SREBF2

This gene encodes a member of the a ubiquitously expressed transcription factor that controls cholesterol homeostasis by regulating transcription of sterol-regulated genes. The encoded protein contains a basic helix-loop-helix-leucine zipper (bHLH-Zip) domain and binds the sterol regulatory element 1 motif. Alternate splicing results in multiple transcript variants. RefSeq, Jul 2013
Sterol regulatory element-binding protein 2 (SREBP-2) also known as sterol regulatory element binding transcription factor 2 (SREBF2) is a protein that in humans is encoded by the SREBF2 gene.wikipedia

SREBF2

PDB image
PDB 1UKL

PDB 1UKL
ENCODE experiments
Ensemble search
Entrez 6721
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia SREBF2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DYT

loading

HepG2 - Weissman - ENCSR000EZO

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DYT

1.
159 / 500
1.4e-288
TCGGTGGCTCAGTGGTTAAGGC
small heat map img p-value: 0.00
pct_center: 0.41
pct_ratio: 2.56
2.
110 / 500
6.7e-76
AAAAAGAATATCAAAAAGAATTTAAAAAA
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.49
3.
60 / 500
5.7e-56
CAGCCAATCAGAGGGGGCGTCACAGCC
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 1.72
4.
95 / 500
3.7e-53
CCGGAACCGGAAGTG
small heat map img p-value: 0.00
pct_center: 0.38
pct_ratio: 1.23
5.
11 / 500
7.3e-21
GGCCGGGCGCGGTGGCTCACGCCTGTAAT
small heat map img p-value: 0.80
pct_center: 0.26
pct_ratio: 0.51
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Weissman - ENCSR000EZO

1.
60 / 500
1.3e-51
CTGATTGGCTG
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 3.53
2.
67 / 500
7.4e-35
ATGGGGTGAT
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 3.31
3.
5 / 500
19
CATGGGGAGAGGTGGCAGAG
small heat map img p-value: 0.29
pct_center: 0.39
pct_ratio: 0.57
4.
9 / 500
90
GCTTGATCTGATTGG
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 1.90
5.
7 / 500
1.0e+3
CATGGACACGGAGCTTGGAGTGAGCTGA
small heat map img p-value: 0.77
pct_center: 0.17
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at SREBF2 peaks

GM12878 - Snyder - ENCSR000DYT

GM12878
Snyder
SREBF2
ENCSR000DYT
r=1.00

small heat map img

GM12878
Snyder
H2AFZ
ENCSR000AOV
r=0.49

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000AKA
r=0.36

small heat map img

GM12878
Snyder
H3K27ac
ENCSR000AKC
r=0.36

small heat map img

GM12878
Snyder
H3K9ac
ENCSR000AKH
r=0.35

small heat map img

GM12878
Snyder
H3K4me2
ENCSR000AKG
r=0.32

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000DRY
r=0.28

small heat map img

GM12878
Snyder
H3K4me1
ENCSR000AKF
r=0.09

small heat map img

GM12878
Snyder
H3K9me3
ENCSR000AOX
r=0.01

small heat map img

GM12878
Snyder
H3K79me2
ENCSR000AOW
r=-0.02

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000AKD
r=-0.02

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000DRX
r=-0.04

small heat map img

GM12878
Snyder
H4K20me1
ENCSR000AKI
r=-0.06

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000DRW
r=-0.12

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000AKE
r=-0.19

small heat map img
568 peaks (download )

HepG2 - Weissman - ENCSR000EZO

HepG2
Weissman
SREBF2
ENCSR000EZO
r=1.00

small heat map img

HepG2
Weissman
H3K27ac
ENCSR000AMO
r=0.46

small heat map img

HepG2
Weissman
H3K9ac
ENCSR000AMD
r=0.40

small heat map img

HepG2
Weissman
H3K4me3
ENCSR000DUF
r=0.38

small heat map img

HepG2
Weissman
H3K4me3
ENCSR000AMP
r=0.38

small heat map img

HepG2
Weissman
H2AFZ
ENCSR000AOK
r=0.28

small heat map img

HepG2
Weissman
H3K4me2
ENCSR000AMC
r=0.26

small heat map img

HepG2
Weissman
H3K27me3
ENCSR000AOL
r=0.25

small heat map img

HepG2
Weissman
H3K27me3
ENCSR000DUE
r=0.06

small heat map img

HepG2
Weissman
H3K79me2
ENCSR000AOM
r=0.00

small heat map img

HepG2
Weissman
H3K9me3
ENCSR000ATD
r=0.00

small heat map img

HepG2
Weissman
H3K4me1
ENCSR000APV
r=-0.01

small heat map img

HepG2
Weissman
H4K20me1
ENCSR000AMQ
r=-0.07

small heat map img

HepG2
Weissman
H3K36me3
ENCSR000DUD
r=-0.09

small heat map img

HepG2
Weissman
H3K36me3
ENCSR000AMB
r=-0.14

small heat map img
103 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at SREBF2 peaks

