POLR2A

This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. RefSeq, Jul 2008
DNA-directed RNA polymerase II subunit RPB1, also known as RPB1, is an enzyme that in humans is encoded by the POLR2A gene.wikipedia

POLR2A

PDB image
PDB 2GHQ

PDB 2GHQ 2GHT 2LTO 3D9K 3D9L 3D9M 3D9N 3D9O 3D9P 4JXT
ENCODE experiments
Ensemble search
Entrez 5430
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia POLR2A

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

A549 - Iyer - ENCSR000DMZ

loading

A549 - Myers - ENCSR000BHH

loading

A549 - Myers - ENCSR000BHI

loading

endothelial cell of umbilical vein - Iyer - ENCSR000DLV

loading

endothelial cell of umbilical vein - Myers - ENCSR000BQB

loading

endothelial cell of umbilical vein - Snyder - ENCSR000EFB

loading

GM12878 - Iyer - ENCSR000DKT

loading

GM12878 - Myers - ENCSR000BGD

loading

GM12878 - Snyder - ENCSR000EAD

loading

GM12878 - Weissman - ENCSR000EYW

loading

H1-hESC - Iyer - ENCSR000DLJ

loading

H1-hESC - Myers - ENCSR000BHN

loading

HCT116 - Farnham - ENCSR000EUU

loading

HeLa-S3 - Iyer - ENCSR000DLM

loading

HeLa-S3 - Myers - ENCSR000BGO

loading

HeLa-S3 - Weissman - ENCSR000EZL

loading

HepG2 - Iyer - ENCSR000DLQ

loading

HepG2 - Myers - ENCSR000BJM

loading

HepG2 - Snyder - ENCSR000EEM

loading

HepG2 - Snyder - ENCSR000EEP

loading

HepG2 - Weissman - ENCSR000EZQ

loading

K562 - Iyer - ENCSR000DLY

loading

K562 - Myers - ENCSR000BMR

loading

K562 - Snyder - ENCSR000EHL

loading

K562 - Snyder - ENCSR000EHP

loading

K562 - Weissman - ENCSR000FAJ

loading

K562 - Weissman - ENCSR000FAW

loading

K562 - Weissman - ENCSR000FAX

loading

K562 - Weissman - ENCSR000FAY

loading

MCF-7 - Iyer - ENCSR000DMK

loading

MCF-7 - Iyer - ENCSR000DMN

loading

MCF-7 - Iyer - ENCSR000DMT

loading

NB4 - Weissman - ENCSR000FAL

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

A549 - Iyer - ENCSR000DMZ

1.
104 / 500
1.3e-35
AGGCGGCAGCGGCGGCAGCGG
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 0.62
2.
9 / 500
0.0000010
ATTTTTCACATTTGGGGAAGTTGCAGGA
small heat map img p-value: 0.75
pct_center: 0.05
pct_ratio: 0.38
3.
37 / 500
1.9e-7
GGGGTGGGTGGTTGTGGGTGGCTGTGTGTG
small heat map img p-value: 0.99
pct_center: 0.44
pct_ratio: 0.57
4.
29 / 500
0.000037
CCAAGATGGCG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.72
5.
9 / 500
7.2e+2
GTGAATTTTCTTTTT
small heat map img p-value: 0.65
pct_center: 0.03
pct_ratio: 0.24
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

A549 - Myers - ENCSR000BHH

1.
89 / 500
2.6e-61
CGGCGGCGGCGGCGGCGGCG
small heat map img p-value: 0.00
pct_center: 0.60
pct_ratio: 0.70
2.
67 / 500
3.1e-25
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.74
3.
17 / 500
0.00093
AGCAAGAAACAGAA
small heat map img p-value: 0.19
pct_center: 0.09
pct_ratio: 0.39
4.
54 / 500
0.0028
AAGAGCAGCAGCAGC
small heat map img p-value: 0.02
pct_center: 0.41
pct_ratio: 0.69
5.
32 / 500
4.7
AGGTGAGT
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.68
MEME output

A549 - Myers - ENCSR000BHI

1.
112 / 500
1.1e-47
GCGGCGGCGGCGGCG
small heat map img p-value: 0.00
pct_center: 0.54
pct_ratio: 0.67
2.
34 / 500
3.3e-12
AGCAGCGGCAGCGGGAGCAGCAGCAGCAG
small heat map img p-value: 0.00
pct_center: 0.67
pct_ratio: 0.65
3.
30 / 500
0.0000062
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.66
4.
17 / 500
0.000055
AGTGCGCATGCGCGG
small heat map img p-value: 0.00
pct_center: 0.47
pct_ratio: 0.79
5.
8 / 500
68
TTCAGGATGCAGATAGGGGAT
small heat map img p-value: 0.71
pct_center: 0.06
pct_ratio: 0.43
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM10847 - Snyder - ENCSR000DYO

1.
13 / 500
1.3e-52
GGCGGGCTTGGTGATGCCCTGGATGTTGT
small heat map img p-value: 0.77
pct_center: 0.03
pct_ratio: 0.38
2.
104 / 500
9.8e-40
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.60
pct_ratio: 0.74
3.
8 / 500
9.3e-33
AAAAGCGCTCCGGCCACCGGCGGCGTGAA
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 0.76
4.
12 / 500
9.8e-27
CTTGGTGGCCAGCTGCTTGCGCGGGGCCTT
small heat map img p-value: 0.78
pct_center: 0.17
pct_ratio: 0.61
5.
39 / 500
9.8e-18
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.34
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Iyer - ENCSR000DKT

1.
65 / 500
4.3e-26
GGCGGCAGCGGCAGC
small heat map img p-value: 0.00
pct_center: 0.52
pct_ratio: 0.65
2.
6 / 500
5.5e-18
GCTGGCTTGGTGATGCCCTGGATGTTGT
small heat map img p-value: 0.91
pct_center: 0.04
pct_ratio: 0.45
3.
51 / 500
1.2e-17
TGGGCGTGGGTGTCTGCGTTTGTGCTTTT
small heat map img p-value: 0.83
pct_center: 0.21
pct_ratio: 0.49
4.
49 / 500
7.7e-14
AAGATGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 0.68
5.
9 / 500
3.9e-10
CTTGCTCGCCGCGGTGGTGTCAAGCGGATT
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.67
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Myers - ENCSR000BGD

1.
107 / 500
5.8e-53
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.79
2.
80 / 500
1.0e-15
AGGAGCAGCAG
small heat map img p-value: 0.66
pct_center: 0.42
pct_ratio: 0.63
3.
73 / 500
5.1e-18
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.50
pct_ratio: 0.64
4.
43 / 500
4.9e-10
GGTTGTGGGTGTGTCTGTGGGTTTCGGTG
small heat map img p-value: 0.44
pct_center: 0.47
pct_ratio: 0.59
5.
16 / 500
0.00011
GGATGGCGGCGGATT
small heat map img p-value: 0.36
pct_center: 0.08
pct_ratio: 0.50
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Snyder - ENCSR000EAD

1.
8 / 500
6.7e-37
TGGCTCGTACGAAGCAGACTGCTCGCAAGT
small heat map img p-value: 0.89
pct_center: 0.07
pct_ratio: 0.59
2.
18 / 500
1.3e-23
GGCGGCAAGGCTCCGCGCAAG
small heat map img p-value: 0.01
pct_center: 0.26
pct_ratio: 0.60
3.
8 / 500
5.2e-23
GTGATGCCCTGGATGTTATCGCGCA
small heat map img p-value: 0.98
pct_center: 0.06
pct_ratio: 0.50
4.
102 / 500
2.1e-16
AAGGAAGAAAAAAAC
small heat map img p-value: 0.35
pct_center: 0.28
pct_ratio: 0.49
5.
20 / 500
3.0e-8
CAACATGGTGAGTGT
small heat map img p-value: 0.01
pct_center: 0.07
pct_ratio: 0.60
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Weissman - ENCSR000EYW

1.
71 / 500
3.3e-15
GGCGGCAGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 0.63
2.
10 / 500
5.8e-16
GTGGACTTGCGAGCTGTTTGCTT
small heat map img p-value: 0.72
pct_center: 0.05
pct_ratio: 0.41
3.
65 / 500
6.2e-19
CTGGTTTGGGTGTGTGTGTGTTGTGGTTT
small heat map img p-value: 0.61
pct_center: 0.30
pct_ratio: 0.55
4.
6 / 500
1.4e-16
GGCGGCAAAGCGCCGCGCAAGCAGCTGGCC
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 0.65
5.
8 / 500
0.0000095
TGGCCGGCTTGGTGATGCCCTGGATGTTGT
small heat map img p-value: 1.00
pct_center: 0.08
pct_ratio: 0.51
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12891 - Myers - ENCSR000BIK

1.
102 / 500
2.3e-36
AAAAGGAAGAGAGAA
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.48
2.
43 / 500
1.4e-17
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.66
3.
5 / 500
7.2e-13
TGGCTCGTACGAAGCAGACTGCTCGCAAGT
small heat map img p-value: 0.47
pct_center: 0.09
pct_ratio: 0.62
4.
5 / 500
9.8e-10
AAGGCGGAAAAGGTTTGGGTAAGGGAGGTG
small heat map img p-value: 0.81
pct_center: 0.27
pct_ratio: 0.53
5.
33 / 500
1.9e-9
GGCGGCAGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 0.60
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12891 - Snyder - ENCSR000EAJ

1.
189 / 500
4.1e-43
AAAGAAAAAGGAAAAAGCAGA
small heat map img p-value: 0.42
pct_center: 0.41
pct_ratio: 0.52
2.
5 / 500
5.3e-10
GGCGGCAAAGCTCCGCGCAAGCAGCT
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 0.62
3.
6 / 500
7.8e-12
TGGACTTCCGAGCAGTCTGCTTAGTACGA
small heat map img p-value: 0.67
pct_center: 0.04
pct_ratio: 0.52
4.
9 / 500
1.5e-9
TTGGTAATGCCCTGGATGTTGTC
small heat map img p-value: 1.00
pct_center: 0.05
pct_ratio: 0.49
5.
6 / 500
8.7e-8
AGGCGCTAAGCGTCACCGTAAGGTCCTGCG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12892 - Myers - ENCSR000BHZ

1.
140 / 500
2.6e-37
AGCGGAGGAGGCGGAGGCGGGAGCAGAGG
small heat map img p-value: 0.00
pct_center: 0.73
pct_ratio: 0.85
2.
51 / 500
4.8e-15
TTTGTGTGTGTTTGTTGCTTT
small heat map img p-value: 0.94
pct_center: 0.09
pct_ratio: 0.30
3.
49 / 500
1.7e-14
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.75
4.
4 / 500
0.0017
GCTCGTACGAAGCAGACTGCTCGCAAGT
small heat map img p-value: 0.01
pct_center: 0.11
pct_ratio: 0.65
5.
5 / 500
0.0046
GTGGCAAGGCGCCACGCAAGCAGCTGGCCA
small heat map img p-value: 0.73
pct_center: 0.37
pct_ratio: 0.64
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12892 - Snyder - ENCSR000EAM

1.
10 / 500
3.5e-45
AGCAGCTGGCCACCAAGGCGGCTCGCAAGA
small heat map img p-value: 0.34
pct_center: 0.07
pct_ratio: 0.54
2.
8 / 500
2.5e-36
GCTTTGCCGCCGGTGGACTTGCGAGCTGTT
small heat map img p-value: 0.28
pct_center: 0.15
pct_ratio: 0.65
3.
96 / 500
6.3e-34
GCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.45
pct_ratio: 0.64
4.
7 / 500
4.8e-23
TGGCCGGCTTGGTGATGCCCTGGATGTTAT
small heat map img p-value: 0.87
pct_center: 0.05
pct_ratio: 0.47
5.
8 / 500
6.2e-20
AAGGGAGGCGCTAAGCGCCACCGTAAGGT
small heat map img p-value: 0.23
pct_center: 0.13
pct_ratio: 0.56
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM15510 - Snyder - ENCSR000EAR

1.
17 / 500
7.7e-61
TTGTCGCGCAGCACCTTGCGGTGGCGCTT
small heat map img p-value: 0.29
pct_center: 0.12
pct_ratio: 0.60
2.
79 / 500
9.5e-47
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 0.67
3.
46 / 500
3.4e-24
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.33
4.
8 / 500
1.6e-38
CGGATGGCCGGCTTGGTGATGCCCTGGATG
small heat map img p-value: 0.94
pct_center: 0.08
pct_ratio: 0.52
5.
8 / 500
2.2e-18
CCGCCGGTGGCCGGAGCGCTCTTGCGAG
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 0.72
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM18505 - Snyder - ENCSR000EAU

1.
104 / 500
3.9e-45
GGTGGCGGCAGCGGCGGCGG
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 0.63
2.
49 / 500
1.1e-24
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.36
3.
77 / 500
9.4e-17
AGAGAGGAAGA
small heat map img p-value: 0.23
pct_center: 0.25
pct_ratio: 0.45
4.
7 / 500
2.1e-11
GACTGCTCGCAAGTCTACCGGCGGCAAGGC
small heat map img p-value: 0.08
pct_center: 0.15
pct_ratio: 0.64
5.
35 / 500
3.0e-9
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM18526 - Snyder - ENCSR000EAY

