SP2

This gene encodes a member of the Sp subfamily of Sp/XKLF transcription factors. Sp family proteins are sequence-specific DNA-binding proteins characterized by an amino-terminal trans-activation domain and three carboxy-terminal zinc finger motifs. This protein contains the least conserved DNA-binding domain within the Sp subfamily of proteins, and its DNA sequence specificity differs from the other Sp proteins. It localizes primarily within subnuclear foci associated with the nuclear matrix, and can activate or in some cases repress expression from different promoters. RefSeq, Jul 2008
Transcription factor Sp2 is a protein that in humans is encoded by the SP2 gene.wikipedia

SP2


ENCODE experiments
Ensemble search
Entrez 6668
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia Sp2_transcription_factor

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

H1-hESC - Myers - ENCSR000BQG

loading

HepG2 - Myers - ENCSR000BOU

loading

K562 - Myers - ENCSR000BNL

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

H1-hESC - Myers - ENCSR000BQG

1.
262 / 500
3.2e-288
TTCTGATTGGCTAA
small heat map img p-value: 0.00
pct_center: 0.57
pct_ratio: 3.51
2.
165 / 500
9.4e-182
GGGGCCGCTCTAGGC
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.77
3.
111 / 500
5.0e-154
CGATTGGCTAGTGCGGCTGTCAATCA
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 2.36
4.
88 / 500
2.7e-84
AACCATAGAGA
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.77
5.
105 / 500
1.6e-18
GGGGGCGGGGC
small heat map img p-value: 0.00
pct_center: 0.77
pct_ratio: 0.76
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Myers - ENCSR000BOU

1.
340 / 500
8.0e-1563
GGCGCTGTCCATGGTGCTGAA
small heat map img p-value: 0.00
pct_center: 0.55
pct_ratio: 2.34
2.
119 / 500
6.9e-150
GGGAGCTGTCCA
small heat map img p-value: 0.00
pct_center: 0.52
pct_ratio: 2.01
3.
86 / 500
8.9e-87
GTGGTGCTGAA
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 2.19
4.
50 / 500
8.0e-8
AGAGGAAAGGAAAGC
small heat map img p-value: 0.81
pct_center: 0.30
pct_ratio: 0.49
5.
36 / 500
0.0015
AGGGGGCTAGAGCGGCCCC
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.79
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Myers - ENCSR000BNL

1.
375 / 500
1.1e-232
GGCCAATGAGA
small heat map img p-value: 0.00
pct_center: 0.45
pct_ratio: 2.47
2.
181 / 500
6.9e-218
GGGGCCGCTCTAGGC
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.69
3.
73 / 500
4.5e-90
ATTGGCTGGGGGGGCTGTCCGTCA
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 1.40
4.
136 / 500
9.3e-24
GGGGGGCGGGGCCTC
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 0.78
5.
24 / 500
3.3e-22
CCCCCCGGCCGCCAGGGGGCGCTGTGGG
small heat map img p-value: 0.00
pct_center: 0.63
pct_ratio: 0.67
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at SP2 peaks

H1-hESC - Myers - ENCSR000BQG

H1-hESC
Myers
SP2
ENCSR000BQG
r=1.00

small heat map img

H1-hESC
Myers
H3K4me3
ENCSR000AMG
r=0.43

small heat map img

H1-hESC
Myers
H3K9ac
ENCSR000AND
r=0.42

small heat map img

H1-hESC
Myers
H3K27ac
ENCSR000ANP
r=0.40

small heat map img

H1-hESC
Myers
H3K4me2
ENCSR000ANC
r=0.37

small heat map img

H1-hESC
Myers
H2AFZ
ENCSR000APX
r=0.37

small heat map img

H1-hESC
Myers
H3K4me1
ENCSR000ANA
r=0.09

small heat map img

H1-hESC
Myers
H3K79me2
ENCSR000APY
r=-0.03

small heat map img

H1-hESC
Myers
H3K9me3
ENCSR000APZ
r=-0.03

small heat map img

H1-hESC
Myers
H3K27me3
ENCSR000ALU
r=-0.04

small heat map img

H1-hESC
Myers
H4K20me1
ENCSR000AMH
r=-0.05

small heat map img

H1-hESC
Myers
H3K36me3
ENCSR000ANB
r=-0.12

small heat map img
2,469 peaks (download )