GM12878 - Snyder - ENCSR000DYT

GM12878
Snyder
SREBF2
ENCSR000DYT
r=1.00

small heat map img

GM12878
Snyder
TBP
ENCSR000DZZ
r=0.85

small heat map img

GM12878
Snyder
TBL1XR1
ENCSR000DYZ
r=0.72

small heat map img

GM12878
Snyder
POLR3G
ENCSR000EYU
r=0.71

small heat map img

GM12878
Snyder
EP300
ENCSR000DZD
r=0.71

small heat map img

GM12878
Snyder
STAT3
ENCSR000DZV
r=0.62

small heat map img

GM12878
Snyder
RCOR1
ENCSR000DZC
r=0.61

small heat map img

GM12878
Snyder
SREBF1
ENCSR000DYU
r=0.58

small heat map img

GM12878
Snyder
RELA
ENCSR000EAG
r=0.58

small heat map img

GM12878
Snyder
ESRRA
ENCSR000DYQ
r=0.57

small heat map img

GM12878
Snyder
STAT1
ENCSR000DZM
r=0.55

small heat map img

GM12878
Snyder
MAFK
ENCSR000DYV
r=0.54

small heat map img

GM12878
Snyder
RUNX3
ENCSR000BRI
r=0.54

small heat map img

GM12878
Snyder
BRCA1
ENCSR000DZS
r=0.54

small heat map img

GM12878
Snyder
CUX1
ENCSR000DYR
r=0.53

small heat map img

GM12878
Snyder
WRNIP1
ENCSR000EAA
r=0.52

small heat map img

GM12878
Snyder
EP300
ENCSR000DZG
r=0.49

small heat map img

GM12878
Snyder
IRF3
ENCSR000DZX
r=0.49

small heat map img

GM12878
Snyder
FOS
ENCSR000EYZ
r=0.48

small heat map img

GM12878
Snyder
CEBPB
ENCSR000BRX
r=0.47

small heat map img

GM12878
Snyder
SMC3
ENCSR000DZP
r=0.47

small heat map img

GM12878
Snyder
ELK1
ENCSR000DZB
r=0.47

small heat map img

GM12878
Snyder
NFIC
ENCSR000BRN
r=0.44

small heat map img

GM12878
Snyder
ATF2
ENCSR000BQK
r=0.44

small heat map img

GM12878
Snyder
MAX
ENCSR000DZF
r=0.43

small heat map img

GM12878
Snyder
NFE2
ENCSR000DZY
r=0.43

small heat map img

GM12878
Snyder
ETS1
ENCSR000BKA
r=0.42

small heat map img

GM12878
Snyder
E2F4
ENCSR000DYY
r=0.42

small heat map img

GM12878
Snyder
ZNF384
ENCSR000DYP
r=0.42

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHD
r=0.41

small heat map img

GM12878
Snyder
BHLHE40
ENCSR000DZJ
r=0.40

small heat map img

GM12878
Snyder
FOXM1
ENCSR000BRU
r=0.40

small heat map img

GM12878
Snyder
RAD21
ENCSR000EAC
r=0.40

small heat map img

GM12878
Snyder
CHD1
ENCSR000DZE
r=0.39

small heat map img

GM12878
Snyder
JUND
ENCSR000DYS
r=0.39

small heat map img

GM12878
Snyder
RFX5
ENCSR000DZW
r=0.38

small heat map img

GM12878
Snyder
SP1
ENCSR000BHK
r=0.38

small heat map img

GM12878
Snyder
NRF1
ENCSR000DZO
r=0.36

small heat map img

GM12878
Snyder
POU2F2
ENCSR000BGP
r=0.36

small heat map img

GM12878
Snyder
JUND
ENCSR000EYV
r=0.35

small heat map img

GM12878
Snyder
CREB1
ENCSR000BUF
r=0.35

small heat map img

GM12878
Snyder
PML
ENCSR000BQM
r=0.34

small heat map img

GM12878
Snyder
STAT5A
ENCSR000BQZ
r=0.34

small heat map img

GM12878
Snyder
ELF1
ENCSR000BMB
r=0.34

small heat map img

GM12878
Snyder
IKZF1
ENCSR000EUJ
r=0.34

small heat map img

GM12878
Snyder
EP300
ENCSR000BHB
r=0.33

small heat map img

GM12878
Snyder
SIN3A
ENCSR000DYX
r=0.32

small heat map img

GM12878
Snyder
IRF4
ENCSR000BGY
r=0.30

small heat map img

GM12878
Snyder
MEF2A
ENCSR000BKB
r=0.30

small heat map img

GM12878
Snyder
YY1