1.
161 / 500
1.1e-32
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 0.66
2.
7 / 500
1.7e-22
GGCTTGGTGATGCCCTGGATGTTGTCGCG
small heat map img p-value: 0.69
pct_center: 0.07
pct_ratio: 0.55
3.
55 / 500
1.8e-12
GCAAAGAAGAAGACAAGCGCCACGGAAAG
small heat map img p-value: 0.45
pct_center: 0.43
pct_ratio: 0.55
4.
26 / 500
2.0e-8
GCCAACATGGTGAGT
small heat map img p-value: 0.90
pct_center: 0.07
pct_ratio: 0.54
5.
4 / 500
0.011
AAAAGCGCGCCAGCCACCGGCGGCGTGAAG
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 0.70
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM18951 - Snyder - ENCSR000EBC

1.
11 / 500
5.5e-46
TTGCGAGCCGCCTTGGTGGCCAGCTGCTT
small heat map img p-value: 0.07
pct_center: 0.12
pct_ratio: 0.62
2.
108 / 500
3.0e-41
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.49
pct_ratio: 0.66
3.
8 / 500
9.3e-38
TTGGTGATGCCCTGGATGTTGTCGCGCA
small heat map img p-value: 0.01
pct_center: 0.03
pct_ratio: 0.44
4.
8 / 500
2.0e-24
AGCGCTCCGGCCACCGGCGGCGTGAAGAA
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.69
5.
8 / 500
2.7e-19
TTGCCGCCAGTGGACTTGCGAGCTGTTTG
small heat map img p-value: 0.10
pct_center: 0.10
pct_ratio: 0.66
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM19099 - Snyder - ENCSR000EBG

1.
120 / 500
4.6e-54
GGCGGCGGCGGCAGC
small heat map img p-value: 0.00
pct_center: 0.48
pct_ratio: 0.63
2.
82 / 500
5.1e-32
TTGTTTGTCTTTGTGATTGCTTGTCTGTT
small heat map img p-value: 0.63
pct_center: 0.17
pct_ratio: 0.46
3.
10 / 500
2.1e-26
TTGCGAGCTGCCTTAGTGGCCAGCTGCTT
small heat map img p-value: 0.37
pct_center: 0.04
pct_ratio: 0.39
4.
5 / 500
1.7e-13
AAACAGCTCGCAAGTCTACCGGCGGCAAGG
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.63
5.
43 / 500
3.2e-13
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.29
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM19193 - Snyder - ENCSR000EBK

1.
8 / 500
1.7e-33
AAGAGCGCTCCGGCCACCGGCGGCGTGAAG
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.70
2.
73 / 500
1.7e-24
CAAGATGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.70
3.
107 / 500
1.4e-34
GGCGGCGGCAGCGGCAGCGGC
small heat map img p-value: 0.00
pct_center: 0.72
pct_ratio: 0.63
4.
7 / 500
4.7e-21
GCCTTGGTGGCCAGCTGCTTGCGCGG
small heat map img p-value: 0.13
pct_center: 0.22
pct_ratio: 0.61
5.
7 / 500
5.9e-23
GATGGCGGGCTTGGTGATGCCCTGGATGTT
small heat map img p-value: 0.57
pct_center: 0.06
pct_ratio: 0.51
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Iyer - ENCSR000DLJ

1.
87 / 500
9.5e-77
CAAGATGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 0.74
2.
11 / 500
2.4e-40
ATGTCTGGTCGCGGCAAAGGCGGAAAAGG
small heat map img p-value: 0.03
pct_center: 0.24
pct_ratio: 0.61
3.
27 / 500
3.3e-29
TGGCTCGGACAAAGCAGACCGCAAGAAAGT
small heat map img p-value: 0.02
pct_center: 0.08
pct_ratio: 0.40
4.
120 / 500
5.7e-27
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.66
pct_ratio: 0.62
5.
7 / 500
1.9e-15
AAATGTGGGAAACTCGACTGCATAATTTGT
small heat map img p-value: 0.65
pct_center: 0.02
pct_ratio: 0.23
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Myers - ENCSR000BHN

1.
11 / 500
3.8e-43
TCTAGGAGCAGAGGACACAGAGCAGTGAAG
small heat map img p-value: 0.94
pct_center: 0.20
pct_ratio: 0.52
2.
46 / 500
3.7e-32
CAAGATGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.70
3.
9 / 500
1.7e-24
CTGTGGCCCTGTGACCTGCAGGTATTGG
small heat map img p-value: 1.00
pct_center: 0.13
pct_ratio: 0.52
4.
65 / 500
5.4e-12
GAGAAAGGAAG
small heat map img p-value: 0.02
pct_center: 0.23
pct_ratio: 0.45
5.
6 / 500
1.3e-11
GTGGACTTCCGAGCAGTCTGCTTAGT
small heat map img p-value: 0.58
pct_center: 0.05
pct_ratio: 0.50
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H54 - Iyer - ENCSR000DKM

1.
129 / 500
8.8e-67
GCGGCGGCGGCGGCG
small heat map img p-value: 0.00
pct_center: 0.62
pct_ratio: 0.71
2.
37 / 500
4.0e-18
AAGATGGCGGCGGCG
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 0.80
3.
6 / 500
4.9e-13
AAATGTGGGAAACTCGACTGCATAATTTGT
small heat map img p-value: 0.12
pct_center: 0.01
pct_ratio: 0.24
4.
92 / 500
1.8e-7
GGAGCAGGCGGAGGAGCGAGC
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 0.61
5.
16 / 500
0.79
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.23
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HCT116 - Farnham - ENCSR000EUU

1.
52 / 500
8.6e-35
CTTTTGGTGTGTGTGTTTTTTTGTTTGTT
small heat map img p-value: 0.55
pct_center: 0.11
pct_ratio: 0.36
2.
73 / 500
3.3e-34
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.66
pct_ratio: 0.60
3.
6 / 500
7.2e-18
AAAGGTTTGGGTAAGGGAGGTGCCAAGCGT
small heat map img p-value: 0.99
pct_center: 0.20
pct_ratio: 0.52
4.
13 / 500
6.3e-9
ATCATGTCTGGTCGTGGCAAA
small heat map img p-value: 0.17
pct_center: 0.08
pct_ratio: 0.48
5.
28 / 500
0.000020
GTTTTTATAG
small heat map img p-value: 0.00
pct_center: 0.02
pct_ratio: 0.38
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HEK293 - Weissman - ENCSR000EZA

1.
95 / 500
4.9e-55
GTGGCGGCGGCGGCGGCGG
small heat map img p-value: 0.00
pct_center: 0.73
pct_ratio: 0.67
2.
81 / 500
3.2e-20
GTTTGTTTTGCTGTGCGTTTCCTGCTTCT
small heat map img p-value: 0.00
pct_center: 0.44
pct_ratio: 0.59
3.
8 / 500
1.9e-8
TGGATGTTGTCTTGCAGTACTTTACGGT
small heat map img p-value: 0.89
pct_center: 0.02
pct_ratio: 0.33
4.
7 / 500
1.9e-8
ATGCAGTCAAGTTTCCCACATTTGGGGAAA
small heat map img p-value: 0.87
pct_center: 0.02
pct_ratio: 0.27
5.
13 / 500
3.5e-7
AAGTCGGCACGCGGCAAGGAGGGACGCAAG
small heat map img p-value: 0.02
pct_center: 0.40
pct_ratio: 0.65
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HGPS cell - Iyer - ENCSR000DNF

1.
127 / 500
5.0e-41
GGCGGCGGCGGCAGC
small heat map img p-value: 0.00
pct_center: 0.60
pct_ratio: 0.68
2.
13 / 500
7.8e-11
AAACTCAAGTGAATAATTTGT
small heat map img p-value: 0.07
pct_center: 0.02
pct_ratio: 0.22
3.
6 / 500
2.2e-12
AAAGGCGGAAAAGGGCTGGGTAAGGGAGG
small heat map img p-value: 0.98
pct_center: 0.20
pct_ratio: 0.48
4.
25 / 500
7.9e-10
TGTGGGGAGCTGCGTTTGCGCTTTTTTGT
small heat map img p-value: 0.48
pct_center: 0.21
pct_ratio: 0.51
5.
49 / 500
5.8e-9
GGGGGAGGAGGAGGAGGAGGA
small heat map img p-value: 0.00
pct_center: 0.67
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Iyer - ENCSR000DLM

1.
115 / 500
4.9e-49
AAAGAGGAAGG
small heat map img p-value: 0.37
pct_center: 0.18
pct_ratio: 0.42
2.
68 / 500
4.5e-33
TATAAAAGGCG
small heat map img p-value: 0.00
pct_center: 0.02
pct_ratio: 0.38
3.
8 / 500
1.3e-21
GTGGACTTCCGAGCAGTCTGCTTAGTACGA
small heat map img p-value: 0.77
pct_center: 0.03
pct_ratio: 0.46
4.
6 / 500
1.0e-15
CAAAGGCGGAAAAGGCCTGGGTAAGGGAGG
small heat map img p-value: 0.99
pct_center: 0.27
pct_ratio: 0.48
5.
14 / 500
6.3e-12
TAATTTGTGGTTGTGGTTAACTGCATTC
small heat map img p-value: 0.54
pct_center: 0.03
pct_ratio: 0.27
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Myers - ENCSR000BGO

1.
156 / 500
1.9e-40
GGCAGAAAGAGGAGAGAGGGAGGAGAAGG
small heat map img p-value: 0.00
pct_center: 0.50
pct_ratio: 0.62
2.
41 / 500
2.6e-20
AAGATGGCGGCGGT
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.69
3.
49 / 500
0.00028
CGGCGGCTGCGGCGGCAGCTG
small heat map img p-value: 0.00
pct_center: 0.60
pct_ratio: 0.58
4.
9 / 500
0.0022
GAGGTGGGAAGCGTCATTGCAAGGTTCTT
small heat map img p-value: 0.02
pct_center: 0.03
pct_ratio: 0.44
5.
25 / 500
0.0073
TTTCTTAGATGAGTTTATCTTTGGTGTTTT
small heat map img p-value: 0.97
pct_center: 0.04
pct_ratio: 0.21
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Weissman - ENCSR000EZL

1.
93 / 500
1.1e-33
GGCGGCGGCGGCGGCGGCGGG
small heat map img p-value: 0.00
pct_center: 0.66
pct_ratio: 0.62
2.
6 / 500
1.8e-13
AAATGTGGGAAACTTGACTGCATAATTTGT
small heat map img p-value: 0.23
pct_center: 0.02
pct_ratio: 0.28
3.
5 / 500
1.7e-14
TGGCTGGCTTGGTGATGCCCTGGATGTTAT
small heat map img p-value: 0.61
pct_center: 0.04
pct_ratio: 0.40
4.
77 / 500
3.3e-11
GAAAGAGAAGAGAGAGCAAAG
small heat map img p-value: 0.03
pct_center: 0.50
pct_ratio: 0.58
5.
33 / 500
1.2e-9
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.63
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Iyer - ENCSR000DLQ

1.
39 / 500
9.0e-62
GTGTGTGTGTGTGTGTGTGTGTGTGT
small heat map img p-value: 0.92
pct_center: 0.22
pct_ratio: 0.52
2.
16 / 500
7.1e-22
TGTGTGTGTGTGTGT
small heat map img p-value: 0.93
pct_center: 0.13
pct_ratio: 0.59
3.
132 / 500
3.5e-20
GGCGGCGGCGGCGGC
small heat map img p-value: 0.01
pct_center: 0.57
pct_ratio: 0.61
4.
83 / 500
2.5e-15
GAAGAGAGAGAGGAG
small heat map img p-value: 0.15
pct_center: 0.32
pct_ratio: 0.47
5.
4 / 500
0.00072
TGGTGGCCAGCTGCTTGCGTGGCGCTTT
small heat map img p-value: 0.01
pct_center: 0.13
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Myers - ENCSR000BJM

1.
113 / 500
2.7e-25
GCGGCGGCGGCAG
small heat map img p-value: 0.00
pct_center: 0.41
pct_ratio: 0.61
2.
71 / 500
9.0e-11
GAGAGAGAAGGGAAAGCGCAG
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 0.60
3.
33 / 500
0.045
GATGGTGAGTG
small heat map img p-value: 0.35
pct_center: 0.15
pct_ratio: 0.62
4.
12 / 500
0.11
TTTCTTGCTTCGAGAGTGTCT
small heat map img p-value: 0.30
pct_center: 0.11
pct_ratio: 0.46
5.
18 / 500
0.31
TATATAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.34
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Snyder - ENCSR000EEM