HepG2 - Myers - ENCSR000BOU

HepG2
Myers
SP2
ENCSR000BOU
r=1.00

small heat map img

HepG2
Myers
H3K4me3
ENCSR000AMP
r=0.48

small heat map img

HepG2
Myers
H3K4me3
ENCSR000DUF
r=0.48

small heat map img

HepG2
Myers
H3K9ac
ENCSR000AMD
r=0.47

small heat map img

HepG2
Myers
H3K27ac
ENCSR000AMO
r=0.44

small heat map img

HepG2
Myers
H3K4me2
ENCSR000AMC
r=0.38

small heat map img

HepG2
Myers
H2AFZ
ENCSR000AOK
r=0.36

small heat map img

HepG2
Myers
H3K79me2
ENCSR000AOM
r=0.19

small heat map img

HepG2
Myers
H3K27me3
ENCSR000AOL
r=0.16

small heat map img

HepG2
Myers
H3K4me1
ENCSR000APV
r=0.10

small heat map img

HepG2
Myers
H3K36me3
ENCSR000DUD
r=0.03

small heat map img

HepG2
Myers
H3K36me3
ENCSR000AMB
r=0.00

small heat map img

HepG2
Myers
H3K27me3
ENCSR000DUE
r=-0.00

small heat map img

HepG2
Myers
H4K20me1
ENCSR000AMQ
r=-0.02

small heat map img

HepG2
Myers
H3K9me3
ENCSR000ATD
r=-0.03

small heat map img
2,626 peaks (download )

K562 - Myers - ENCSR000BNL

K562
Myers
SP2
ENCSR000BNL
r=1.00

small heat map img

K562
Myers
H2AFZ
ENCSR000APC
r=0.40

small heat map img

K562
Myers
H3K4me3
ENCSR000EWA
r=0.39

small heat map img

K562
Myers
H3K4me3
ENCSR000DWD
r=0.37

small heat map img

K562
Myers
H3K9ac
ENCSR000EVZ
r=0.37

small heat map img

K562
Myers
H3K4me3
ENCSR000AKU
r=0.36

small heat map img

K562
Myers
H3K4me2
ENCSR000AKT
r=0.35

small heat map img

K562
Myers
H3K9ac
ENCSR000AKV
r=0.35

small heat map img

K562
Myers
H3K27ac
ENCSR000AKP
r=0.35

small heat map img

K562
Myers
H3K4me1
ENCSR000EWC
r=0.12

small heat map img

K562
Myers
H3K79me2
ENCSR000APD
r=0.07

small heat map img

K562
Myers
H4K20me1
ENCSR000AKX
r=-0.01

small heat map img

K562
Myers
H3K27me3
ENCSR000DWC
r=-0.01

small heat map img

K562
Myers
H3K9me3
ENCSR000APE
r=-0.02

small heat map img

K562
Myers
H3K27me3
ENCSR000AKQ
r=-0.03

small heat map img

K562
Myers
H3K4me1
ENCSR000AKS
r=-0.03

small heat map img

K562
Myers
H3K9me1
ENCSR000AKW
r=-0.04

small heat map img

K562
Myers
H3K27me3
ENCSR000EWB
r=-0.06

small heat map img

K562
Myers
H3K36me3
ENCSR000DWB
r=-0.10

small heat map img

K562
Myers
H3K36me3
ENCSR000AKR
r=-0.11

small heat map img
3,124 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at SP2 peaks

