRF
ENCSR000BLK
r=0.20

small heat map img

K562
Weissman
POLR2A
ENCSR000BMR
r=0.20

small heat map img

K562
Weissman
HDAC2
ENCSR000AQG
r=0.20

small heat map img

K562
Weissman
HCFC1
ENCSR000EFN
r=0.20

small heat map img

K562
Weissman
SETDB1
ENCSR000EWI
r=0.20

small heat map img

K562
Weissman
CTCF
ENCSR000EGM
r=0.20

small heat map img

K562
Weissman
HDAC6
ENCSR000ATJ
r=0.19

small heat map img

K562
Weissman
TAF1
ENCSR000BKS
r=0.19

small heat map img

K562
Weissman
FOSL1
ENCSR000BMV
r=0.19

small heat map img

K562
Weissman
BRF2
ENCSR000DOC
r=0.19

small heat map img

K562
Weissman
SAP30
ENCSR000AQJ
r=0.18

small heat map img

K562
Weissman
ZNF143
ENCSR000EGP
r=0.18

small heat map img

K562
Weissman
NFYB
ENCSR000EGQ
r=0.18

small heat map img

K562
Weissman
TBP
ENCSR000EHA
r=0.18

small heat map img

K562
Weissman
USF2
ENCSR000EHG
r=0.18

small heat map img

K562
Weissman
CREBBP
ENCSR000ATT
r=0.18

small heat map img

K562
Weissman
NRF1
ENCSR000EHH
r=0.18

small heat map img

K562
Weissman
SP1
ENCSR000BKO
r=0.18

small heat map img

K562
Weissman
ETS1
ENCSR000BKQ
r=0.18

small heat map img

K562
Weissman
RNF2
ENCSR000AUA
r=0.17

small heat map img

K562
Weissman
KDM5B
ENCSR000AQA
r=0.17

small heat map img

K562
Weissman
ATF3
ENCSR000DOG
r=0.17

small heat map img

K562
Weissman
ELF1
ENCSR000BMD
r=0.16

small heat map img

K562
Weissman
TRIM28
ENCSR000EVY
r=0.16

small heat map img

K562
Weissman
CBX3
ENCSR000ATV
r=0.16

small heat map img

K562
Weissman
ATF3
ENCSR000BNU
r=0.15

small heat map img

K562
Weissman
BDP1
ENCSR000DOK
r=0.15

small heat map img

K562
Weissman
CTCF
ENCSR000DMA
r=0.15

small heat map img

K562
Weissman
YY1
ENCSR000BKU
r=0.15

small heat map img

K562
Weissman
XRCC4
ENCSR000FAC
r=0.15

small heat map img

K562
Weissman
CTCF
ENCSR000AKO
r=0.15

small heat map img

K562
Weissman
GTF3C2
ENCSR000DOD
r=0.15

small heat map img

K562
Weissman
WHSC1
ENCSR000AVE
r=0.14

small heat map img

K562
Weissman
CHD4
ENCSR000ATL
r=0.14

small heat map img

K562
Weissman
SETDB1
ENCSR000EWD
r=0.14

small heat map img

K562
Weissman
ZBTB33
ENCSR000BKF
r=0.13

small heat map img

K562
Weissman
RAD21
ENCSR000BKV
r=0.13

small heat map img

K562
Weissman
YY1
ENCSR000EWF
r=0.13

small heat map img

K562
Weissman
CTCF
ENCSR000DWE
r=0.13

small heat map img

K562
Weissman
SUZ12
ENCSR000AUC
r=0.13

small heat map img

K562
Weissman
SIN3A
ENCSR000BLR
r=0.13

small heat map img

K562
Weissman
E2F6
ENCSR000BLI
r=0.12

small heat map img

K562
Weissman
CTCF
ENCSR000BPJ
r=0.12

small heat map img

K562
Weissman
SIRT6
ENCSR000AUB
r=0.12

small heat map img

K562
Weissman
ZNF263
ENCSR000EWN
r=0.12

small heat map img

K562
Weissman
PHF8
ENCSR000AQH
r=0.11

small heat map img

K562
Weissman
REST
ENCSR000ATM
r=0.11

small heat map img

K562
Weissman
POLR3G
ENCSR000EHQ
r=0.11

small heat map img

K562
Weissman
ZBTB7A
ENCSR000BME
r=0.10

small heat map img

K562
Weissman
BRF1
ENCSR000DOJ
r=0.10

small heat map img

K562
Weissman
CTCFL
ENCSR000BNK
r=0.10

small heat map img

K562
Weissman
TAF7
ENCSR000BNM
r=0.09

small heat map img

K562
Weissman
YY1
ENCSR000BMH
r=0.09

small heat map img

K562
Weissman
SIX5
ENCSR000BNW
r=0.09

small heat map img

K562
Weissman
SP2
ENCSR000BNL
r=0.08

small heat map img

K562
Weissman
SIX5
ENCSR000BGX
r=0.08

small heat map img

K562
Weissman
THAP1
ENCSR000BNN
r=0.07

small heat map img

K562
Weissman
CBX8
ENCSR000ATW
r=0.07

small heat map img

K562
Weissman
POLR3A
ENCSR000DOI
r=0.07

small heat map img

K562
Weissman
NR2C2
ENCSR000EWH
r=0.06

small heat map img

K562
Weissman
CBX2
ENCSR000ATU
r=0.05

small heat map img

K562
Weissman
CHD1
ENCSR000AQD
r=0.05

small heat map img

K562
Weissman
ZNF274
ENCSR000EWE
r=0.01

small heat map img
1,476 peaks (download )