1.
133 / 500
1.7e-43
AAAGAGAAGAAGAGGGGGAAG
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 0.53
2.
69 / 500
1.4e-11
GGCGGCAGCGGCGGC
small heat map img p-value: 0.02
pct_center: 0.48
pct_ratio: 0.58
3.
39 / 500
0.0000010
TATATAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.38
4.
5 / 500
0.000017
CCGGTGGACTTGCGAGCAGTCTGCTTCGTA
small heat map img p-value: 0.25
pct_center: 0.06
pct_ratio: 0.53
5.
5 / 500
0.023
GAAAGGGACTGGGTAAGGGAGGTGCCAAGC
small heat map img p-value: 0.98
pct_center: 0.21
pct_ratio: 0.53
MEME output

HepG2 - Snyder - ENCSR000EEP

1.
175 / 500
3.1e-83
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.59
pct_ratio: 0.65
2.
35 / 500
2.4e-24
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.37
3.
9 / 500
1.0e-7
AAAGCGCCGCGCAAGCAGCTGGCGACCAAG
small heat map img p-value: 0.05
pct_center: 0.19
pct_ratio: 0.57
4.
24 / 500
0.0032
TGCATGGTGAGTGTGAGTTTT
small heat map img p-value: 0.94
pct_center: 0.09
pct_ratio: 0.52
5.
56 / 500
0.0000026
GAGAAAGCGAGAGAGGAAAG
small heat map img p-value: 0.00
pct_center: 0.52
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Weissman - ENCSR000EZQ

1.
117 / 500
1.2e-20
GGCGGCGGCGGCAGC
small heat map img p-value: 0.01
pct_center: 0.71
pct_ratio: 0.59
2.
78 / 500
9.4e-19
TGAAAGAGGGGGGGAGAGAAAGAGAGGCAG
small heat map img p-value: 1.00
pct_center: 0.28
pct_ratio: 0.44
3.
31 / 500
0.030
CGGGAGGCTGGGGAAAAGGGGGGGGCGAG
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 0.56
4.
24 / 500
0.034
AAGATGGCGGCGCTG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.65
5.
8 / 500
1.2e+2
TATAGTAGATAGACTTTATGCTGAA
small heat map img p-value: 0.59
pct_center: 0.02
pct_ratio: 0.31
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

IMR-90 - Snyder - ENCSR000EFK

1.
91 / 500
1.5e-58
TGCTGTTTGTCTGTGTGTTTTTTTCTTTTT
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.40
2.
91 / 500
2.3e-38
GCGGCGGCGGCAGC
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 0.64
3.
7 / 500
1.8e-7
GCCGCCGGTAGACTTGCGAGCTGTTTGCTT
small heat map img p-value: 0.15
pct_center: 0.08
pct_ratio: 0.60
4.
37 / 500
0.000075
GAAAGAGAAA
small heat map img p-value: 0.06
pct_center: 0.17
pct_ratio: 0.47
5.
30 / 500
0.0020
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.68
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Ishikawa - Myers - ENCSR000BKI

1.
49 / 500
6.0e-29
CAAGATGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.70
2.
105 / 500
5.5e-40
AGGCGGCAGCGGCGGCAGGGG
small heat map img p-value: 0.00
pct_center: 0.77
pct_ratio: 0.93
3.
76 / 500
1.5e-16
TTTGTTTTGGTTTGTCTGTTTTGTTGTTT
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.45
4.
37 / 500
0.00040
GAAAAAGAAAGAGCT
small heat map img p-value: 0.24
pct_center: 0.35
pct_ratio: 0.55
5.
5 / 500
2.7
AAAGTGCTGCGCGATAACATCCAGGGCATC
small heat map img p-value: 0.32
pct_center: 0.04
pct_ratio: 0.44
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Iyer - ENCSR000DLY

1.
62 / 500
4.1e-31
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.75
2.
129 / 500
2.3e-30
AGGAGGAGGGGAAAGCGGAGC
small heat map img p-value: 0.00
pct_center: 0.63
pct_ratio: 0.61
3.
7 / 500
9.6e-11
AAATGTGGGAAACTTGACTGCATAATTTGT
small heat map img p-value: 0.78
pct_center: 0.02
pct_ratio: 0.29
4.
5 / 500
3.5e-10
GGTAAGGGAGGTGCTAAGCGTCACCGTAAG
small heat map img p-value: 0.95
pct_center: 0.13
pct_ratio: 0.59
5.
60 / 500
1.5e-8
GTGGCGGCGGCGGCGGCG
small heat map img p-value: 0.00
pct_center: 0.58
pct_ratio: 0.65
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Myers - ENCSR000BMR

1.
123 / 500
1.5e-109
CAAGATGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.72
2.
101 / 500
4.0e-24
GCGGCGGCGGCGGCG
small heat map img p-value: 0.00
pct_center: 0.57
pct_ratio: 0.64
3.
67 / 500
1.2e-14
AAAAAGAGAAA
small heat map img p-value: 0.54
pct_center: 0.22
pct_ratio: 0.45
4.
39 / 500
1.5e-10
GTGTGTGTGGGTGTTTGTGTT
small heat map img p-value: 0.98
pct_center: 0.16
pct_ratio: 0.50
5.
73 / 500
0.048
CGGAAGTGACG
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.66
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Snyder - ENCSR000EHL

1.
207 / 500
2.3e-126
GGCAGATAAGA
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 1.03
2.
228 / 500
4.6e-49
GGGGGCAGGGGGAGG
small heat map img p-value: 0.93
pct_center: 0.62
pct_ratio: 0.56
3.
14 / 500
2.6e-23
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
small heat map img p-value: 0.19
pct_center: 0.14
pct_ratio: 0.51
4.
165 / 500
9.7e-19
CTGGGCTG
small heat map img p-value: 0.20
pct_center: 0.33
pct_ratio: 0.61
5.
39 / 500
0.0057
CAGGCTGCTGACTCAGGAGGG
small heat map img p-value: 1.00
pct_center: 0.30
pct_ratio: 0.59
MEME output

K562 - Snyder - ENCSR000EHP

1.
128 / 500
1.7e-50
GCAGGAAGAGAAAAAGGAAGA
small heat map img p-value: 0.00
pct_center: 0.44
pct_ratio: 0.54
2.
63 / 500
6.7e-29
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.54
pct_ratio: 0.63
3.
6 / 500
4.2e-7
ATGTCTGGACGTGGCAAGGGGGGAGG
small heat map img p-value: 0.28
pct_center: 0.14
pct_ratio: 0.62
4.
7 / 500
0.000081
TAAGGGAGGAGCTAAGCGTCATCGTAAGGT
small heat map img p-value: 0.97
pct_center: 0.02
pct_ratio: 0.36
5.
33 / 500
0.00026
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.61
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Weissman - ENCSR000FAY

1.
96 / 500
5.4e-50
TTTGAGGTACTGTGTTTTTTTTTTCTTTT
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.45
2.
68 / 500
1.2e-20
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 0.61
3.
5 / 500
1.5e-9
AGGTTTGGGTAAGGGAGGTGCTAAGCGTCA
small heat map img p-value: 1.00
pct_center: 0.20
pct_ratio: 0.55
4.
6 / 500
6.3e-8
ATGTCTGGACGTGGCAAGCAAGGAGG
small heat map img p-value: 0.72
pct_center: 0.19
pct_ratio: 0.61
5.
4 / 500
0.000046
TGGCTCGTACGAAGCAGACTGCTCGCAAGT
small heat map img p-value: 0.18
pct_center: 0.09
pct_ratio: 0.63
MEME output

K562 - Weissman - ENCSR000FAX

1.
158 / 500
2.5e-44
CAGAAGGAAGAGAAAAGGCAA
small heat map img p-value: 0.00
pct_center: 0.46
pct_ratio: 0.54
2.
14 / 500
5.0e-17
TTTACCATGTCTGGACGTGGCAAGTGCGG
small heat map img p-value: 1.00
pct_center: 0.15
pct_ratio: 0.57
3.
42 / 500
1.6e-14
GGCGGCAGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.54
pct_ratio: 0.63
4.
5 / 500
1.1e-10
GGGTAAGGGAGGCGCTAAGCGTCACCGTAA
small heat map img p-value: 0.49
pct_center: 0.13
pct_ratio: 0.56
5.
9 / 500
1.9e-7
AAACTCGACTGTATAATTTGTGGTAGTG
small heat map img p-value: 0.14
pct_center: 0.02
pct_ratio: 0.36
MEME output

K562 - Weissman - ENCSR000FAJ

1.
58 / 500
2.4e-38
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.36
2.
167 / 500
1.5e-21
GAGGCGGCGGCGGCGGCGGCG
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 0.62
3.
53 / 500
3.0e-10
GTTGGTGTGTTGTTTGTTTTGGTTTTGTTA
small heat map img p-value: 0.77
pct_center: 0.08
pct_ratio: 0.33
4.
28 / 500
2.2e-9
CAAGATGGCG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.61
5.
6 / 500
5.3
GACGCGTGGCCACAGCCTGCCGGTCAGTGT
small heat map img p-value: 0.99
pct_center: 0.35
pct_ratio: 0.65
MEME output

K562 - Weissman - ENCSR000FAW

1.
61 / 500
3.3e-39
GCGGCGGCGGCGGCGGCGGCTGCGGCAG
small heat map img p-value: 0.00
pct_center: 0.69
pct_ratio: 0.64
2.
122 / 500
5.9e-35
AAAAAGAAAGAGGAAAGCGAA
small heat map img p-value: 0.00
pct_center: 0.45
pct_ratio: 0.55
3.
6 / 500
1.4e-10
TAAGGGTGGCGCTAAGCGTCACCGTAAGGT
small heat map img p-value: 0.90
pct_center: 0.09
pct_ratio: 0.54
4.
40 / 500
3.9e-10
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.65
5.
6 / 500
0.000018
ATGTCTGGACGTGGCAAGCAGGGCGGAA
small heat map img p-value: 0.03
pct_center: 0.17
pct_ratio: 0.65
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF 10A - Struhl - ENCSR000DPA

1.
128 / 500
8.8e-49
AAAAGAAAGAGAAAA
small heat map img p-value: 0.01
pct_center: 0.32
pct_ratio: 0.50
2.
79 / 500
3.4e-34
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.02
pct_ratio: 0.32
3.
86 / 500
8.2e-32
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.50
pct_ratio: 0.58
4.
37 / 500
4.4e-15
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.56
5.
20 / 500
6.7e-7
AAATTATGTTGTTAAGTTTCCCAATTTTG
small heat map img p-value: 0.99
pct_center: 0.05
pct_ratio: 0.26
MEME output

MCF 10A - Struhl - ENCSR000DPC

1.
126 / 500
7.7e-59
GAAAAGAAAGAAGAA
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.44
2.
95 / 500
1.3e-39
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.63
pct_ratio: 0.59
3.
65 / 500
2.3e-34
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.43
4.
45 / 500
2.5e-12
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.63
5.
5 / 500
3.6e-8
TCTGGTCGCGGCAAAGGCGGAAAGGGTCTG
small heat map img p-value: 0.01
pct_center: 0.23
pct_ratio: 0.60
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF-7 - Iyer - ENCSR000DMK

1.
104 / 500
3.5e-26
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 0.69
2.
7 / 500
6.3e-23
TGGCCGGCTTGGTGATGCCCTGGATGTTAT
small heat map img p-value: 0.94
pct_center: 0.05
pct_ratio: 0.48
3.
46 / 500
9.7e-13
CAAGATGGCG
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.64
4.
7 / 500
1.4e-8
GTCTGGGTAAGGGAGGCGCCAAGCGTCACC
small heat map img p-value: 1.00
pct_center: 0.13
pct_ratio: 0.56
5.
6 / 500
0.011
TTGACGCCGCCGGTGGCCGGAGCGCTCTT
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.74
MEME output

MCF-7 - Iyer - ENCSR000DMN

1.
110 / 500
5.2e-45
GGCGGCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.56
pct_ratio: 0.67
2.
43 / 500
8.0e-19
CAAGATGGCG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.72
3.
7 / 500
4.8e-15
GGCTTTGTAATGCCCTGGATGTTATCGCGC
small heat map img p-value: 0.85
pct_center: 0.07
pct_ratio: 0.52
4.
6 / 500
4.1e-11
TAAGGGAGGCGCCAAGCGTCACCGTAAGGT
small heat map img p-value: 0.40
pct_center: 0.12
pct_ratio: 0.59
5.
31 / 500
0.0000060
GGAAGAGGAAG
small heat map img p-value: 0.01
pct_center: 0.26
pct_ratio: 0.47
MEME output

MCF-7 - Iyer - ENCSR000DMT

1.
47 / 500
5.4e-21
GAAGATGGCGGCGG
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 0.67
2.
119 / 500
3.9e-18
GCGGCAGCAGCAGCG
small heat map img p-value: 0.06
pct_center: 0.65
pct_ratio: 0.61
3.
9 / 500
5.0e-17
AAAGGTGGAAAGGGTTTGGGTAAGGGAGG
small heat map img p-value: 0.97
pct_center: 0.34
pct_ratio: 0.53
4.
60 / 500
2.3e-16
AAAAAAGAAAAAGAA
small heat map img p-value: 0.01
pct_center: 0.13
pct_ratio: 0.36
5.
7 / 500
2.4e-11
CCGGTGGACTTGCGAGCTGTCTGCTTAGTA
small heat map img p-value: 0.70
pct_center: 0.06
pct_ratio: 0.53
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