H1-hESC - Myers - ENCSR000BQG

H1-hESC
Myers
SP2
ENCSR000BQG
r=1.00

small heat map img

H1-hESC
Myers
SP1
ENCSR000BIR
r=0.66

small heat map img

H1-hESC
Myers
MXI1
ENCSR000EBR
r=0.45

small heat map img

H1-hESC
Myers
CREB1
ENCSR000BSN
r=0.44

small heat map img

H1-hESC
Myers
ZNF143
ENCSR000EBW
r=0.44

small heat map img

H1-hESC
Myers
JUND
ENCSR000EBZ
r=0.38

small heat map img

H1-hESC
Myers
TBP
ENCSR000ECB
r=0.36

small heat map img

H1-hESC
Myers
GABPA
ENCSR000BIW
r=0.35

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000EBO
r=0.35

small heat map img

H1-hESC
Myers
SP4
ENCSR000BQV
r=0.34

small heat map img

H1-hESC
Myers
TAF1
ENCSR000BHO
r=0.34

small heat map img

H1-hESC
Myers
MYC
ENCSR000EBY
r=0.33

small heat map img

H1-hESC
Myers
MAX
ENCSR000EUP
r=0.31

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000DLJ
r=0.31

small heat map img

H1-hESC
Myers
TEAD4
ENCSR000BRY
r=0.30

small heat map img

H1-hESC
Myers
MAX
ENCSR000BSJ
r=0.29

small heat map img

H1-hESC
Myers
CEBPB
ENCSR000EBV
r=0.29

small heat map img

H1-hESC
Myers
BRCA1
ENCSR000EBX
r=0.29

small heat map img

H1-hESC
Myers
EGR1
ENCSR000BJA
r=0.27

small heat map img

H1-hESC
Myers
CTBP2
ENCSR000EUO
r=0.27

small heat map img

H1-hESC
Myers
JUN
ENCSR000ECA
r=0.26

small heat map img

H1-hESC
Myers
E2F6
ENCSR000BSI
r=0.26

small heat map img

H1-hESC
Myers
YY1
ENCSR000BKD
r=0.25

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000BHN
r=0.25

small heat map img

H1-hESC
Myers
EP300
ENCSR000AUQ
r=0.24

small heat map img

H1-hESC
Myers
RAD21
ENCSR000ECE
r=0.23

small heat map img

H1-hESC
Myers
USF2
ENCSR000ECD
r=0.23

small heat map img

H1-hESC
Myers
ATF2
ENCSR000BQU
r=0.23

small heat map img

H1-hESC
Myers
MAFK
ENCSR000EBS
r=0.22

small heat map img

H1-hESC
Myers
CTCF
ENCSR000AMF
r=0.22

small heat map img

H1-hESC
Myers
CHD7
ENCSR000AVA
r=0.22

small heat map img

H1-hESC
Myers
RFX5
ENCSR000ECF
r=0.22

small heat map img

H1-hESC
Myers
BACH1
ENCSR000EBQ
r=0.22

small heat map img

H1-hESC
Myers
CTCF
ENCSR000BNH
r=0.22

small heat map img

H1-hESC
Myers
NRF1
ENCSR000ECC
r=0.21

small heat map img

H1-hESC
Myers
MYC
ENCSR000DLI
r=0.21

small heat map img

H1-hESC
Myers
CTCF
ENCSR000DLK
r=0.20

small heat map img

H1-hESC
Myers
KDM5A
ENCSR000AQL
r=0.20

small heat map img

H1-hESC
Myers
RBBP5
ENCSR000AQC
r=0.19

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000BIS
r=0.17

small heat map img

H1-hESC
Myers
USF1
ENCSR000BIU
r=0.17

small heat map img

H1-hESC
Myers
SIX5
ENCSR000BIQ
r=0.17

small heat map img

H1-hESC
Myers
SIRT6
ENCSR000AUS
r=0.16

small heat map img

H1-hESC
Myers
HDAC6
ENCSR000ATQ
r=0.16

small heat map img

H1-hESC
Myers
RAD21
ENCSR000BLD
r=0.15

small heat map img

H1-hESC
Myers
JUND
ENCSR000BKP
r=0.15

small heat map img

H1-hESC
Myers
TAF7
ENCSR000BLU
r=0.15

small heat map img

H1-hESC
Myers
SRF
ENCSR000BIV
r=0.14

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000AVB
r=0.13

small heat map img

H1-hESC
Myers
PHF8
ENCSR000ATK
r=0.13

small heat map img

H1-hESC
Myers
FOSL1
ENCSR000BNS
r=0.13

small heat map img

H1-hESC
Myers
TCF12
ENCSR000BIT
r=0.12

small heat map img

H1-hESC
Myers
EP300
ENCSR000BKK
r=0.11

small heat map img

H1-hESC
Myers
NANOG
ENCSR000BMT
r=0.11

small heat map img

H1-hESC
Myers
ATF3
ENCSR000BKC
r=0.10

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000ATS
r=0.10

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000BNR
r=0.08

small heat map img

H1-hESC
Myers
KDM4A
ENCSR000AVC
r=0.08

small heat map img

H1-hESC
Myers
SAP30
ENCSR000ATR
r=0.07

small heat map img

H1-hESC
Myers
RXRA
ENCSR000BJW
r=0.07

small heat map img

H1-hESC
Myers
CHD1
ENCSR000EBU
r=0.07

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BMJ
r=0.06

small heat map img

H1-hESC
Myers
REST
ENCSR000BHM
r=0.05

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BIP
r=0.05

small heat map img

H1-hESC
Myers
KDM5B
ENCSR000AUR
r=0.01

small heat map img

H1-hESC
Myers
EZH2
ENCSR000ASY
r=-0.00

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000EUQ
r=-0.02

small heat map img

H1-hESC
Myers
ZNF274
ENCSR000EUN
r=-0.03

small heat map img

H1-hESC
Myers
CHD1
ENCSR000AQK
r=-0.05

small heat map img
2,469 peaks (download )