K562 - Weissman - ENCSR000FAV

K562
Weissman
STAT1
ENCSR000FAV
r=1.00

small heat map img

K562
Weissman
STAT2
ENCSR000FAT
r=0.90

small heat map img

K562
Weissman
STAT1
ENCSR000FAU
r=0.73

small heat map img

K562
Weissman
STAT1
ENCSR000EHJ
r=0.72

small heat map img

K562
Weissman
STAT1
ENCSR000EHK
r=0.69

small heat map img

K562
Weissman
STAT2
ENCSR000FBC
r=0.67

small heat map img

K562
Weissman
IRF1
ENCSR000EGK
r=0.67

small heat map img

K562
Weissman
IRF1
ENCSR000EGT
r=0.66

small heat map img

K562
Weissman
MYC
ENCSR000EZU
r=0.64

small heat map img

K562
Weissman
MYC
ENCSR000EZV
r=0.63

small heat map img

K562
Weissman
IRF1
ENCSR000EGU
r=0.63

small heat map img

K562
Weissman
IRF1
ENCSR000EGL
r=0.62

small heat map img

K562
Weissman
MYC
ENCSR000FAZ
r=0.62

small heat map img

K562
Weissman
ATF1
ENCSR000DNZ
r=0.62

small heat map img

K562
Weissman
JUN
ENCSR000EGH
r=0.61

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGB
r=0.61

small heat map img

K562
Weissman
JUN
ENCSR000EZT
r=0.60

small heat map img

K562
Weissman
JUN
ENCSR000EZX
r=0.60

small heat map img

K562
Weissman
RCOR1
ENCSR000EGG
r=0.60

small heat map img

K562
Weissman
MYC
ENCSR000EGS
r=0.59

small heat map img

K562
Weissman
JUN
ENCSR000EFS
r=0.58

small heat map img

K562
Weissman
STAT5A
ENCSR000BRR
r=0.58

small heat map img

K562
Weissman
JUND
ENCSR000EGN
r=0.58

small heat map img

K562
Weissman
JUN
ENCSR000EZW
r=0.57

small heat map img

K562
Weissman
JUN
ENCSR000FAH
r=0.56

small heat map img

K562
Weissman
EP300
ENCSR000EGE
r=0.56

small heat map img

K562
Weissman
RCOR1
ENCSR000EGC
r=0.54

small heat map img

K562
Weissman
ARID3A
ENCSR000EFY
r=0.54

small heat map img

K562
Weissman
MYC
ENCSR000FAG
r=0.54

small heat map img

K562
Weissman
ZMIZ1
ENCSR000EFQ
r=0.54

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGA
r=0.53

small heat map img

K562
Weissman
GATA1
ENCSR000EFT
r=0.53

small heat map img

K562
Weissman
MYC
ENCSR000EGJ
r=0.53

small heat map img

K562
Weissman
MXI1
ENCSR000EGZ
r=0.53

small heat map img

K562
Weissman
TRIM28
ENCSR000BRW
r=0.52

small heat map img

K562
Weissman
MAX
ENCSR000EFV
r=0.52

small heat map img

K562
Weissman
FOS
ENCSR000FAI
r=0.52

small heat map img

K562
Weissman
EP300
ENCSR000EGY
r=0.52

small heat map img

K562
Weissman
SIRT6
ENCSR000DOH
r=0.51

small heat map img

K562
Weissman
MAFK
ENCSR000EGX
r=0.51

small heat map img

K562
Weissman
CCNT2
ENCSR000DOA
r=0.50

small heat map img

K562
Weissman
MYC
ENCSR000DLZ