NB4 - Weissman - ENCSR000FAL

1.
103 / 500
1.1e-60
GCGGCGGCGGCGGCGGCAGCG
small heat map img p-value: 0.01
pct_center: 0.67
pct_ratio: 0.64
2.
8 / 500
1.3e-13
GTGGACTTGCGAGCTGTTTGCTTCGTGC
small heat map img p-value: 0.01
pct_center: 0.06
pct_ratio: 0.48
3.
10 / 500
8.9e-18
CAAGGCCACAAAAAATTGGTTTAAGTCT
small heat map img p-value: 0.41
pct_center: 0.01
pct_ratio: 0.17
4.
39 / 500
1.4e-14
TATATAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.35
5.
8 / 500
2.6e-13
GGCAAGGGAGGCGCTAAGCGTCACCGTAAG
small heat map img p-value: 0.71
pct_center: 0.28
pct_ratio: 0.60
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Raji - Farnham - ENCSR000EXX

1.
79 / 500
1.4e-13
AGGAGGAGCAGCAGC
small heat map img p-value: 0.18
pct_center: 0.56
pct_ratio: 0.62
2.
45 / 500
5.0e-10
ATTTTGGTTTGTGTGTGTGTGTGTGTTGGT
small heat map img p-value: 0.61
pct_center: 0.21
pct_ratio: 0.51
3.
66 / 500
1.8e-8
GGCGGGGGAGGCGGCGGCGGCGGCAGCGG
small heat map img p-value: 0.00
pct_center: 0.72
pct_ratio: 0.61
4.
4 / 500
0.010
TTGCCGCCGGTGGACTTGCGAGCAGTCTG
small heat map img p-value: 0.28
pct_center: 0.10
pct_ratio: 0.61
5.
8 / 500
0.00040
AGCAGCTAGCCACCAAGGCTGCTCGGAAGA
small heat map img p-value: 0.28
pct_center: 0.05
pct_ratio: 0.49
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

endothelial cell of umbilical vein - Iyer - ENCSR000DLV

1.
99 / 500
1.2e-39
TTTTTTTTGCTTTTG
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.31
2.
18 / 500
1.9e-34
ATGTCTGGCCGCGGCAAAG
small heat map img p-value: 0.00
pct_center: 0.09
pct_ratio: 0.57
3.
91 / 500
2.8e-23
GCGGCGGCGGC
small heat map img p-value: 0.00
pct_center: 0.55
pct_ratio: 0.71
4.
10 / 500
8.4e-13
AAACTCAACTGTATAATTTGTGGTAGTG
small heat map img p-value: 0.30
pct_center: 0.02
pct_ratio: 0.31
5.
6 / 500
3.7e-9
GGAAAAGGTTTGGGTAAGGGAGGTGCTAAG
small heat map img p-value: 0.53
pct_center: 0.19
pct_ratio: 0.51
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

endothelial cell of umbilical vein - Myers - ENCSR000BQB

1.
104 / 500
2.3e-37
GCCGGCGGCGGCGGCAGCGG
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 0.60
2.
93 / 500
1.0e-32
ATGTTTTTTGCTGGTTGCTGTGTTGTTTTT
small heat map img p-value: 0.81
pct_center: 0.12
pct_ratio: 0.36
3.
6 / 500
5.3e-17
AAGGGTTTGGGTAAGGGAGGCGCTAAGCGT
small heat map img p-value: 0.62
pct_center: 0.17
pct_ratio: 0.52
4.
39 / 500
6.8e-8
TATATAAG
small heat map img p-value: 0.00
pct_center: 0.01
pct_ratio: 0.30
5.
6 / 500
0.016
TCCTGCGATTTCCCCAAGTGGGGGAA
small heat map img p-value: 0.58
pct_center: 0.06
pct_ratio: 0.47
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

endothelial cell of umbilical vein - Snyder - ENCSR000EFB

1.
81 / 500
6.1e-62
AAAAAAAGAAAAAACAAAAAAAAAGCGAA
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.37
2.
127 / 500
9.2e-43
GAGGCGGCGGCGGAGGCGGAG
small heat map img p-value: 0.00
pct_center: 0.68
pct_ratio: 0.59
3.
7 / 500
2.7e-21
GTGGACTTGCGAGCTGTCTGCTTTGTACG
small heat map img p-value: 0.16
pct_center: 0.05
pct_ratio: 0.53
4.
5 / 500
0.000095
ATTATGCAGTCGAGTTTCCCACATTTGGG
small heat map img p-value: 0.56
pct_center: 0.04
pct_ratio: 0.48
5.
36 / 500
0.00042
TATAAAAG
small heat map img p-value: 0.00
pct_center: 0.02
pct_ratio: 0.44
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

erythroblast - Farnham - ENCSR000EXO

1.
10 / 500
3.6e-21
TGCTGCGGGAGAACATCCAGGACATCACGA
small heat map img p-value: 0.49
pct_center: 0.06
pct_ratio: 0.52
2.
64 / 500
1.7e-18
GGAGCGGCAGCGGCAGCGGGAGGAGCAGC
small heat map img p-value: 0.00
pct_center: 0.72
pct_ratio: 0.81
3.
41 / 500
8.3e-14
GTATATTCTTTTTTTTTAGTCAGTGTTTTT
small heat map img p-value: 1.00
pct_center: 0.05
pct_ratio: 0.22
4.
30 / 500
5.4e-10
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.61
5.
8 / 500
3.4e-8
GGAGCTCTGGAAGCGCAGGTC
small heat map img p-value: 0.15
pct_center: 0.13
pct_ratio: 0.57
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at POLR2A peaks

A549 - Iyer - ENCSR000DMZ

A549
Iyer
POLR2A
ENCSR000DMZ
r=1.00

small heat map img

A549
Iyer
POLR2A
ENCSR000BHI
r=0.74

small heat map img

A549
Iyer
POLR2A
ENCSR000BHH
r=0.72

small heat map img

A549
Iyer
H3K4me3
ENCSR000DPD
r=0.48

small heat map img

A549
Iyer
H3K4me3
ENCSR000AST
r=0.48

small heat map img

A549
Iyer
H3K4me3
ENCSR000ASH
r=0.48

small heat map img

A549
Iyer
H2AFZ
ENCSR000AUG
r=0.44

small heat map img

A549
Iyer
H3K9ac
ENCSR000ASV
r=0.44

small heat map img

A549
Iyer
H2AFZ
ENCSR000AUH
r=0.42

small heat map img

A549
Iyer
H3K27ac
ENCSR000AVF
r=0.42

small heat map img

A549
Iyer
H3K27ac
ENCSR000AUI
r=0.35

small heat map img

A549
Iyer
H3K4me2
ENCSR000AVI
r=0.35

small heat map img

A549
Iyer
H3K4me2
ENCSR000ATO
r=0.34

small heat map img

A549
Iyer
H3K79me2
ENCSR000ASU
r=0.15

small heat map img

A549
Iyer
H3K79me2
ENCSR000ATP
r=0.14

small heat map img

A549
Iyer
H3K27me3
ENCSR000AUK
r=-0.01

small heat map img

A549
Iyer
H3K9me3
ENCSR000AUN
r=-0.01

small heat map img

A549
Iyer
H3K4me1
ENCSR000AUM
r=-0.02

small heat map img

A549
Iyer
H3K4me1
ENCSR000AVH
r=-0.02

small heat map img

A549
Iyer
H4K20me1
ENCSR000AUO
r=-0.04

small heat map img

A549
Iyer
H3K27me3
ENCSR000AUJ
r=-0.06

small heat map img

A549
Iyer
H3K36me3
ENCSR000AVG
r=-0.08

small heat map img

A549
Iyer
H3K36me3
ENCSR000AUL
r=-0.08

small heat map img
10,000 randomly-selected peaks from a total of 17,011 (download )

A549 - Myers - ENCSR000BHH

A549
Myers
POLR2A
ENCSR000BHH
r=1.00

small heat map img

A549
Myers
POLR2A
ENCSR000BHI
r=0.95

small heat map img

A549
Myers
POLR2A
ENCSR000DMZ
r=0.70

small heat map img

A549
Myers
H3K4me3
ENCSR000DPD
r=0.36

small heat map img

A549
Myers
H3K4me3
ENCSR000AST
r=0.36

small heat map img

A549
Myers
H3K4me3
ENCSR000ASH
r=0.36

small heat map img

A549
Myers
H3K9ac
ENCSR000ASV
r=0.34

small heat map img

A549
Myers
H3K27ac
ENCSR000AVF
r=0.33

small heat map img

A549
Myers
H2AFZ
ENCSR000AUG
r=0.31

small heat map img

A549
Myers
H2AFZ
ENCSR000AUH
r=0.29

small heat map img

A549
Myers
H3K27ac
ENCSR000AUI
r=0.26

small heat map img

A549
Myers
H3K4me2
ENCSR000AVI
r=0.24

small heat map img

A549
Myers
H3K4me2
ENCSR000ATO
r=0.23

small heat map img

A549
Myers
H3K79me2
ENCSR000ASU
r=0.09

small heat map img

A549
Myers
H3K79me2
ENCSR000ATP
r=0.09

small heat map img

A549
Myers
H3K27me3
ENCSR000AUK
r=-0.00

small heat map img

A549
Myers
H4K20me1
ENCSR000AUO
r=-0.00

small heat map img

A549
Myers
H3K9me3
ENCSR000AUN
r=-0.02

small heat map img

A549
Myers
H3K4me1
ENCSR000AUM
r=-0.02

small heat map img

A549
Myers
H3K4me1
ENCSR000AVH
r=-0.03

small heat map img

A549
Myers
H3K36me3
ENCSR000AUL
r=-0.04

small heat map img

A549
Myers
H3K36me3
ENCSR000AVG
r=-0.04

small heat map img

A549
Myers
H3K27me3
ENCSR000AUJ
r=-0.05

small heat map img
10,000 randomly-selected peaks from a total of 27,685 (download )

A549 - Myers - ENCSR000BHI

A549
Myers
POLR2A
ENCSR000BHI
r=1.00

small heat map img

A549
Myers
POLR2A
ENCSR000BHH
r=0.94

small heat map img

A549
Myers
POLR2A
ENCSR000DMZ
r=0.74

small heat map img

A549
Myers
H3K4me3
ENCSR000DPD
r=0.41

small heat map img

A549
Myers
H3K4me3
ENCSR000AST
r=0.40

small heat map img

A549
Myers
H3K4me3
ENCSR000ASH
r=0.40

small heat map img

A549
Myers
H3K9ac
ENCSR000ASV
r=0.37

small heat map img

A549
Myers
H3K27ac
ENCSR000AVF
r=0.35

small heat map img

A549
Myers
H2AFZ
ENCSR000AUG
r=0.35

small heat map img

A549
Myers
H2AFZ
ENCSR000AUH
r=0.33

small heat map img

A549
Myers
H3K4me2
ENCSR000AVI
r=0.28

small heat map img

A549
Myers
H3K27ac
ENCSR000AUI
r=0.28

small heat map img

A549
Myers
H3K4me2
ENCSR000ATO
r=0.27

small heat map img

A549
Myers
H3K79me2
ENCSR000ASU
r=0.11

small heat map img

A549
Myers
H3K79me2
ENCSR000ATP
r=0.11

small heat map img

A549
Myers
H3K27me3
ENCSR000AUK
r=0.00

small heat map img

A549
Myers
H4K20me1
ENCSR000AUO
r=0.00

small heat map img

A549
Myers
H3K9me3
ENCSR000AUN
r=-0.02

small heat map img

A549
Myers
H3K4me1
ENCSR000AUM
r=-0.02

small heat map img

A549
Myers
H3K4me1
ENCSR000AVH
r=-0.02

small heat map img

A549
Myers
H3K27me3
ENCSR000AUJ
r=-0.05

small heat map img

A549
Myers
H3K36me3
ENCSR000AUL
r=-0.05

small heat map img

A549
Myers
H3K36me3
ENCSR000AVG
r=-0.05

small heat map img
10,000 randomly-selected peaks from a total of 27,603 (download )

GM10847 - Snyder - ENCSR000DYO

GM10847
Snyder
POLR2A
ENCSR000DYO
r=1.00

small heat map img
9,683 peaks (download )