HepG2 - Myers - ENCSR000BOU

HepG2
Myers
SP2
ENCSR000BOU
r=1.00

small heat map img

HepG2
Myers
SP1
ENCSR000BJX
r=0.66

small heat map img

HepG2
Myers
CREB1
ENCSR000BVL
r=0.63

small heat map img

HepG2
Myers
SREBF1
ENCSR000EEO
r=0.60

small heat map img

HepG2
Myers
ELF1
ENCSR000BMZ
r=0.55

small heat map img

HepG2
Myers
MXI1
ENCSR000EDU
r=0.52

small heat map img

HepG2
Myers
ARID3A
ENCSR000EDP
r=0.49

small heat map img

HepG2
Myers
MAX
ENCSR000BTM
r=0.48

small heat map img

HepG2
Myers
RFX5
ENCSR000EEA
r=0.48

small heat map img

HepG2
Myers
MAX
ENCSR000EDS
r=0.48

small heat map img

HepG2
Myers
NR2F2
ENCSR000BVM
r=0.47

small heat map img

HepG2
Myers
IRF3
ENCSR000EEJ
r=0.46

small heat map img

HepG2
Myers
ZEB1
ENCSR000BVN
r=0.46

small heat map img

HepG2
Myers
EP300
ENCSR000EDV
r=0.46

small heat map img

HepG2
Myers
TBP
ENCSR000EEL
r=0.44

small heat map img

HepG2
Myers
MYC
ENCSR000DLR
r=0.44

small heat map img

HepG2
Myers
POLR2A
ENCSR000DLQ
r=0.43

small heat map img

HepG2
Myers
YY1
ENCSR000BNT
r=0.43

small heat map img

HepG2
Myers
BRCA1
ENCSR000EDY
r=0.42

small heat map img

HepG2
Myers
HNF4A
ENCSR000EEU
r=0.42

small heat map img

HepG2
Myers
BHLHE40
ENCSR000EDT
r=0.42

small heat map img

HepG2
Myers
HSF1
ENCSR000EET
r=0.41

small heat map img

HepG2
Myers
CEBPB
ENCSR000EEX
r=0.41

small heat map img

HepG2
Myers
MAFF
ENCSR000EEC
r=0.40

small heat map img

HepG2
Myers
RCOR1
ENCSR000EDQ
r=0.40

small heat map img

HepG2
Myers
TAF1
ENCSR000BJN
r=0.39

small heat map img

HepG2
Myers
MYBL2
ENCSR000BRO
r=0.38

small heat map img

HepG2
Myers
MAFK
ENCSR000EEB
r=0.38

small heat map img

HepG2
Myers
NR2C2
ENCSR000EVS
r=0.38

small heat map img

HepG2
Myers
MAFK
ENCSR000EDZ
r=0.37

small heat map img

HepG2
Myers
NFIC
ENCSR000BQX
r=0.37

small heat map img

HepG2
Myers
POLR2A
ENCSR000EEP
r=0.37

small heat map img

HepG2
Myers
SREBF1
ENCSR000EZP
r=0.35

small heat map img

HepG2
Myers
ESRRA
ENCSR000EEW
r=0.35

small heat map img

HepG2
Myers
SREBF2
ENCSR000EZO
r=0.35

small heat map img

HepG2
Myers
CEBPB
ENCSR000EEE
r=0.35

small heat map img

HepG2
Myers
JUND
ENCSR000EEI
r=0.33

small heat map img

HepG2
Myers
POLR2A
ENCSR000BJM
r=0.32

small heat map img

HepG2
Myers
USF2
ENCSR000EEF
r=0.32

small heat map img

HepG2
Myers
SMC3
ENCSR000EDW
r=0.32

small heat map img

HepG2
