SMARCC2

The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. RefSeq, Jul 2008
SWI/SNF complex subunit SMARCC2 is a protein that in humans is encoded by the SMARCC2 gene.wikipedia

SMARCC2


ENCODE experiments
Ensemble search
Entrez 6601
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia SMARCC2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

HeLa-S3 - Snyder - ENCSR000EDL

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

HeLa-S3 - Snyder - ENCSR000EDL

1.
95 / 500
1.6e-312
GGGCCTTCTGGGAGTTGTAGT
small heat map img p-value: 0.69
pct_center: 0.18
pct_ratio: 0.60
2.
47 / 500
3.6e-84
GCCTTCTGGGAGTTGTAGTCC
small heat map img p-value: 0.05
pct_center: 0.16
pct_ratio: 0.67
3.
108 / 500
5.6e-54
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 1.79
4.
81 / 500
2.7e-23
GTTATGTAAC
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 1.27
5.
40 / 500
6.0e-17
CGGGTCACGTGAGGG
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.73
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at SMARCC2 peaks

HeLa-S3 - Snyder - ENCSR000EDL

HeLa-S3
Snyder
SMARCC2
ENCSR000EDL
r=1.00

small heat map img

HeLa-S3
Snyder
H2AFZ
ENCSR000AQN
r=0.39

small heat map img

HeLa-S3
Snyder
H3K27ac
ENCSR000AOC
r=0.37

small heat map img

HeLa-S3
Snyder
H3K4me2
ENCSR000AOE
r=0.37

small heat map img

HeLa-S3
Snyder
H3K4me3
ENCSR000AOF
r=0.34

small heat map img

HeLa-S3
Snyder
H3K9ac
ENCSR000AOH
r=0.33

small heat map img

HeLa-S3
Snyder
H3K4me1
ENCSR000APW
r=0.29

small heat map img

HeLa-S3
Snyder
H3K4me3
ENCSR000DUA
r=0.27

small heat map img

HeLa-S3
Snyder
H3K79me2
ENCSR000AOG
r=0.08

small heat map img

HeLa-S3
Snyder
H3K27me3
ENCSR000DTY
r=0.07

small heat map img

HeLa-S3
Snyder
H3K9me3
ENCSR000AQO
r=0.05

small heat map img

HeLa-S3
Snyder
H4K20me1
ENCSR000AOI
r=0.04

small heat map img

HeLa-S3
Snyder
H3K36me3
ENCSR000DTZ
r=0.04

small heat map img

HeLa-S3
Snyder
H3K27me3
ENCSR000APB
r=0.03

small heat map img

HeLa-S3
Snyder
H3K36me3
ENCSR000AOD
r=-0.03

small heat map img
2,632 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at SMARCC2 peaks