ENCSR000BNP
r=0.30

small heat map img

GM12878
Snyder
USF2
ENCSR000DZU
r=0.30

small heat map img

GM12878
Snyder
MXI1
ENCSR000DZI
r=0.30

small heat map img

GM12878
Snyder
RXRA
ENCSR000BJD
r=0.28

small heat map img

GM12878
Snyder
EBF1
ENCSR000DZQ
r=0.27

small heat map img

GM12878
Snyder
BATF
ENCSR000BGT
r=0.27

small heat map img

GM12878
Snyder
NFYA
ENCSR000DNN
r=0.27

small heat map img

GM12878
Snyder
SUPT20H
ENCSR000DNP
r=0.27

small heat map img

GM12878
Snyder
EZH2
ENCSR000ARD
r=0.27

small heat map img

GM12878
Snyder
TCF12
ENCSR000BGZ
r=0.26

small heat map img

GM12878
Snyder
NFATC1
ENCSR000BQL
r=0.26

small heat map img

GM12878
Snyder
MTA3
ENCSR000BRH
r=0.24

small heat map img

GM12878
Snyder
YY1
ENCSR000EUM
r=0.23

small heat map img

GM12878
Snyder
MYC
ENCSR000DKU
r=0.23

small heat map img

GM12878
Snyder
ZBTB33
ENCSR000BHC
r=0.23

small heat map img

GM12878
Snyder
NFYB
ENCSR000DNM
r=0.23

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHJ
r=0.22

small heat map img

GM12878
Snyder
SRF
ENCSR000BMI
r=0.22

small heat map img

GM12878
Snyder
ZNF143
ENCSR000DZL
r=0.21

small heat map img

GM12878
Snyder
EBF1
ENCSR000BGU
r=0.21

small heat map img

GM12878
Snyder
EGR1
ENCSR000BRG
r=0.21

small heat map img

GM12878
Snyder
PBX3
ENCSR000BGR
r=0.20

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EAD
r=0.19

small heat map img

GM12878
Snyder
KAT2A
ENCSR000DNO
r=0.19

small heat map img

GM12878
Snyder
BCL3
ENCSR000BNQ
r=0.19

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EYW
r=0.19

small heat map img

GM12878
Snyder
SIX5
ENCSR000BJE
r=0.19

small heat map img

GM12878
Snyder
BCL11A
ENCSR000BHA
r=0.19

small heat map img

GM12878
Snyder
EGR1
ENCSR000BMQ
r=0.18

small heat map img

GM12878
Snyder
USF1
ENCSR000BGI
r=0.17

small heat map img

GM12878
Snyder
TCF3
ENCSR000BQT
r=0.17

small heat map img

GM12878
Snyder
POLR2A
ENCSR000DKT
r=0.17

small heat map img

GM12878
Snyder
CTCF
ENCSR000DZN
r=0.17

small heat map img

GM12878
Snyder
SPI1
ENCSR000BGQ
r=0.16

small heat map img

GM12878
Snyder
TAF1
ENCSR000BGS
r=0.16

small heat map img

GM12878
Snyder
MEF2C
ENCSR000BNG
r=0.14

small heat map img

GM12878
Snyder
SRF
ENCSR000BGE
r=0.14

small heat map img

GM12878
Snyder
REST
ENCSR000BGF
r=0.14

small heat map img

GM12878
Snyder
CTCF
ENCSR000DKV
r=0.12

small heat map img

GM12878
Snyder
ZEB1
ENCSR000BND
r=0.12

small heat map img

GM12878
Snyder
GABPA
ENCSR000BGC
r=0.12

small heat map img

GM12878
Snyder
CTCF
ENCSR000AKB
r=0.11

small heat map img

GM12878
Snyder
POLR2A
ENCSR000BGD
r=0.11

small heat map img

GM12878
Snyder
ATF3
ENCSR000BJY
r=0.11

small heat map img

GM12878
Snyder
NR2C2
ENCSR000EUL
r=0.10

small heat map img

GM12878
Snyder
ZZZ3
ENCSR000DNQ
r=0.10

small heat map img

GM12878
Snyder
CTCF
ENCSR000DRZ
r=0.09

small heat map img

GM12878
Snyder
REST
ENCSR000BQS
r=0.07

small heat map img

GM12878
Snyder
RAD21
ENCSR000BMY
r=0.07

small heat map img

GM12878
Snyder
ZNF274
ENCSR000EUK
r=-0.02

small heat map img
568 peaks (download )