Myers
SIN3A
ENCSR000BGL
r=0.31

small heat map img

HepG2
Myers
HDAC2
ENCSR000BMC
r=0.30

small heat map img

HepG2
Myers
JUND
ENCSR000BGK
r=0.30

small heat map img

HepG2
Myers
NR3C1
ENCSR000EEV
r=0.30

small heat map img

HepG2
Myers
HNF4G
ENCSR000BNJ
r=0.29

small heat map img

HepG2
Myers
TCF12
ENCSR000BJG
r=0.29

small heat map img

HepG2
Myers
FOSL2
ENCSR000BHP
r=0.29

small heat map img

HepG2
Myers
POLR2A
ENCSR000EEM
r=0.29

small heat map img

HepG2
Myers
TEAD4
ENCSR000BRP
r=0.28

small heat map img

HepG2
Myers
CEBPD
ENCSR000BQJ
r=0.27

small heat map img

HepG2
Myers
MBD4
ENCSR000BQW
r=0.26

small heat map img

HepG2
Myers
RAD21
ENCSR000EEG
r=0.26

small heat map img

HepG2
Myers
EP300
ENCSR000BLW
r=0.25

small heat map img

HepG2
Myers
FOXA1
ENCSR000BLE
r=0.23

small heat map img

HepG2
Myers
USF1
ENCSR000BGM
r=0.23

small heat map img

HepG2
Myers
SRF
ENCSR000BLV
r=0.22

small heat map img

HepG2
Myers
POLR2A
ENCSR000EZQ
r=0.21

small heat map img

HepG2
Myers
CTCF
ENCSR000DUG
r=0.21

small heat map img

HepG2
Myers
CTCF
ENCSR000AMA
r=0.20

small heat map img

HepG2
Myers
CTCF
ENCSR000BIE
r=0.20

small heat map img

HepG2
Myers
RAD21
ENCSR000BLS
r=0.19

small heat map img

HepG2
Myers
CTCF
ENCSR000DLS
r=0.19

small heat map img

HepG2
Myers
JUN
ENCSR000EEK
r=0.19

small heat map img

HepG2
Myers
HNF4A
ENCSR000BLF
r=0.19

small heat map img

HepG2
Myers
FOXA1
ENCSR000BMO
r=0.18

small heat map img

HepG2
Myers
NRF1
ENCSR000EEH
r=0.16

small heat map img

HepG2
Myers
ZBTB7A
ENCSR000BQA
r=0.15

small heat map img

HepG2
Myers
RXRA
ENCSR000BHU
r=0.15

small heat map img

HepG2
Myers
BHLHE40
ENCSR000BID
r=0.13

small heat map img

HepG2
Myers
ZBTB33
ENCSR000BNA
r=0.13

small heat map img

HepG2
Myers
ATF3
ENCSR000BKE
r=0.13

small heat map img

HepG2
Myers
ZBTB33
ENCSR000BHR
r=0.12

small heat map img

HepG2
Myers
CEBPB
ENCSR000BQI
r=0.11

small heat map img

HepG2
Myers
GABPA
ENCSR000BJK
r=0.10

small heat map img

HepG2
Myers
FOXA2
ENCSR000BNI
r=0.07

small heat map img

HepG2
Myers
TCF7L2
ENCSR000EVQ
r=0.01

small heat map img

HepG2
Myers
EZH2
ENCSR000ARI
r=0.01

small heat map img

HepG2
Myers
ZNF274
ENCSR000EVR
r=0.00

small heat map img

HepG2
Myers
REST
ENCSR000BJL
r=-0.02

small heat map img

HepG2
Myers
REST
ENCSR000BOT
r=-0.05

small heat map img
2,626 peaks (download )