HeLa-S3 - Snyder - ENCSR000EDL

HeLa-S3
Snyder
SMARCC2
ENCSR000EDL
r=1.00

small heat map img

HeLa-S3
Snyder
SMARCC1
ENCSR000EDM
r=0.74

small heat map img

HeLa-S3
Snyder
RCOR1
ENCSR000ECM
r=0.64

small heat map img

HeLa-S3
Snyder
ZKSCAN1
ENCSR000ECJ
r=0.61

small heat map img

HeLa-S3
Snyder
ELK1
ENCSR000ECI
r=0.60

small heat map img

HeLa-S3
Snyder
MAFK
ENCSR000ECK
r=0.60

small heat map img

HeLa-S3
Snyder
MAX
ENCSR000ECN
r=0.60

small heat map img

HeLa-S3
Snyder
MXI1
ENCSR000ECU
r=0.59

small heat map img

HeLa-S3
Snyder
SMARCA4
ENCSR000EZC
r=0.58

small heat map img

HeLa-S3
Snyder
MAX
ENCSR000EZF
r=0.58

small heat map img

HeLa-S3
Snyder
SMC3
ENCSR000ECS
r=0.57

small heat map img

HeLa-S3
Snyder
SMARCB1
ENCSR000EDK
r=0.56

small heat map img

HeLa-S3
Snyder
MYC
ENCSR000EZD
r=0.56

small heat map img

HeLa-S3
Snyder
STAT1
ENCSR000EZK
r=0.54

small heat map img

HeLa-S3
Snyder
BRCA1
ENCSR000EDB
r=0.54

small heat map img

HeLa-S3
Snyder
MYC
ENCSR000DLN
r=0.53

small heat map img

HeLa-S3
Snyder
TCF7L2
ENCSR000EVE
r=0.52

small heat map img

HeLa-S3
Snyder
JUND
ENCSR000EDH
r=0.51

small heat map img

HeLa-S3
Snyder
JUN
ENCSR000EDG
r=0.51

small heat map img

HeLa-S3
Snyder
STAT3
ENCSR000EDC
r=0.51

small heat map img

HeLa-S3
Snyder
FOS
ENCSR000EZE
r=0.50

small heat map img

HeLa-S3
Snyder
ELK4
ENCSR000EVI
r=0.48

small heat map img

HeLa-S3
Snyder
EP300
ENCSR000ECV
r=0.46

small heat map img

HeLa-S3
Snyder
HCFC1
ENCSR000ECH
r=0.45

small heat map img

HeLa-S3
Snyder
RAD21
ENCSR000EDE
r=0.45

small heat map img

HeLa-S3
Snyder
IRF3
ENCSR000EDF
r=0.44

small heat map img

HeLa-S3
Snyder
CEBPB
ENCSR000EDA
r=0.44

small heat map img

HeLa-S3
Snyder
KAT2A
ENCSR000ECR
r=0.41

small heat map img

HeLa-S3
Snyder
E2F6
ENCSR000EVK
r=0.40

small heat map img

HeLa-S3
Snyder
E2F4
ENCSR000EVL
r=0.40

small heat map img

HeLa-S3
Snyder
USF2
ENCSR000ECW
r=0.40

small heat map img

HeLa-S3
Snyder
PRDM1
ENCSR000ECY
r=0.39

small heat map img

HeLa-S3
Snyder
NR2C2
ENCSR000EVN
r=0.39

small heat map img

HeLa-S3
Snyder
RFX5
ENCSR000ECX
r=0.39

small heat map img

HeLa-S3
Snyder
TCF7L2
ENCSR000EVF
r=0.39

small heat map img

HeLa-S3
Snyder
ZNF274
ENCSR000EVG
r=0.38

small heat map img

HeLa-S3
Snyder
TBP
ENCSR000EDD
r=0.36

small heat map img

HeLa-S3
Snyder
ZNF143
ENCSR000ECO
r=0.36

small heat map img

HeLa-S3
Snyder
SUPT20H
ENCSR000ECQ
r=0.36

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000DLM
r=0.35

small heat map img

HeLa-S3
Snyder
EZH2
ENCSR000ATC
r=0.35

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000BGO
r=0.34

small heat map img

HeLa-S3
Snyder
NRF1
ENCSR000EDJ
r=0.34

small heat map img

HeLa-S3
Snyder
NFYA
ENCSR000DNS
r=0.33

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000EZL
r=0.33

small heat map img

HeLa-S3
Snyder
E2F1
ENCSR000EVJ
r=0.30

small heat map img

HeLa-S3
Snyder
GTF3C2
ENCSR000DNY
r=0.26

small heat map img

HeLa-S3
Snyder
NFYB
ENCSR000DNR
r=0.26

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000AOA
r=0.25

small heat map img

HeLa-S3
Snyder
BRF2
ENCSR000DNV
r=0.22

small heat map img

HeLa-S3
Snyder
TAF1
ENCSR000BHT
r=0.20

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000DLO
r=0.20

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000DUB
r=0.19

small heat map img

HeLa-S3
Snyder
GABPA
ENCSR000BHS
r=0.17

small heat map img

HeLa-S3
Snyder
BDP1
ENCSR000DNX
r=0.13

small heat map img

HeLa-S3
Snyder
ZZZ3
ENCSR000DNT
r=0.09

small heat map img

HeLa-S3
Snyder
POLR3A
ENCSR000DNU
r=0.09

small heat map img

HeLa-S3
Snyder
REST
ENCSR000BMN
r=0.09

small heat map img

HeLa-S3
Snyder
BRF1
ENCSR000DNW
r=0.08

small heat map img
2,632 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help