GM12878 - Iyer - ENCSR000DKT

GM12878
Iyer
POLR2A
ENCSR000DKT
r=1.00

small heat map img

GM12878
Iyer
POLR2A
ENCSR000EAD
r=0.82

small heat map img

GM12878
Iyer
POLR2A
ENCSR000EYW
r=0.77

small heat map img

GM12878
Iyer
POLR2A
ENCSR000BGD
r=0.75

small heat map img

GM12878
Iyer
H3K9ac
ENCSR000AKH
r=0.46

small heat map img

GM12878
Iyer
H3K4me3
ENCSR000DRY
r=0.43

small heat map img

GM12878
Iyer
H3K4me3
ENCSR000AKA
r=0.41

small heat map img

GM12878
Iyer
H2AFZ
ENCSR000AOV
r=0.40

small heat map img

GM12878
Iyer
H3K27ac
ENCSR000AKC
r=0.35

small heat map img

GM12878
Iyer
H3K4me2
ENCSR000AKG
r=0.33

small heat map img

GM12878
Iyer
H3K79me2
ENCSR000AOW
r=0.21

small heat map img

GM12878
Iyer
H3K4me1
ENCSR000AKF
r=0.04

small heat map img

GM12878
Iyer
H3K9me3
ENCSR000AOX
r=0.02

small heat map img

GM12878
Iyer
H4K20me1
ENCSR000AKI
r=-0.01

small heat map img

GM12878
Iyer
H3K36me3
ENCSR000DRW
r=-0.03

small heat map img

GM12878
Iyer
H3K27me3
ENCSR000DRX
r=-0.04

small heat map img

GM12878
Iyer
H3K27me3
ENCSR000AKD
r=-0.06

small heat map img

GM12878
Iyer
H3K36me3
ENCSR000AKE
r=-0.11

small heat map img
10,000 randomly-selected peaks from a total of 14,237 (download )

GM12878 - Myers - ENCSR000BGD

GM12878
Myers
POLR2A
ENCSR000BGD
r=1.00

small heat map img

GM12878
Myers
POLR2A
ENCSR000EYW
r=0.79

small heat map img

GM12878
Myers
POLR2A
ENCSR000EAD
r=0.78

small heat map img

GM12878
Myers
POLR2A
ENCSR000DKT
r=0.74

small heat map img

GM12878
Myers
H3K9ac
ENCSR000AKH
r=0.37

small heat map img

GM12878
Myers
H3K4me3
ENCSR000DRY
r=0.36

small heat map img

GM12878
Myers
H3K4me3
ENCSR000AKA
r=0.33

small heat map img

GM12878
Myers
H2AFZ
ENCSR000AOV
r=0.31

small heat map img

GM12878
Myers
H3K27ac
ENCSR000AKC
r=0.25

small heat map img

GM12878
Myers
H3K4me2
ENCSR000AKG
r=0.25

small heat map img

GM12878
Myers
H3K79me2
ENCSR000AOW
r=0.22

small heat map img

GM12878
Myers
H3K9me3
ENCSR000AOX
r=0.02

small heat map img

GM12878
Myers
H3K4me1
ENCSR000AKF
r=0.01

small heat map img

GM12878
Myers
H4K20me1
ENCSR000AKI
r=0.01

small heat map img

GM12878
Myers
H3K27me3
ENCSR000AKD
r=-0.04

small heat map img

GM12878
Myers
H3K36me3
ENCSR000DRW
r=-0.05

small heat map img

GM12878
Myers
H3K27me3
ENCSR000DRX
r=-0.06

small heat map img

GM12878
Myers
H3K36me3
ENCSR000AKE
r=-0.08

small heat map img
10,000 randomly-selected peaks from a total of 27,558 (download )

GM12878 - Snyder - ENCSR000EAD

GM12878
Snyder
POLR2A
ENCSR000EAD
r=1.00

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EYW
r=0.92

small heat map img

GM12878
Snyder
POLR2A
ENCSR000DKT
r=0.80

small heat map img

GM12878
Snyder
POLR2A
ENCSR000BGD
r=0.77

small heat map img

GM12878
Snyder
H3K9ac
ENCSR000AKH
r=0.38

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000DRY
r=0.34

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000AKA
r=0.33

small heat map img

GM12878
Snyder
H3K27ac
ENCSR000AKC
r=0.32

small heat map img

GM12878
Snyder
H2AFZ
ENCSR000AOV
r=0.31

small heat map img

GM12878
Snyder
H3K4me2
ENCSR000AKG
r=0.25

small heat map img

GM12878
Snyder
H3K79me2
ENCSR000AOW
r=0.19

small heat map img

GM12878
Snyder
H3K4me1
ENCSR000AKF
r=0.02

small heat map img

GM12878
Snyder
H3K9me3
ENCSR000AOX
r=0.02

small heat map img

GM12878
Snyder
H4K20me1
ENCSR000AKI
r=-0.00

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000DRW
r=-0.02

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000DRX
r=-0.05

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000AKE
r=-0.06

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000AKD
r=-0.06

small heat map img
10,000 randomly-selected peaks from a total of 21,947 (download )

GM12878 - Weissman - ENCSR000EYW

GM12878
Weissman
POLR2A
ENCSR000EYW
r=1.00

small heat map img

GM12878
Weissman
POLR2A
ENCSR000EAD
r=0.93

small heat map img

GM12878
Weissman
POLR2A
ENCSR000BGD
r=0.81

small heat map img

GM12878
Weissman
POLR2A
ENCSR000DKT
r=0.78

small heat map img

GM12878
Weissman
H3K9ac
ENCSR000AKH
r=0.38

small heat map img

GM12878
Weissman
H2AFZ
ENCSR000AOV
r=0.36

small heat map img

GM12878
Weissman
H3K4me3
ENCSR000DRY
r=0.34

small heat map img

GM12878
Weissman
H3K27ac
ENCSR000AKC
r=0.33

small heat map img

GM12878
Weissman
H3K4me3
ENCSR000AKA
r=0.32

small heat map img

GM12878
Weissman
H3K4me2
ENCSR000AKG
r=0.23

small heat map img

GM12878
Weissman
H3K79me2
ENCSR000AOW
r=0.17

small heat map img

GM12878
Weissman
H3K9me3
ENCSR000AOX
r=0.03

small heat map img

GM12878
Weissman
H3K4me1
ENCSR000AKF
r=0.01

small heat map img

GM12878
Weissman
H4K20me1
ENCSR000AKI
r=-0.02

small heat map img

GM12878
Weissman
H3K36me3
ENCSR000DRW
r=-0.04

small heat map img

GM12878
Weissman
H3K27me3
ENCSR000DRX
r=-0.05

small heat map img

GM12878
Weissman
H3K27me3
ENCSR000AKD
r=-0.06

small heat map img

GM12878
Weissman
H3K36me3
ENCSR000AKE
r=-0.10

small heat map img
10,000 randomly-selected peaks from a total of 11,086 (download )

GM12891 - Myers - ENCSR000BIK

GM12891
Myers
POLR2A
ENCSR000BIK
r=1.00

small heat map img

GM12891
Myers
POLR2A
ENCSR000EAJ
r=0.75

small heat map img
10,000 randomly-selected peaks from a total of 16,585 (download )

GM12891 - Snyder - ENCSR000EAJ

GM12891
Snyder
POLR2A
ENCSR000EAJ
r=1.00

small heat map img

GM12891
Snyder
POLR2A
ENCSR000BIK
r=0.76

small heat map img
10,000 randomly-selected peaks from a total of 20,390 (download )

GM12892 - Myers - ENCSR000BHZ

GM12892
Myers
POLR2A
ENCSR000BHZ
r=1.00

small heat map img

GM12892
Myers
POLR2A
ENCSR000EAM
r=0.76

small heat map img
10,000 randomly-selected peaks from a total of 20,075 (download )

GM12892 - Snyder - ENCSR000EAM

GM12892
Snyder
POLR2A
ENCSR000EAM
r=1.00

small heat map img

GM12892
Snyder
POLR2A
ENCSR000BHZ
r=0.77

small heat map img
10,000 randomly-selected peaks from a total of 22,544 (download )

GM15510 - Snyder - ENCSR000EAR

GM15510
Snyder
POLR2A
ENCSR000EAR
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 18,661 (download )

GM18505 - Snyder - ENCSR000EAU

GM18505
Snyder
POLR2A
ENCSR000EAU
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 21,784 (download )

GM18526 - Snyder - ENCSR000EAY

GM18526
Snyder
POLR2A
ENCSR000EAY
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 16,856 (download )

GM18951 - Snyder - ENCSR000EBC

GM18951
Snyder
POLR2A
ENCSR000EBC
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 21,218 (download )

GM19099 - Snyder - ENCSR000EBG

GM19099
Snyder
POLR2A
ENCSR000EBG
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 22,219 (download )

GM19193 - Snyder - ENCSR000EBK

GM19193
Snyder
POLR2A
ENCSR000EBK
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 21,404 (download )

H1-hESC - Iyer - ENCSR000DLJ

H1-hESC
Iyer
POLR2A
ENCSR000DLJ
r=1.00

small heat map img

H1-hESC
Iyer
POLR2A
ENCSR000BHN
r=0.69

small heat map img

H1-hESC
Iyer
H3K9ac
ENCSR000AND
r=0.47

small heat map img

H1-hESC
Iyer
H3K4me3
ENCSR000AMG
r=0.46

small heat map img

H1-hESC
Iyer
H3K27ac
ENCSR000ANP
r=0.45

small heat map img

H1-hESC
Iyer
H3K4me2
ENCSR000ANC
r=0.44

small heat map img

H1-hESC
Iyer
H2AFZ
ENCSR000APX
r=0.29

small heat map img

H1-hESC
Iyer
H3K4me1
ENCSR000ANA
r=0.17

small heat map img

H1-hESC
Iyer
H3K79me2
ENCSR000APY
r=0.12

small heat map img

H1-hESC
Iyer
H4K20me1
ENCSR000AMH
r=0.08

small heat map img

H1-hESC
Iyer
H3K9me3
ENCSR000APZ
r=-0.00

small heat map img

H1-hESC
Iyer
H3K27me3
ENCSR000ALU
r=-0.01

small heat map img

H1-hESC
Iyer
H3K36me3
ENCSR000ANB
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 12,915 (download )

H1-hESC - Myers - ENCSR000BHN

H1-hESC
Myers
POLR2A
ENCSR000BHN
r=1.00

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000DLJ
r=0.67

small heat map img

H1-hESC
Myers
H3K9ac
ENCSR000AND
r=0.33

small heat map img

H1-hESC
Myers
H3K27ac
ENCSR000ANP
r=0.31

small heat map img

H1-hESC
Myers
H3K4me3
ENCSR000AMG
r=0.30

small heat map img

H1-hESC
Myers
H3K4me2
ENCSR000ANC
r=0.29

small heat map img

H1-hESC
Myers
H2AFZ
ENCSR000APX
r=0.18

small heat map img

H1-hESC
Myers
H3K4me1
ENCSR000ANA
r=0.10

small heat map img

H1-hESC
Myers
H3K79me2
ENCSR000APY
r=0.10

small heat map img

H1-hESC
Myers
H4K20me1
ENCSR000AMH
r=0.06

small heat map img

H1-hESC
Myers
H3K36me3
ENCSR000ANB
r=0.01

small heat map img

H1-hESC
Myers
H3K9me3
ENCSR000APZ
r=0.01

small heat map img

H1-hESC
Myers
H3K27me3
ENCSR000ALU
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 20,317 (download )

H54 - Iyer - ENCSR000DKM

H54
Iyer
POLR2A
ENCSR000DKM
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 17,417 (download )

HCT116 - Farnham - ENCSR000EUU

HCT116
Farnham
POLR2A
ENCSR000EUU
r=1.00

small heat map img

HCT116
Farnham
H3K27ac
ENCSR000EUT
r=0.40

small heat map img

HCT116
Farnham
H3K4me3
ENCSR000DTQ
r=0.39

small heat map img

HCT116
Farnham
H3K4me1
ENCSR000EUS
r=0.08

small heat map img
10,000 randomly-selected peaks from a total of 12,864 (download )

HEK293 - Weissman - ENCSR000EZA

HEK293
Weissman
POLR2A
ENCSR000EZA
r=1.00

small heat map img

HEK293
Weissman
H3K4me3
ENCSR000DTU
r=0.48

small heat map img
10,000 randomly-selected peaks from a total of 11,490 (download )

HGPS cell - Iyer - ENCSR000DNF

HGPS cell
Iyer
POLR2A
ENCSR000DNF
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 16,338 (download )

HeLa-S3 - Iyer - ENCSR000DLM

HeLa-S3
Iyer
POLR2A
ENCSR000DLM
r=1.00

small heat map img

HeLa-S3
Iyer
POLR2A
ENCSR000EZL
r=0.83

small heat map img

HeLa-S3
Iyer
POLR2A
ENCSR000BGO
r=0.71

small heat map img

HeLa-S3
Iyer
H3K4me3
ENCSR000AOF
r=0.50

small heat map img

HeLa-S3
Iyer
H3K9ac
ENCSR000AOH
r=0.49

small heat map img

HeLa-S3
Iyer
H3K4me3
ENCSR000DUA
r=0.48

small heat map img

HeLa-S3
Iyer
H3K27ac
ENCSR000AOC
r=0.43

small heat map img

HeLa-S3
Iyer
H3K4me2
ENCSR000AOE
r=0.39

small heat map img

HeLa-S3
Iyer
H2AFZ
ENCSR000AQN
r=0.39

small heat map img

HeLa-S3
Iyer
H3K79me2
ENCSR000AOG
r=0.14

small heat map img

HeLa-S3
Iyer
H3K4me1
ENCSR000APW
r=0.08

small heat map img

HeLa-S3
Iyer
H3K27me3
ENCSR000DTY
r=0.05

small heat map img

HeLa-S3
Iyer
H4K20me1
ENCSR000AOI
r=-0.02

small heat map img

HeLa-S3
Iyer
H3K36me3
ENCSR000DTZ
r=-0.05

small heat map img

HeLa-S3
Iyer
H3K9me3
ENCSR000AQO
r=-0.05

small heat map img

HeLa-S3
Iyer
H3K27me3
ENCSR000APB
r=-0.07

small heat map img

HeLa-S3
Iyer
H3K36me3
ENCSR000AOD
r=-0.13

small heat map img
10,000 randomly-selected peaks from a total of 15,736 (download )