K562 - Myers - ENCSR000BNL

K562
Myers
SP2
ENCSR000BNL
r=1.00

small heat map img

K562
Myers
FOS
ENCSR000FAI
r=0.66

small heat map img

K562
Myers
IRF1
ENCSR000EGT
r=0.63

small heat map img

K562
Myers
NFYA
ENCSR000EGR
r=0.61

small heat map img

K562
Myers
NFYB
ENCSR000EGQ
r=0.56

small heat map img

K562
Myers
ATF1
ENCSR000DNZ
r=0.47

small heat map img

K562
Myers
E2F4
ENCSR000EWL
r=0.45

small heat map img

K562
Myers
SP1
ENCSR000BKO
r=0.43

small heat map img

K562
Myers
CREB1
ENCSR000BSO
r=0.43

small heat map img

K562
Myers
ARID3A
ENCSR000EFY
r=0.42

small heat map img

K562
Myers
JUN
ENCSR000FAH
r=0.42

small heat map img

K562
Myers
HCFC1
ENCSR000EFN
r=0.41

small heat map img

K562
Myers
JUND
ENCSR000EGN
r=0.41

small heat map img

K562
Myers
ELF1
ENCSR000BMD
r=0.41

small heat map img

K562
Myers
IRF1
ENCSR000EGL
r=0.41

small heat map img

K562
Myers
JUN
ENCSR000EGH
r=0.41

small heat map img

K562
Myers
IRF1
ENCSR000EGK
r=0.40

small heat map img

K562
Myers
GABPA
ENCSR000BLO
r=0.40

small heat map img

K562
Myers
MYC
ENCSR000EGS
r=0.39

small heat map img

K562
Myers
MYC
ENCSR000FAG
r=0.37

small heat map img

K562
Myers
RCOR1
ENCSR000EGG
r=0.37

small heat map img

K562
Myers
JUN
ENCSR000EFS
r=0.37

small heat map img

K562
Myers
TBL1XR1
ENCSR000EGB
r=0.37

small heat map img

K562
Myers
MYC
ENCSR000EZV
r=0.37

small heat map img

K562
Myers
MAX
ENCSR000EFV
r=0.36

small heat map img

K562
Myers
ZNF143
ENCSR000EGP
r=0.36

small heat map img

K562
Myers
MYC
ENCSR000EZU
r=0.35

small heat map img

K562
Myers
MYC
ENCSR000EGJ
r=0.35

small heat map img

K562
Myers
MYC
ENCSR000FAZ
r=0.34

small heat map img

K562
Myers
STAT1
ENCSR000EHJ
r=0.34

small heat map img

K562
Myers
STAT2
ENCSR000FAT
r=0.34

small heat map img

K562
Myers
HMGN3
ENCSR000DOB
r=0.34

small heat map img

K562
Myers
ELK1
ENCSR000EFU
r=0.33

small heat map img

K562
Myers
EGR1
ENCSR000BNE
r=0.33

small heat map img

K562
Myers
CCNT2
ENCSR000DOA
r=0.32

small heat map img

K562
Myers
EP300
ENCSR000EGE
r=0.32

small heat map img

K562
Myers
TBP
ENCSR000EHA
r=0.32

small heat map img

K562
Myers
MYC
ENCSR000DLZ
r=0.32

small heat map img

K562
Myers
POLR2A
ENCSR000DLY
r=0.31

small heat map img

K562
Myers
MAX
ENCSR000FAE
r=0.30

small heat map img

K562
Myers
YY1
ENCSR000BKU
r=0.29

small heat map img

K562
Myers
MXI1
ENCSR000EGZ
r=0.29

small heat map img

K562
Myers
TAF1
ENCSR000BKS
r=0.29

small heat map img

K562
Myers
STAT1
ENCSR000EHK
r=0.29

small heat map img

K562
Myers
GTF2B
ENCSR000DOE
r=0.29

small heat map img

K562
Myers
MAX
ENCSR000BLP
r=0.28

small heat map img

K562
Myers
STAT1
ENCSR000FAV
r=0.28

small heat map img

K562
Myers
CBX3
ENCSR000BRT
r=0.28

small heat map img

K562
Myers
BHLHE40
ENCSR000EGV
r=0.28

small heat map img

K562
Myers
GATA1
ENCSR000EFT
r=0.28

small heat map img

K562
Myers
SETDB1
ENCSR000AUT
r=0.28

small heat map img

K562
Myers
STAT1
ENCSR000FAU
r=0.27

small heat map img

K562
Myers
KAT2B
ENCSR000ATZ
r=0.27

small heat map img

K562
Myers
TRIM28
ENCSR000BRW
r=0.27

small heat map img

K562
Myers
ZMIZ1
ENCSR000EFQ
r=0.27

small heat map img