HepG2 - Weissman - ENCSR000EZO

HepG2
Weissman
SREBF2
ENCSR000EZO
r=1.00

small heat map img

HepG2
Weissman
SREBF1
ENCSR000EZP
r=0.90

small heat map img

HepG2
Weissman
SREBF1
ENCSR000EEO
r=0.84

small heat map img

HepG2
Weissman
FOSL2
ENCSR000BHP
r=0.72

small heat map img

HepG2
Weissman
SP1
ENCSR000BJX
r=0.71

small heat map img

HepG2
Weissman
CREB1
ENCSR000BVL
r=0.61

small heat map img

HepG2
Weissman
REST
ENCSR000BJL
r=0.56

small heat map img

HepG2
Weissman
REST
ENCSR000BOT
r=0.52

small heat map img

HepG2
Weissman
EP300
ENCSR000EDV
r=0.50

small heat map img

HepG2
Weissman
MXI1
ENCSR000EDU
r=0.48

small heat map img

HepG2
Weissman
EP300
ENCSR000BLW
r=0.47

small heat map img

HepG2
Weissman
ARID3A
ENCSR000EDP
r=0.46

small heat map img

HepG2
Weissman
MAX
ENCSR000EDS
r=0.45

small heat map img

HepG2
Weissman
HNF4A
ENCSR000EEU
r=0.45

small heat map img

HepG2
Weissman
RCOR1
ENCSR000EDQ
r=0.43

small heat map img

HepG2
Weissman
RFX5
ENCSR000EEA
r=0.43

small heat map img

HepG2
Weissman
BHLHE40
ENCSR000EDT
r=0.42

small heat map img

HepG2
Weissman
IRF3
ENCSR000EEJ
r=0.41

small heat map img

HepG2
Weissman
MAX
ENCSR000BTM
r=0.40

small heat map img

HepG2
Weissman
JUND
ENCSR000EEI
r=0.40

small heat map img

HepG2
Weissman
MYC
ENCSR000DLR
r=0.40

small heat map img

HepG2
Weissman
CEBPB
ENCSR000EEX
r=0.39

small heat map img

HepG2
Weissman
SIN3A
ENCSR000BGL
r=0.39

small heat map img

HepG2
Weissman
NR2F2
ENCSR000BVM
r=0.38

small heat map img

HepG2
Weissman
MAFF
ENCSR000EEC
r=0.38

small heat map img

HepG2
Weissman
HSF1
ENCSR000EET
r=0.38

small heat map img

HepG2
Weissman
JUND
ENCSR000BGK
r=0.37

small heat map img

HepG2
Weissman
TCF12
ENCSR000BJG
r=0.37

small heat map img

HepG2
Weissman
NR3C1
ENCSR000EEV
r=0.37

small heat map img

HepG2
Weissman
BRCA1
ENCSR000EDY
r=0.36

small heat map img

HepG2
Weissman
ELF1
ENCSR000BMZ
r=0.36

small heat map img

HepG2
Weissman
ESRRA
ENCSR000EEW
r=0.35

small heat map img

HepG2
Weissman
MAFK
ENCSR000EEB
r=0.35

small heat map img

HepG2
Weissman
ZEB1
ENCSR000BVN
r=0.34

small heat map img

HepG2
Weissman
TAF1
ENCSR000BJN
r=0.34

small heat map img

HepG2
Weissman
CEBPB
ENCSR000EEE
r=0.34

small heat map img

HepG2
Weissman
JUN
ENCSR000EEK
r=0.34

small heat map img

HepG2
Weissman
MYBL2
ENCSR000BRO
r=0.33

small heat map img

HepG2
Weissman
USF2
ENCSR000EEF
r=0.33

small heat map img

HepG2
Weissman
HNF4G
ENCSR000BNJ
r=0.32

small heat map img

HepG2
Weissman
NR2C2
ENCSR000EVS
r=0.32