HeLa-S3 - Myers - ENCSR000BGO

HeLa-S3
Myers
POLR2A
ENCSR000BGO
r=1.00

small heat map img

HeLa-S3
Myers
POLR2A
ENCSR000EZL
r=0.76

small heat map img

HeLa-S3
Myers
POLR2A
ENCSR000DLM
r=0.72

small heat map img

HeLa-S3
Myers
H3K9ac
ENCSR000AOH
r=0.39

small heat map img

HeLa-S3
Myers
H3K4me3
ENCSR000AOF
r=0.37

small heat map img

HeLa-S3
Myers
H3K27ac
ENCSR000AOC
r=0.35

small heat map img

HeLa-S3
Myers
H3K4me3
ENCSR000DUA
r=0.35

small heat map img

HeLa-S3
Myers
H3K4me2
ENCSR000AOE
r=0.30

small heat map img

HeLa-S3
Myers
H2AFZ
ENCSR000AQN
r=0.24

small heat map img

HeLa-S3
Myers
H3K79me2
ENCSR000AOG
r=0.16

small heat map img

HeLa-S3
Myers
H3K4me1
ENCSR000APW
r=0.07

small heat map img

HeLa-S3
Myers
H4K20me1
ENCSR000AOI
r=0.05

small heat map img

HeLa-S3
Myers
H3K27me3
ENCSR000DTY
r=0.05

small heat map img

HeLa-S3
Myers
H3K36me3
ENCSR000DTZ
r=0.02

small heat map img

HeLa-S3
Myers
H3K9me3
ENCSR000AQO
r=-0.01

small heat map img

HeLa-S3
Myers
H3K27me3
ENCSR000APB
r=-0.02

small heat map img

HeLa-S3
Myers
H3K36me3
ENCSR000AOD
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 25,332 (download )

HeLa-S3 - Weissman - ENCSR000EZL

HeLa-S3
Weissman
POLR2A
ENCSR000EZL
r=1.00

small heat map img

HeLa-S3
Weissman
POLR2A
ENCSR000DLM
r=0.83

small heat map img

HeLa-S3
Weissman
POLR2A
ENCSR000BGO
r=0.76

small heat map img

HeLa-S3
Weissman
H3K4me3
ENCSR000AOF
r=0.47

small heat map img

HeLa-S3
Weissman
H3K9ac
ENCSR000AOH
r=0.47

small heat map img

HeLa-S3
Weissman
H3K4me3
ENCSR000DUA
r=0.45

small heat map img

HeLa-S3
Weissman
H3K27ac
ENCSR000AOC
r=0.42

small heat map img

HeLa-S3
Weissman
H3K4me2
ENCSR000AOE
r=0.38

small heat map img

HeLa-S3
Weissman
H2AFZ
ENCSR000AQN
r=0.36

small heat map img

HeLa-S3
Weissman
H3K79me2
ENCSR000AOG
r=0.18

small heat map img

HeLa-S3
Weissman
H3K4me1
ENCSR000APW
r=0.11

small heat map img

HeLa-S3
Weissman
H3K27me3
ENCSR000DTY
r=0.06

small heat map img

HeLa-S3
Weissman
H4K20me1
ENCSR000AOI
r=0.01

small heat map img

HeLa-S3
Weissman
H3K36me3
ENCSR000DTZ
r=-0.02

small heat map img

HeLa-S3
Weissman
H3K9me3
ENCSR000AQO
r=-0.02

small heat map img

HeLa-S3
Weissman
H3K27me3
ENCSR000APB
r=-0.04

small heat map img

HeLa-S3
Weissman
H3K36me3
ENCSR000AOD
r=-0.09

small heat map img
10,000 randomly-selected peaks from a total of 21,270 (download )

HepG2 - Iyer - ENCSR000DLQ

HepG2
Iyer
POLR2A
ENCSR000DLQ
r=1.00

small heat map img

HepG2
Iyer
POLR2A
ENCSR000BJM
r=0.66

small heat map img

HepG2
Iyer
POLR2A
ENCSR000EEP
r=0.63

small heat map img

HepG2
Iyer
POLR2A
ENCSR000EEM
r=0.59

small heat map img

HepG2
Iyer
POLR2A
ENCSR000EZQ
r=0.47

small heat map img

HepG2
Iyer
H3K4me3
ENCSR000AMP
r=0.42

small heat map img

HepG2
Iyer
H3K4me3
ENCSR000DUF
r=0.40

small heat map img

HepG2
Iyer
H3K9ac
ENCSR000AMD
r=0.39

small heat map img

HepG2
Iyer
H3K4me2
ENCSR000AMC
r=0.35

small heat map img

HepG2
Iyer
H3K27ac
ENCSR000AMO
r=0.32

small heat map img

HepG2
Iyer
H3K27me3
ENCSR000AOL
r=0.27

small heat map img

HepG2
Iyer
H2AFZ
ENCSR000AOK
r=0.25

small heat map img

HepG2
Iyer
H3K79me2
ENCSR000AOM
r=0.11

small heat map img

HepG2
Iyer
H4K20me1
ENCSR000AMQ
r=0.03

small heat map img

HepG2
Iyer
H3K27me3
ENCSR000DUE
r=0.02

small heat map img

HepG2
Iyer
H3K4me1
ENCSR000APV
r=0.01

small heat map img

HepG2
Iyer
H3K36me3
ENCSR000DUD
r=-0.05

small heat map img

HepG2
Iyer
H3K9me3
ENCSR000ATD
r=-0.06

small heat map img

HepG2
Iyer
H3K36me3
ENCSR000AMB
r=-0.08

small heat map img
10,000 randomly-selected peaks from a total of 15,108 (download )

HepG2 - Myers - ENCSR000BJM

HepG2
Myers
POLR2A
ENCSR000BJM
r=1.00

small heat map img

HepG2
Myers
POLR2A
ENCSR000EEP
r=0.79

small heat map img

HepG2
Myers
POLR2A
ENCSR000EEM
r=0.69

small heat map img

HepG2
Myers
POLR2A
ENCSR000DLQ
r=0.67

small heat map img

HepG2
Myers
POLR2A
ENCSR000EZQ
r=0.66

small heat map img

HepG2
Myers
H3K4me3
ENCSR000AMP
r=0.38

small heat map img

HepG2
Myers
H3K4me3
ENCSR000DUF
r=0.36

small heat map img

HepG2
Myers
H3K9ac
ENCSR000AMD
r=0.36

small heat map img

HepG2
Myers
H3K4me2
ENCSR000AMC
r=0.29

small heat map img

HepG2
Myers
H3K27ac
ENCSR000AMO
r=0.29

small heat map img

HepG2
Myers
H2AFZ
ENCSR000AOK
r=0.24

small heat map img

HepG2
Myers
H3K27me3
ENCSR000AOL
r=0.23

small heat map img

HepG2
Myers
H3K79me2
ENCSR000AOM
r=0.13

small heat map img

HepG2
Myers
H4K20me1
ENCSR000AMQ
r=0.04

small heat map img

HepG2
Myers
H3K27me3
ENCSR000DUE
r=0.03

small heat map img

HepG2
Myers
H3K4me1
ENCSR000APV
r=-0.01

small heat map img

HepG2
Myers
H3K9me3
ENCSR000ATD
r=-0.02

small heat map img

HepG2
Myers
H3K36me3
ENCSR000DUD
r=-0.03

small heat map img

HepG2
Myers
H3K36me3
ENCSR000AMB
r=-0.05

small heat map img
10,000 randomly-selected peaks from a total of 25,927 (download )

HepG2 - Snyder - ENCSR000EEM

HepG2
Snyder
POLR2A
ENCSR000EEM
r=1.00

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EZQ
r=0.83

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEP
r=0.75

small heat map img

HepG2
Snyder
POLR2A
ENCSR000BJM
r=0.68

small heat map img

HepG2
Snyder
POLR2A
ENCSR000DLQ
r=0.61

small heat map img

HepG2
Snyder
H3K9ac
ENCSR000AMD
r=0.36

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000AMP
r=0.34

small heat map img

HepG2
Snyder
H3K27ac
ENCSR000AMO
r=0.33

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000DUF
r=0.32

small heat map img

HepG2
Snyder
H3K4me2
ENCSR000AMC
r=0.27

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000AOL
r=0.25

small heat map img

HepG2
Snyder
H2AFZ
ENCSR000AOK
r=0.23

small heat map img

HepG2
Snyder
H3K79me2
ENCSR000AOM
r=0.13

small heat map img

HepG2
Snyder
H4K20me1
ENCSR000AMQ
r=0.08

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000DUE
r=0.05

small heat map img

HepG2
Snyder
H3K9me3
ENCSR000ATD
r=0.03

small heat map img

HepG2
Snyder
H3K4me1
ENCSR000APV
r=0.01

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000DUD
r=0.00

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000AMB
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 19,572 (download )

HepG2 - Snyder - ENCSR000EEP

HepG2
Snyder
POLR2A
ENCSR000EEP
r=1.00

small heat map img

HepG2
Snyder
POLR2A
ENCSR000BJM
r=0.80

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEM
r=0.79

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EZQ
r=0.74

small heat map img

HepG2
Snyder
POLR2A
ENCSR000DLQ
r=0.64

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000AMP
r=0.39

small heat map img

HepG2
Snyder
H3K9ac
ENCSR000AMD
r=0.38

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000DUF
r=0.37

small heat map img

HepG2
Snyder
H3K27ac
ENCSR000AMO
r=0.32

small heat map img

HepG2
Snyder
H3K4me2
ENCSR000AMC
r=0.29

small heat map img

HepG2
Snyder
H2AFZ
ENCSR000AOK
r=0.26

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000AOL
r=0.23

small heat map img

HepG2
Snyder
H3K79me2
ENCSR000AOM
r=0.13

small heat map img

HepG2
Snyder
H4K20me1
ENCSR000AMQ
r=0.04

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000DUE
r=0.03

small heat map img

HepG2
Snyder
H3K4me1
ENCSR000APV
r=-0.01

small heat map img

HepG2
Snyder
H3K9me3
ENCSR000ATD
r=-0.01

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000DUD
r=-0.04

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000AMB
r=-0.06

small heat map img
10,000 randomly-selected peaks from a total of 22,928 (download )

HepG2 - Weissman - ENCSR000EZQ

HepG2
Weissman
POLR2A
ENCSR000EZQ
r=1.00

small heat map img

HepG2
Weissman
POLR2A
ENCSR000EEM
r=0.86

small heat map img

HepG2
Weissman
POLR2A
ENCSR000EEP
r=0.69

small heat map img

HepG2
Weissman
POLR2A
ENCSR000BJM
r=0.69

small heat map img

HepG2
Weissman
POLR2A
ENCSR000DLQ
r=0.53

small heat map img

HepG2
Weissman
H3K4me3
ENCSR000AMP
r=0.33

small heat map img

HepG2
Weissman
H3K9ac
ENCSR000AMD
r=0.32

small heat map img

HepG2
Weissman
H3K27ac
ENCSR000AMO
r=0.31

small heat map img

HepG2
Weissman
H3K4me3
ENCSR000DUF
r=0.31

small heat map img

HepG2
Weissman
H2AFZ
ENCSR000AOK
r=0.23

small heat map img

HepG2
Weissman
H3K27me3
ENCSR000AOL
r=0.22

small heat map img

HepG2
Weissman
H3K4me2
ENCSR000AMC
r=0.20

small heat map img

HepG2
Weissman
H3K27me3
ENCSR000DUE
r=0.05

small heat map img

HepG2
Weissman
H3K79me2
ENCSR000AOM
r=0.03

small heat map img

HepG2
Weissman
H4K20me1
ENCSR000AMQ
r=-0.01

small heat map img

HepG2
Weissman
H3K9me3
ENCSR000ATD
r=-0.02

small heat map img

HepG2
Weissman
H3K36me3
ENCSR000DUD
r=-0.05

small heat map img

HepG2
Weissman
H3K4me1
ENCSR000APV
r=-0.06

small heat map img

HepG2
Weissman
H3K36me3
ENCSR000AMB
r=-0.10

small heat map img
3,438 peaks (download )

IMR-90 - Snyder - ENCSR000EFK

IMR-90
Snyder
POLR2A
ENCSR000EFK
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 17,647 (download )

Ishikawa - Myers - ENCSR000BKI

Ishikawa
Myers
POLR2A
ENCSR000BKI
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 20,137 (download )