r=0.50

small heat map img

K562
Weissman
CUX1
ENCSR000EFO
r=0.50

small heat map img

K562
Weissman
EP300
ENCSR000AQB
r=0.49

small heat map img

K562
Weissman
BHLHE40
ENCSR000EGV
r=0.49

small heat map img

K562
Weissman
CBX3
ENCSR000BRT
r=0.49

small heat map img

K562
Weissman
NR2F2
ENCSR000BRS
r=0.48

small heat map img

K562
Weissman
GATA2
ENCSR000EWG
r=0.48

small heat map img

K562
Weissman
CEBPD
ENCSR000BVY
r=0.48

small heat map img

K562
Weissman
TEAD4
ENCSR000BRK
r=0.47

small heat map img

K562
Weissman
REST
ENCSR000BMW
r=0.46

small heat map img

K562
Weissman
MAX
ENCSR000FAE
r=0.46

small heat map img

K562
Weissman
UBTF
ENCSR000EFZ
r=0.46

small heat map img

K562
Weissman
GATA2
ENCSR000BKM
r=0.46

small heat map img

K562
Weissman
KDM1A
ENCSR000ATX
r=0.45

small heat map img

K562
Weissman
HMGN3
ENCSR000DOB
r=0.45

small heat map img

K562
Weissman
ELK1
ENCSR000EFU
r=0.45

small heat map img

K562
Weissman
CEBPB
ENCSR000BRQ
r=0.45

small heat map img

K562
Weissman
GATA1
ENCSR000EWM
r=0.45

small heat map img

K562
Weissman
MAFF
ENCSR000EGI
r=0.44

small heat map img

K562
Weissman
NFYA
ENCSR000EGR
r=0.44

small heat map img

K562
Weissman
SMC3
ENCSR000EGW
r=0.44

small heat map img

K562
Weissman
SETDB1
ENCSR000AUT
r=0.43

small heat map img

K562
Weissman
CREB1
ENCSR000BSO
r=0.42

small heat map img

K562
Weissman
TAL1
ENCSR000EHB
r=0.42

small heat map img

K562
Weissman
UBTF
ENCSR000EFW
r=0.42

small heat map img

K562
Weissman
PML
ENCSR000BQY
r=0.42

small heat map img

K562
Weissman
POLR2A
ENCSR000FAY
r=0.42

small heat map img

K562
Weissman
POLR2A
ENCSR000EHL
r=0.42

small heat map img

K562
Weissman
POLR2A
ENCSR000FAX
r=0.41

small heat map img

K562
Weissman
E2F4
ENCSR000EWL
r=0.41

small heat map img

K562
Weissman
SMARCA4
ENCSR000EHO
r=0.40

small heat map img

K562
Weissman
MAX
ENCSR000BLP
r=0.40

small heat map img

K562
Weissman
KAT2B
ENCSR000ATZ
r=0.39

small heat map img

K562
Weissman
EZH2
ENCSR000AQE
r=0.39

small heat map img

K562
Weissman
ZNF384
ENCSR000EFP
r=0.39

small heat map img

K562
Weissman
NFE2
ENCSR000FAF
r=0.39

small heat map img

K562
Weissman
RAD21
ENCSR000FAD
r=0.39

small heat map img

K562
Weissman
BACH1
ENCSR000EGD
r=0.38

small heat map img

K562
Weissman
POLR2A
ENCSR000FAJ
r=0.38

small heat map img

K562
Weissman
NCOR1
ENCSR000ATY
r=0.37

small heat map img

K562
Weissman
ZNF274
ENCSR000EVX
r=0.37

small heat map img

K562
Weissman
POLR2A
ENCSR000FAW
r=0.37

small heat map img

K562