small heat map img

HepG2
Weissman
MAFK
ENCSR000EDZ
r=0.31

small heat map img

HepG2
Weissman
YY1
ENCSR000BNT
r=0.31

small heat map img

HepG2
Weissman
TBP
ENCSR000EEL
r=0.30

small heat map img

HepG2
Weissman
POLR2A
ENCSR000EEP
r=0.30

small heat map img

HepG2
Weissman
POLR2A
ENCSR000EZQ
r=0.29

small heat map img

HepG2
Weissman
HDAC2
ENCSR000BMC
r=0.29

small heat map img

HepG2
Weissman
NFIC
ENCSR000BQX
r=0.28

small heat map img

HepG2
Weissman
POLR2A
ENCSR000BJM
r=0.28

small heat map img

HepG2
Weissman
SMC3
ENCSR000EDW
r=0.28

small heat map img

HepG2
Weissman
CEBPD
ENCSR000BQJ
r=0.28

small heat map img

HepG2
Weissman
HNF4A
ENCSR000BLF
r=0.26

small heat map img

HepG2
Weissman
GABPA
ENCSR000BJK
r=0.26

small heat map img

HepG2
Weissman
FOXA1
ENCSR000BMO
r=0.26

small heat map img

HepG2
Weissman
FOXA1
ENCSR000BLE
r=0.26

small heat map img

HepG2
Weissman
POLR2A
ENCSR000DLQ
r=0.25

small heat map img

HepG2
Weissman
POLR2A
ENCSR000EEM
r=0.25

small heat map img

HepG2
Weissman
SP2
ENCSR000BOU
r=0.25

small heat map img

HepG2
Weissman
USF1
ENCSR000BGM
r=0.25

small heat map img

HepG2
Weissman
RAD21
ENCSR000EEG
r=0.24

small heat map img

HepG2
Weissman
TEAD4
ENCSR000BRP
r=0.24

small heat map img

HepG2
Weissman
CEBPB
ENCSR000BQI
r=0.21

small heat map img

HepG2
Weissman
MBD4
ENCSR000BQW
r=0.21

small heat map img

HepG2
Weissman
NRF1
ENCSR000EEH
r=0.20

small heat map img

HepG2
Weissman
SRF
ENCSR000BLV
r=0.20

small heat map img

HepG2
Weissman
BHLHE40
ENCSR000BID
r=0.19

small heat map img

HepG2
Weissman
ZBTB33
ENCSR000BHR
r=0.19

small heat map img

HepG2
Weissman
ATF3
ENCSR000BKE
r=0.18

small heat map img

HepG2
Weissman
RXRA
ENCSR000BHU
r=0.18

small heat map img

HepG2
Weissman
RAD21
ENCSR000BLS
r=0.16

small heat map img

HepG2
Weissman
CTCF
ENCSR000BIE
r=0.15

small heat map img

HepG2
Weissman
ZBTB33
ENCSR000BNA
r=0.15

small heat map img

HepG2
Weissman
ZBTB7A
ENCSR000BQA
r=0.15

small heat map img

HepG2
Weissman
TCF7L2
ENCSR000EVQ
r=0.14

small heat map img

HepG2
Weissman
CTCF
ENCSR000DLS
r=0.13

small heat map img

HepG2
Weissman
CTCF
ENCSR000DUG
r=0.12

small heat map img

HepG2
Weissman
CTCF
ENCSR000AMA
r=0.12

small heat map img

HepG2
Weissman
FOXA2
ENCSR000BNI
r=0.11

small heat map img

HepG2
Weissman
EZH2
ENCSR000ARI
r=0.04

small heat map img

HepG2
Weissman
ZNF274
ENCSR000EVR
r=-0.06

small heat map img
103 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DYT

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help