K562
Myers
TBL1XR1
ENCSR000EGA
r=0.26

small heat map img

K562
Myers
JUN
ENCSR000EZX
r=0.26

small heat map img

K562
Myers
E2F6
ENCSR000EWJ
r=0.25

small heat map img

K562
Myers
IRF1
ENCSR000EGU
r=0.25

small heat map img

K562
Myers
CTCF
ENCSR000EGM
r=0.25

small heat map img

K562
Myers
MAFK
ENCSR000EGX
r=0.25

small heat map img

K562
Myers
POLR2A
ENCSR000FAY
r=0.24

small heat map img

K562
Myers
POLR2A
ENCSR000FAJ
r=0.24

small heat map img

K562
Myers
STAT5A
ENCSR000BRR
r=0.24

small heat map img

K562
Myers
STAT2
ENCSR000FBC
r=0.24

small heat map img

K562
Myers
POLR2A
ENCSR000FAW
r=0.24

small heat map img

K562
Myers
JUN
ENCSR000EZT
r=0.24

small heat map img

K562
Myers
POLR2A
ENCSR000FAX
r=0.23

small heat map img

K562
Myers
CTCFL
ENCSR000BNK
r=0.23

small heat map img

K562
Myers
RCOR1
ENCSR000EGC
r=0.23

small heat map img

K562
Myers
CEBPD
ENCSR000BVY
r=0.22

small heat map img

K562
Myers
ETS1
ENCSR000BKQ
r=0.22

small heat map img

K562
Myers
POLR2A
ENCSR000BMR
r=0.22

small heat map img

K562
Myers
SMC3
ENCSR000EGW
r=0.22

small heat map img

K562
Myers
NRF1
ENCSR000EHH
r=0.22

small heat map img

K562
Myers
WHSC1
ENCSR000AVE
r=0.21

small heat map img

K562
Myers
CTCF
ENCSR000BPJ
r=0.21

small heat map img

K562
Myers
USF1
ENCSR000BKT
r=0.21

small heat map img

K562
Myers
SRF
ENCSR000BLK
r=0.21

small heat map img

K562
Myers
POLR2A
ENCSR000EHP
r=0.21

small heat map img

K562
Myers
YY1
ENCSR000EWF
r=0.21

small heat map img

K562
Myers
CEBPB
ENCSR000BRQ
r=0.20

small heat map img

K562
Myers
ATF3
ENCSR000BNU
r=0.20

small heat map img

K562
Myers
THAP1
ENCSR000BNN
r=0.20

small heat map img

K562
Myers
KDM5B
ENCSR000AQA
r=0.20

small heat map img

K562
Myers
RFX5
ENCSR000EGO
r=0.20

small heat map img

K562
Myers
JUN
ENCSR000EZW
r=0.19

small heat map img

K562
Myers
CTCF
ENCSR000DMA
r=0.19

small heat map img

K562
Myers
TEAD4
ENCSR000BRK
r=0.19

small heat map img

K562
Myers
NFE2
ENCSR000FAF
r=0.19

small heat map img

K562
Myers
CTCF
ENCSR000DWE
r=0.19

small heat map img

K562
Myers
NR2F2
ENCSR000BRS
r=0.18

small heat map img

K562
Myers
CTCF
ENCSR000AKO
r=0.18

small heat map img

K562
Myers
ZNF384
ENCSR000EFP
r=0.18

small heat map img

K562
Myers
E2F6
ENCSR000BLI
r=0.18

small heat map img

K562
Myers
SPI1
ENCSR000BGW
r=0.17

small heat map img

K562
Myers
CEBPB
ENCSR000EHE
r=0.17

small heat map img

K562
Myers
RBBP5
ENCSR000AQI
r=0.17

small heat map img

K562
Myers
SETDB1
ENCSR000EWI
r=0.17

small heat map img

K562
Myers
YY1
ENCSR000BMH
r=0.17

small heat map img

K562
Myers
ATF3
ENCSR000DOG
r=0.17

small heat map img

K562
Myers
CUX1
ENCSR000EFO
r=0.17

small heat map img

K562
Myers
SIX5
ENCSR000BGX
r=0.16

small heat map img

K562
Myers
HDAC6
ENCSR000ATJ
r=0.16

small heat map img

K562
Myers
CREBBP
ENCSR000ATT
r=0.15

small heat map img

K562
Myers
EP300
ENCSR000EGY
r=0.15

small heat map img

K562
Myers
NCOR1
ENCSR000ATY
r=0.15

small heat map img

K562
Myers
PML
ENCSR000BQY
r=0.15

small heat map img

K562
Myers
SIRT6
ENCSR000DOH
r=0.14

small heat map img

K562
Myers
HDAC2
ENCSR000BMG
r=0.14

small heat map img