Weissman
POLR2A
ENCSR000EHP
r=0.37

small heat map img

K562
Weissman
CHD7
ENCSR000AVD
r=0.37

small heat map img

K562
Weissman
POLR2A
ENCSR000DLY
r=0.37

small heat map img

K562
Weissman
GABPA
ENCSR000BLO
r=0.36

small heat map img

K562
Weissman
GTF2B
ENCSR000DOE
r=0.36

small heat map img

K562
Weissman
SMARCB1
ENCSR000EHN
r=0.36

small heat map img

K562
Weissman
SRF
ENCSR000BLK
r=0.36

small heat map img

K562
Weissman
HDAC1
ENCSR000AQF
r=0.35

small heat map img

K562
Weissman
HCFC1
ENCSR000EFN
r=0.35

small heat map img

K562
Weissman
POLR2A
ENCSR000BMR
r=0.35

small heat map img

K562
Weissman
USF1
ENCSR000BKT
r=0.35

small heat map img

K562
Weissman
EGR1
ENCSR000BNE
r=0.35

small heat map img

K562
Weissman
MEF2A
ENCSR000BNV
r=0.35

small heat map img

K562
Weissman
ZNF143
ENCSR000EGP
r=0.34

small heat map img

K562
Weissman
HDAC2
ENCSR000BMG
r=0.33

small heat map img

K562
Weissman
CEBPB
ENCSR000EHE
r=0.33

small heat map img

K562
Weissman
HDAC2
ENCSR000AQG
r=0.32

small heat map img

K562
Weissman
RBBP5
ENCSR000AQI
r=0.32

small heat map img

K562
Weissman
SPI1
ENCSR000BGW
r=0.31

small heat map img

K562
Weissman
CTCF
ENCSR000EGM
r=0.31

small heat map img

K562
Weissman
FOSL1
ENCSR000BMV
r=0.31

small heat map img

K562
Weissman
E2F6
ENCSR000EWJ
r=0.30

small heat map img

K562
Weissman
SETDB1
ENCSR000EWI
r=0.30

small heat map img

K562
Weissman
SP1
ENCSR000BKO
r=0.30

small heat map img

K562
Weissman
TAF1
ENCSR000BKS
r=0.30

small heat map img

K562
Weissman
KDM5B
ENCSR000AQA
r=0.30

small heat map img

K562
Weissman
BRF2
ENCSR000DOC
r=0.29

small heat map img

K562
Weissman
TRIM28
ENCSR000EVY
r=0.29

small heat map img

K562
Weissman
ETS1
ENCSR000BKQ
r=0.29

small heat map img

K562
Weissman
TBP
ENCSR000EHA
r=0.28

small heat map img

K562
Weissman
NRF1
ENCSR000EHH
r=0.28

small heat map img

K562
Weissman
HDAC6
ENCSR000ATJ
r=0.28

small heat map img

K562
Weissman
USF2
ENCSR000EHG
r=0.28

small heat map img

K562
Weissman
CREBBP
ENCSR000ATT
r=0.28

small heat map img

K562
Weissman
SAP30
ENCSR000AQJ
r=0.27

small heat map img

K562
Weissman
ATF3
ENCSR000DOG
r=0.27

small heat map img

K562
Weissman
YY1
ENCSR000BKU
r=0.27

small heat map img

K562
Weissman
RFX5
ENCSR000EGO
r=0.26

small heat map img

K562
Weissman
ELF1
ENCSR000BMD
r=0.25

small heat map img

K562
Weissman
ATF3
ENCSR000BNU
r=0.25

small heat map img

K562
Weissman
XRCC4
ENCSR000FAC
r=0.24

small heat map img

K562
Weissman
BDP1
ENCSR000DOK
r=0.24