K562 - Iyer - ENCSR000DLY

K562
Iyer
POLR2A
ENCSR000DLY
r=1.00

small heat map img

K562
Iyer
POLR2A
ENCSR000FAW
r=0.82

small heat map img

K562
Iyer
POLR2A
ENCSR000FAY
r=0.81

small heat map img

K562
Iyer
POLR2A
ENCSR000FAJ
r=0.80

small heat map img

K562
Iyer
POLR2A
ENCSR000FAX
r=0.79

small heat map img

K562
Iyer
POLR2A
ENCSR000EHP
r=0.78

small heat map img

K562
Iyer
POLR2A
ENCSR000BMR
r=0.74

small heat map img

K562
Iyer
H3K4me3
ENCSR000AKU
r=0.46

small heat map img

K562
Iyer
H3K4me3
ENCSR000DWD
r=0.45

small heat map img

K562
Iyer
H3K4me2
ENCSR000AKT
r=0.44

small heat map img

K562
Iyer
H3K9ac
ENCSR000AKV
r=0.44

small heat map img

K562
Iyer
H3K9ac
ENCSR000EVZ
r=0.44

small heat map img

K562
Iyer
H3K4me3
ENCSR000EWA
r=0.42

small heat map img

K562
Iyer
POLR2A
ENCSR000EHL
r=0.41

small heat map img

K562
Iyer
H3K27ac
ENCSR000AKP
r=0.39

small heat map img

K562
Iyer
H2AFZ
ENCSR000APC
r=0.34

small heat map img

K562
Iyer
H3K79me2
ENCSR000APD
r=0.22

small heat map img

K562
Iyer
H3K4me1
ENCSR000EWC
r=0.19

small heat map img

K562
Iyer
H4K20me1
ENCSR000AKX
r=0.11

small heat map img

K562
Iyer
H3K4me1
ENCSR000AKS
r=0.03

small heat map img

K562
Iyer
H3K9me1
ENCSR000AKW
r=0.02

small heat map img

K562
Iyer
H3K27me3
ENCSR000DWC
r=0.01

small heat map img

K562
Iyer
H3K27me3
ENCSR000AKQ
r=0.01

small heat map img

K562
Iyer
H3K9me3
ENCSR000APE
r=0.00

small heat map img

K562
Iyer
H3K36me3
ENCSR000AKR
r=-0.02

small heat map img

K562
Iyer
H3K36me3
ENCSR000DWB
r=-0.03

small heat map img

K562
Iyer
H3K27me3
ENCSR000EWB
r=-0.05

small heat map img
10,000 randomly-selected peaks from a total of 19,255 (download )

K562 - Myers - ENCSR000BMR

K562
Myers
POLR2A
ENCSR000BMR
r=1.00

small heat map img

K562
Myers
POLR2A
ENCSR000FAJ
r=0.81

small heat map img

K562
Myers
POLR2A
ENCSR000EHP
r=0.80

small heat map img

K562
Myers
POLR2A
ENCSR000FAW
r=0.79

small heat map img

K562
Myers
POLR2A
ENCSR000FAY
r=0.78

small heat map img

K562
Myers
POLR2A
ENCSR000FAX
r=0.78

small heat map img

K562
Myers
POLR2A
ENCSR000DLY
r=0.69

small heat map img

K562
Myers
H3K9ac
ENCSR000AKV
r=0.39

small heat map img

K562
Myers
POLR2A
ENCSR000EHL
r=0.39

small heat map img

K562
Myers
H3K4me3
ENCSR000AKU
r=0.38

small heat map img

K562
Myers
H3K4me2
ENCSR000AKT
r=0.36

small heat map img

K562
Myers
H3K4me3
ENCSR000DWD
r=0.35

small heat map img

K562
Myers
H3K27ac
ENCSR000AKP
r=0.34

small heat map img

K562
Myers
H3K9ac
ENCSR000EVZ
r=0.34

small heat map img

K562
Myers
H3K4me3
ENCSR000EWA
r=0.34

small heat map img

K562
Myers
H2AFZ
ENCSR000APC
r=0.27

small heat map img

K562
Myers
H3K79me2
ENCSR000APD
r=0.22

small heat map img

K562
Myers
H4K20me1
ENCSR000AKX
r=0.13

small heat map img

K562
Myers
H3K4me1
ENCSR000EWC
r=0.09

small heat map img

K562
Myers
H3K9me3
ENCSR000APE
r=0.05

small heat map img

K562
Myers
H3K9me1
ENCSR000AKW
r=0.04

small heat map img

K562
Myers
H3K36me3
ENCSR000AKR
r=0.04

small heat map img

K562
Myers
H3K4me1
ENCSR000AKS
r=0.03

small heat map img

K562
Myers
H3K27me3
ENCSR000AKQ
r=0.03

small heat map img

K562
Myers
H3K27me3
ENCSR000DWC
r=0.01

small heat map img

K562
Myers
H3K36me3
ENCSR000DWB
r=-0.02

small heat map img

K562
Myers
H3K27me3
ENCSR000EWB
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 24,989 (download )

K562 - Snyder - ENCSR000EHL

K562
Snyder
POLR2A
ENCSR000EHL
r=1.00

small heat map img

K562
Snyder
POLR2A
ENCSR000DLY
r=0.46

small heat map img

K562
Snyder
POLR2A
ENCSR000FAX
r=0.43

small heat map img

K562
Snyder
POLR2A
ENCSR000FAY
r=0.42

small heat map img

K562
Snyder
POLR2A
ENCSR000BMR
r=0.38

small heat map img

K562
Snyder
POLR2A
ENCSR000EHP
r=0.38

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.38

small heat map img

K562
Snyder
POLR2A
ENCSR000FAJ
r=0.38

small heat map img

K562
Snyder
POLR2A
ENCSR000FAW
r=0.37

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.36

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.34

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.34

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.32

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.29

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.29

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.27

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.25

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.23

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.17

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.17

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.15

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.10

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=0.09

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=0.07

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=0.05

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=0.03

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.01

small heat map img
9,974 peaks (download )

K562 - Snyder - ENCSR000EHP

K562
Snyder
POLR2A
ENCSR000EHP
r=1.00

small heat map img

K562
Snyder
POLR2A
ENCSR000FAW
r=0.95

small heat map img

K562
Snyder
POLR2A
ENCSR000FAY
r=0.93

small heat map img

K562
Snyder
POLR2A
ENCSR000FAX
r=0.92

small heat map img

K562
Snyder
POLR2A
ENCSR000FAJ
r=0.90

small heat map img

K562
Snyder
POLR2A
ENCSR000BMR
r=0.83

small heat map img

K562
Snyder
POLR2A
ENCSR000DLY
r=0.77

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.41

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.41

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.39

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.39

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.39

small heat map img

K562
Snyder
POLR2A
ENCSR000EHL
r=0.38

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.38

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.38

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.35

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.18

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.12

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.10

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.05

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=0.04

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.04

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.03

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=-0.00

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.03

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 16,558 (download )

K562 - Weissman - ENCSR000FAJ

K562
Weissman
POLR2A
ENCSR000FAJ
r=1.00

small heat map img

K562
Weissman
POLR2A
ENCSR000FAW
r=0.91

small heat map img

K562
Weissman
POLR2A
ENCSR000EHP
r=0.90

small heat map img

K562
Weissman
POLR2A
ENCSR000FAY
r=0.87

small heat map img

K562
Weissman
POLR2A
ENCSR000FAX
r=0.85

small heat map img

K562
Weissman
POLR2A
ENCSR000BMR
r=0.83

small heat map img

K562
Weissman
POLR2A
ENCSR000DLY
r=0.78

small heat map img

K562
Weissman
H3K9ac
ENCSR000AKV
r=0.43

small heat map img

K562
Weissman
H3K4me3
ENCSR000AKU
r=0.43

small heat map img

K562
Weissman
H3K4me3
ENCSR000DWD
r=0.42

small heat map img

K562
Weissman
H3K9ac
ENCSR000EVZ
r=0.42

small heat map img

K562
Weissman
H3K4me2
ENCSR000AKT
r=0.42

small heat map img

K562
Weissman
H3K4me3
ENCSR000EWA
r=0.41

small heat map img

K562
Weissman
H3K27ac
ENCSR000AKP
r=0.39

small heat map img

K562
Weissman
H2AFZ
ENCSR000APC
r=0.37

small heat map img

K562
Weissman
POLR2A
ENCSR000EHL
r=0.33

small heat map img

K562
Weissman
H3K79me2
ENCSR000APD
r=0.19

small heat map img

K562
Weissman
H3K4me1
ENCSR000EWC
r=0.13

small heat map img

K562
Weissman
H4K20me1
ENCSR000AKX
r=0.09

small heat map img

K562
Weissman
H3K9me3
ENCSR000APE
r=0.03

small heat map img

K562
Weissman
H3K27me3
ENCSR000AKQ
r=0.03

small heat map img

K562
Weissman
H3K4me1
ENCSR000AKS
r=0.02

small heat map img

K562
Weissman
H3K9me1
ENCSR000AKW
r=0.02

small heat map img

K562
Weissman
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Weissman
H3K36me3
ENCSR000AKR
r=-0.03

small heat map img

K562
Weissman
H3K27me3
ENCSR000EWB
r=-0.04

small heat map img

K562
Weissman
H3K36me3
ENCSR000DWB
r=-0.07

small heat map img
10,000 randomly-selected peaks from a total of 18,081 (download )

K562 - Weissman - ENCSR000FAW

K562
Weissman
POLR2A
ENCSR000FAW
r=1.00

small heat map img

K562
Weissman
POLR2A
ENCSR000EHP
r=0.95

small heat map img

K562
Weissman
POLR2A
ENCSR000FAY
r=0.95

small heat map img

K562
Weissman
POLR2A
ENCSR000FAX
r=0.93

small heat map img

K562
Weissman
POLR2A
ENCSR000FAJ
r=0.91

small heat map img

K562
Weissman
POLR2A
ENCSR000BMR
r=0.83

small heat map img

K562
Weissman
POLR2A
ENCSR000DLY
r=0.82

small heat map img

K562
Weissman
H3K4me3
ENCSR000AKU
r=0.47

small heat map img

K562
Weissman
H3K9ac
ENCSR000AKV
r=0.46

small heat map img

K562
Weissman
H3K4me2
ENCSR000AKT
r=0.45

small heat map img

K562
Weissman
H3K4me3
ENCSR000DWD
r=0.45

small heat map img

K562
Weissman
H3K9ac
ENCSR000EVZ
r=0.44

small heat map img

K562
Weissman
H3K4me3
ENCSR000EWA
r=0.43

small heat map img

K562
Weissman
H3K27ac
ENCSR000AKP
r=0.42

small heat map img

K562
Weissman
H2AFZ
ENCSR000APC
r=0.39

small heat map img

K562
Weissman
POLR2A
ENCSR000EHL
r=0.38

small heat map img

K562
Weissman
H3K79me2
ENCSR000APD
r=0.22

small heat map img

K562
Weissman
H3K4me1
ENCSR000EWC
r=0.13

small heat map img

K562
Weissman
H4K20me1
ENCSR000AKX
r=0.11

small heat map img

K562
Weissman
H3K9me3
ENCSR000APE
r=0.06

small heat map img

K562
Weissman
H3K27me3
ENCSR000AKQ
r=0.04

small heat map img

K562
Weissman
H3K9me1
ENCSR000AKW
r=0.03

small heat map img

K562
Weissman
H3K4me1
ENCSR000AKS
r=0.03

small heat map img

K562
Weissman
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Weissman
H3K36me3
ENCSR000AKR
r=-0.01

small heat map img

K562
Weissman
H3K27me3
ENCSR000EWB
r=-0.03

small heat map img

K562
Weissman
H3K36me3
ENCSR000DWB
r=-0.05

small heat map img
10,000 randomly-selected peaks from a total of 16,522 (download )

K562 - Weissman - ENCSR000FAX

K562
Weissman
POLR2A
ENCSR000FAX
r=1.00

small heat map img

K562
Weissman
POLR2A
ENCSR000FAY
r=0.97

small heat map img

K562
Weissman
POLR2A
ENCSR000FAW
r=0.94

small heat map img

K562
Weissman
POLR2A
ENCSR000EHP
r=0.92

small heat map img

K562
Weissman
POLR2A
ENCSR000FAJ
r=0.85

small heat map img

K562
Weissman
POLR2A
ENCSR000BMR
r=0.81

small heat map img

K562
Weissman
POLR2A
ENCSR000DLY
r=0.80

small heat map img

K562
Weissman
H3K9ac
ENCSR000AKV
r=0.46

small heat map img

K562
Weissman
H3K4me3
ENCSR000AKU
r=0.46

small heat map img

K562
Weissman
H3K4me2
ENCSR000AKT
r=0.44

small heat map img

K562
Weissman
POLR2A
ENCSR000EHL
r=0.44

small heat map img

K562
Weissman
H3K27ac
ENCSR000AKP
r=0.43

small heat map img

K562
Weissman
H3K4me3
ENCSR000DWD
r=0.42

small heat map img

K562
Weissman
H3K9ac
ENCSR000EVZ
r=0.42

small heat map img

K562
Weissman
H3K4me3
ENCSR000EWA
r=0.41

small heat map img

K562
Weissman
H2AFZ
ENCSR000APC
r=0.39

small heat map img

K562
Weissman
H3K79me2
ENCSR000APD
r=0.20

small heat map img

K562
Weissman
H3K4me1
ENCSR000EWC
r=0.13

small heat map img

K562
Weissman
H4K20me1
ENCSR000AKX
r=0.11

small heat map img

K562
Weissman
H3K9me3
ENCSR000APE
r=0.08

small heat map img

K562
Weissman
H3K27me3
ENCSR000AKQ
r=0.06

small heat map img

K562
Weissman
H3K9me1
ENCSR000AKW
r=0.05

small heat map img

K562
Weissman
H3K4me1
ENCSR000AKS
r=0.05

small heat map img

K562
Weissman
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Weissman
H3K36me3
ENCSR000AKR
r=-0.01

small heat map img

K562
Weissman
H3K27me3
ENCSR000EWB
r=-0.02

small heat map img

K562
Weissman
H3K36me3
ENCSR000DWB
r=-0.05

small heat map img
10,000 randomly-selected peaks from a total of 13,582 (download )