K562
Myers
CHD7
ENCSR000AVD
r=0.13

small heat map img

K562
Myers
ZNF263
ENCSR000EWN
r=0.13

small heat map img

K562
Myers
REST
ENCSR000BMW
r=0.13

small heat map img

K562
Myers
TAL1
ENCSR000EHB
r=0.13

small heat map img

K562
Myers
GTF3C2
ENCSR000DOD
r=0.12

small heat map img

K562
Myers
ZBTB7A
ENCSR000BME
r=0.12

small heat map img

K562
Myers
SIN3A
ENCSR000BLR
r=0.12

small heat map img

K562
Myers
SIX5
ENCSR000BNW
r=0.12

small heat map img

K562
Myers
GATA1
ENCSR000EWM
r=0.12

small heat map img

K562
Myers
FOSL1
ENCSR000BMV
r=0.12

small heat map img

K562
Myers
RAD21
ENCSR000FAD
r=0.11

small heat map img

K562
Myers
CBX3
ENCSR000ATV
r=0.11

small heat map img

K562
Myers
PHF8
ENCSR000AQH
r=0.11

small heat map img

K562
Myers
TAF7
ENCSR000BNM
r=0.11

small heat map img

K562
Myers
RAD21
ENCSR000BKV
r=0.11

small heat map img

K562
Myers
KDM1A
ENCSR000ATX
r=0.10

small heat map img

K562
Myers
MEF2A
ENCSR000BNV
r=0.10

small heat map img

K562
Myers
SETDB1
ENCSR000EWD
r=0.09

small heat map img

K562
Myers
MAFF
ENCSR000EGI
r=0.09

small heat map img

K562
Myers
BACH1
ENCSR000EGD
r=0.09

small heat map img

K562
Myers
SAP30
ENCSR000AQJ
r=0.09

small heat map img

K562
Myers
XRCC4
ENCSR000FAC
r=0.09

small heat map img

K562
Myers
TRIM28
ENCSR000EVY
r=0.08

small heat map img

K562
Myers
REST
ENCSR000ATM
r=0.08

small heat map img

K562
Myers
POLR2A
ENCSR000EHL
r=0.08

small heat map img

K562
Myers
HDAC1
ENCSR000AQF
r=0.08

small heat map img

K562
Myers
GATA2
ENCSR000EWG
r=0.07

small heat map img

K562
Myers
ZBTB33
ENCSR000BKF
r=0.07

small heat map img

K562
Myers
USF2
ENCSR000EHG
r=0.07

small heat map img

K562
Myers
UBTF
ENCSR000EFZ
r=0.07

small heat map img

K562
Myers
HDAC2
ENCSR000AQG
r=0.06

small heat map img

K562
Myers
EP300
ENCSR000AQB
r=0.06

small heat map img

K562
Myers
UBTF
ENCSR000EFW
r=0.06

small heat map img

K562
Myers
SMARCB1
ENCSR000EHN
r=0.06

small heat map img

K562
Myers
RNF2
ENCSR000AUA
r=0.06

small heat map img

K562
Myers
SUZ12
ENCSR000AUC
r=0.06

small heat map img

K562
Myers
BRF2
ENCSR000DOC
r=0.05

small heat map img

K562
Myers
GATA2
ENCSR000BKM
r=0.05

small heat map img

K562
Myers
POLR3A
ENCSR000DOI
r=0.05

small heat map img

K562
Myers
SMARCA4
ENCSR000EHO
r=0.05

small heat map img

K562
Myers
SIRT6
ENCSR000AUB
r=0.04

small heat map img

K562
Myers
CHD4
ENCSR000ATL
r=0.03

small heat map img

K562
Myers
NR2C2
ENCSR000EWH
r=0.03

small heat map img

K562
Myers
ZNF274
ENCSR000EVX
r=0.03

small heat map img

K562
Myers
POLR3G
ENCSR000EHQ
r=0.01

small heat map img

K562
Myers
BRF1
ENCSR000DOJ
r=-0.00

small heat map img

K562
Myers
EZH2
ENCSR000AQE
r=-0.01

small heat map img

K562
Myers
CBX8
ENCSR000ATW
r=-0.01

small heat map img

K562
Myers
CBX2
ENCSR000ATU
r=-0.02

small heat map img

K562
Myers
BDP1
ENCSR000DOK
r=-0.03

small heat map img

K562
Myers
CHD1
ENCSR000AQD
r=-0.05

small heat map img

K562
Myers
ZNF274
ENCSR000EWE
r=-0.13

small heat map img
3,124 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

K562 - Myers - ENCSR000BNL

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help