small heat map img

K562
Weissman
RNF2
ENCSR000AUA
r=0.24

small heat map img

K562
Weissman
YY1
ENCSR000EWF
r=0.24

small heat map img

K562
Weissman
NFYB
ENCSR000EGQ
r=0.23

small heat map img

K562
Weissman
GTF3C2
ENCSR000DOD
r=0.22

small heat map img

K562
Weissman
CTCF
ENCSR000AKO
r=0.22

small heat map img

K562
Weissman
CBX3
ENCSR000ATV
r=0.22

small heat map img

K562
Weissman
CTCF
ENCSR000DMA
r=0.21

small heat map img

K562
Weissman
CHD4
ENCSR000ATL
r=0.21

small heat map img

K562
Weissman
WHSC1
ENCSR000AVE
r=0.21

small heat map img

K562
Weissman
SIRT6
ENCSR000AUB
r=0.21

small heat map img

K562
Weissman
SETDB1
ENCSR000EWD
r=0.21

small heat map img

K562
Weissman
ZBTB33
ENCSR000BKF
r=0.21

small heat map img

K562
Weissman
RAD21
ENCSR000BKV
r=0.20

small heat map img

K562
Weissman
CTCF
ENCSR000BPJ
r=0.19

small heat map img

K562
Weissman
SIN3A
ENCSR000BLR
r=0.19

small heat map img

K562
Weissman
CTCF
ENCSR000DWE
r=0.19

small heat map img

K562
Weissman
POLR3G
ENCSR000EHQ
r=0.18

small heat map img

K562
Weissman
SUZ12
ENCSR000AUC
r=0.18

small heat map img

K562
Weissman
REST
ENCSR000ATM
r=0.17

small heat map img

K562
Weissman
ZBTB7A
ENCSR000BME
r=0.17

small heat map img

K562
Weissman
E2F6
ENCSR000BLI
r=0.17

small heat map img

K562
Weissman
PHF8
ENCSR000AQH
r=0.17

small heat map img

K562
Weissman
BRF1
ENCSR000DOJ
r=0.15

small heat map img

K562
Weissman
ZNF263
ENCSR000EWN
r=0.15

small heat map img

K562
Weissman
TAF7
ENCSR000BNM
r=0.15

small heat map img

K562
Weissman
YY1
ENCSR000BMH
r=0.14

small heat map img

K562
Weissman
SIX5
ENCSR000BNW
r=0.14

small heat map img

K562
Weissman
SIX5
ENCSR000BGX
r=0.13

small heat map img

K562
Weissman
CTCFL
ENCSR000BNK
r=0.13

small heat map img

K562
Weissman
POLR3A
ENCSR000DOI
r=0.12

small heat map img

K562
Weissman
SP2
ENCSR000BNL
r=0.12

small heat map img

K562
Weissman
CHD1
ENCSR000AQD
r=0.11

small heat map img

K562
Weissman
CBX8
ENCSR000ATW
r=0.11

small heat map img

K562
Weissman
THAP1
ENCSR000BNN
r=0.11

small heat map img

K562
Weissman
NR2C2
ENCSR000EWH
r=0.08

small heat map img

K562
Weissman
CBX2
ENCSR000ATU
r=0.05

small heat map img

K562
Weissman
ZNF274
ENCSR000EWE
r=-0.00

small heat map img
1,503 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZM

loading

K562 - Snyder - ENCSR000EHJ

loading

K562 - Snyder - ENCSR000EHK

loading

K562 - Weissman - ENCSR000FAU

loading

K562 - Weissman - ENCSR000FAV

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help