K562 - Weissman - ENCSR000FAY

K562
Weissman
POLR2A
ENCSR000FAY
r=1.00

small heat map img

K562
Weissman
POLR2A
ENCSR000FAX
r=0.96

small heat map img

K562
Weissman
POLR2A
ENCSR000FAW
r=0.95

small heat map img

K562
Weissman
POLR2A
ENCSR000EHP
r=0.92

small heat map img

K562
Weissman
POLR2A
ENCSR000FAJ
r=0.86

small heat map img

K562
Weissman
POLR2A
ENCSR000BMR
r=0.82

small heat map img

K562
Weissman
POLR2A
ENCSR000DLY
r=0.82

small heat map img

K562
Weissman
H3K4me3
ENCSR000AKU
r=0.48

small heat map img

K562
Weissman
H3K9ac
ENCSR000AKV
r=0.48

small heat map img

K562
Weissman
H3K4me2
ENCSR000AKT
r=0.46

small heat map img

K562
Weissman
H3K27ac
ENCSR000AKP
r=0.45

small heat map img

K562
Weissman
H3K4me3
ENCSR000DWD
r=0.44

small heat map img

K562
Weissman
H3K9ac
ENCSR000EVZ
r=0.44

small heat map img

K562
Weissman
POLR2A
ENCSR000EHL
r=0.43

small heat map img

K562
Weissman
H3K4me3
ENCSR000EWA
r=0.43

small heat map img

K562
Weissman
H2AFZ
ENCSR000APC
r=0.40

small heat map img

K562
Weissman
H3K79me2
ENCSR000APD
r=0.21

small heat map img

K562
Weissman
H3K4me1
ENCSR000EWC
r=0.14

small heat map img

K562
Weissman
H4K20me1
ENCSR000AKX
r=0.12

small heat map img

K562
Weissman
H3K9me3
ENCSR000APE
r=0.08

small heat map img

K562
Weissman
H3K27me3
ENCSR000AKQ
r=0.06

small heat map img

K562
Weissman
H3K4me1
ENCSR000AKS
r=0.05

small heat map img

K562
Weissman
H3K9me1
ENCSR000AKW
r=0.05

small heat map img

K562
Weissman
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Weissman
H3K36me3
ENCSR000AKR
r=-0.00

small heat map img

K562
Weissman
H3K27me3
ENCSR000EWB
r=-0.02

small heat map img

K562
Weissman
H3K36me3
ENCSR000DWB
r=-0.05

small heat map img
10,000 randomly-selected peaks from a total of 13,845 (download )

MCF 10A - Struhl - ENCSR000DPA

MCF 10A
Struhl
POLR2A
ENCSR000DPA
r=1.00

small heat map img

MCF 10A
Struhl
POLR2A
ENCSR000DPC
r=0.92

small heat map img
10,000 randomly-selected peaks from a total of 22,298 (download )

MCF 10A - Struhl - ENCSR000DPC

MCF 10A
Struhl
POLR2A
ENCSR000DPC
r=1.00

small heat map img

MCF 10A
Struhl
POLR2A
ENCSR000DPA
r=0.91

small heat map img
10,000 randomly-selected peaks from a total of 19,467 (download )

MCF-7 - Iyer - ENCSR000DMK

MCF-7
Iyer
POLR2A
ENCSR000DMK
r=1.00

small heat map img

MCF-7
Iyer
POLR2A
ENCSR000DMN
r=0.94

small heat map img

MCF-7
Iyer
POLR2A
ENCSR000DMT
r=0.90

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.50

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.24

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.14

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.18

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.20

small heat map img
10,000 randomly-selected peaks from a total of 19,412 (download )

MCF-7 - Iyer - ENCSR000DMN

MCF-7
Iyer
POLR2A
ENCSR000DMN
r=1.00

small heat map img

MCF-7
Iyer
POLR2A
ENCSR000DMK
r=0.94

small heat map img

MCF-7
Iyer
POLR2A
ENCSR000DMT
r=0.86

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.48

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.25

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.12

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.16

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.17

small heat map img
10,000 randomly-selected peaks from a total of 20,449 (download )

MCF-7 - Iyer - ENCSR000DMT

MCF-7
Iyer
POLR2A
ENCSR000DMT
r=1.00

small heat map img

MCF-7
Iyer
POLR2A
ENCSR000DMK
r=0.86

small heat map img

MCF-7
Iyer
POLR2A
ENCSR000DMN
r=0.83

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.49

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.32

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.07

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.11

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.14

small heat map img
10,000 randomly-selected peaks from a total of 16,136 (download )

NB4 - Weissman - ENCSR000FAL

NB4
Weissman
POLR2A
ENCSR000FAL
r=1.00

small heat map img

NB4
Weissman
H3K4me3
ENCSR000DWP
r=0.41

small heat map img
10,000 randomly-selected peaks from a total of 16,703 (download )

Raji - Farnham - ENCSR000EXX

Raji
Farnham
POLR2A
ENCSR000EXX
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 19,732 (download )

endothelial cell of umbilical vein - Iyer - ENCSR000DLV

endothelial cell of umbilical vein
Iyer
POLR2A
ENCSR000DLV
r=1.00

small heat map img

endothelial cell of umbilical vein
Iyer
POLR2A
ENCSR000BQB
r=0.67

small heat map img

endothelial cell of umbilical vein
Iyer
POLR2A
ENCSR000EFB
r=0.59

small heat map img

endothelial cell of umbilical vein
Iyer
H3K4me3
ENCSR000DVN
r=0.44

small heat map img

endothelial cell of umbilical vein
Iyer
H3K9ac
ENCSR000ALD
r=0.43

small heat map img

endothelial cell of umbilical vein
Iyer
H3K4me3
ENCSR000AKN
r=0.41

small heat map img

endothelial cell of umbilical vein
Iyer
H2AFZ
ENCSR000ASC
r=0.38

small heat map img

endothelial cell of umbilical vein
Iyer
H3K27ac
ENCSR000ALB
r=0.36

small heat map img

endothelial cell of umbilical vein
Iyer
H3K4me2
ENCSR000AKM
r=0.36

small heat map img

endothelial cell of umbilical vein
Iyer
H3K4me1
ENCSR000AKL
r=0.17

small heat map img

endothelial cell of umbilical vein
Iyer
H3K79me2
ENCSR000ASD
r=0.14

small heat map img

endothelial cell of umbilical vein
Iyer
H3K9me3
ENCSR000ATB
r=0.03

small heat map img

endothelial cell of umbilical vein
Iyer
H3K27me3
ENCSR000AKK
r=-0.03

small heat map img

endothelial cell of umbilical vein
Iyer
H4K20me1
ENCSR000ALF
r=-0.04

small heat map img

endothelial cell of umbilical vein
Iyer
H3K36me3
ENCSR000DVM
r=-0.04

small heat map img

endothelial cell of umbilical vein
Iyer
H3K9me1
ENCSR000ALE
r=-0.05

small heat map img

endothelial cell of umbilical vein
Iyer
H3K36me3
ENCSR000ALC
r=-0.06

small heat map img

endothelial cell of umbilical vein
Iyer
H3K27me3
ENCSR000DVO
r=-0.13

small heat map img
10,000 randomly-selected peaks from a total of 17,190 (download )

endothelial cell of umbilical vein - Myers - ENCSR000BQB

endothelial cell of umbilical vein
Myers
POLR2A
ENCSR000BQB
r=1.00

small heat map img

endothelial cell of umbilical vein
Myers
POLR2A
ENCSR000EFB
r=0.68

small heat map img

endothelial cell of umbilical vein
Myers
POLR2A
ENCSR000DLV
r=0.65

small heat map img

endothelial cell of umbilical vein
Myers
H3K9ac
ENCSR000ALD
r=0.33

small heat map img

endothelial cell of umbilical vein
Myers
H3K4me3
ENCSR000AKN
r=0.29

small heat map img

endothelial cell of umbilical vein
Myers
H3K27ac
ENCSR000ALB
r=0.28

small heat map img

endothelial cell of umbilical vein
Myers
H3K4me3
ENCSR000DVN
r=0.27

small heat map img

endothelial cell of umbilical vein
Myers
H3K4me2
ENCSR000AKM
r=0.25

small heat map img

endothelial cell of umbilical vein
Myers
H2AFZ
ENCSR000ASC
r=0.20

small heat map img

endothelial cell of umbilical vein
Myers
H3K4me1
ENCSR000AKL
r=0.11

small heat map img

endothelial cell of umbilical vein
Myers
H3K79me2
ENCSR000ASD
r=0.10

small heat map img

endothelial cell of umbilical vein
Myers
H3K9me3
ENCSR000ATB
r=0.04

small heat map img

endothelial cell of umbilical vein
Myers
H3K36me3
ENCSR000ALC
r=0.03

small heat map img

endothelial cell of umbilical vein
Myers
H4K20me1
ENCSR000ALF
r=0.03

small heat map img

endothelial cell of umbilical vein
Myers
H3K36me3
ENCSR000DVM
r=0.01

small heat map img

endothelial cell of umbilical vein
Myers
H3K27me3
ENCSR000AKK
r=0.01

small heat map img

endothelial cell of umbilical vein
Myers
H3K9me1
ENCSR000ALE
r=-0.03

small heat map img

endothelial cell of umbilical vein
Myers
H3K27me3
ENCSR000DVO
r=-0.07

small heat map img
10,000 randomly-selected peaks from a total of 19,254 (download )

endothelial cell of umbilical vein - Snyder - ENCSR000EFB

endothelial cell of umbilical vein
Snyder
POLR2A
ENCSR000EFB
r=1.00

small heat map img

endothelial cell of umbilical vein
Snyder
POLR2A
ENCSR000BQB
r=0.66

small heat map img

endothelial cell of umbilical vein
Snyder
POLR2A
ENCSR000DLV
r=0.57

small heat map img

endothelial cell of umbilical vein
Snyder
H3K9ac
ENCSR000ALD
r=0.34

small heat map img

endothelial cell of umbilical vein
Snyder
H3K27ac
ENCSR000ALB
r=0.31

small heat map img

endothelial cell of umbilical vein
Snyder
H3K4me3
ENCSR000DVN
r=0.28

small heat map img

endothelial cell of umbilical vein
Snyder
H3K4me3
ENCSR000AKN
r=0.28

small heat map img

endothelial cell of umbilical vein
Snyder
H3K4me2
ENCSR000AKM
r=0.23

small heat map img

endothelial cell of umbilical vein
Snyder
H2AFZ
ENCSR000ASC
r=0.18

small heat map img

endothelial cell of umbilical vein
Snyder
H3K4me1
ENCSR000AKL
r=0.10

small heat map img

endothelial cell of umbilical vein
Snyder
H3K79me2
ENCSR000ASD
r=0.08

small heat map img

endothelial cell of umbilical vein
Snyder
H3K9me3
ENCSR000ATB
r=0.05

small heat map img

endothelial cell of umbilical vein
Snyder
H3K27me3
ENCSR000AKK
r=0.03

small heat map img

endothelial cell of umbilical vein
Snyder
H3K36me3
ENCSR000ALC
r=0.01

small heat map img

endothelial cell of umbilical vein
Snyder
H4K20me1
ENCSR000ALF
r=-0.00

small heat map img

endothelial cell of umbilical vein
Snyder
H3K36me3
ENCSR000DVM
r=-0.02

small heat map img

endothelial cell of umbilical vein
Snyder
H3K9me1
ENCSR000ALE
r=-0.05

small heat map img

endothelial cell of umbilical vein
Snyder
H3K27me3
ENCSR000DVO
r=-0.07

small heat map img
10,000 randomly-selected peaks from a total of 12,305 (download )

erythroblast - Farnham - ENCSR000EXO

erythroblast
Farnham
POLR2A
ENCSR000EXO
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 18,332 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at POLR2A peaks

A549 - Iyer - ENCSR000DMZ

A549
Iyer
POLR2A
ENCSR000DMZ
r=1.00

small heat map img

A549
Iyer
POLR2A
ENCSR000BHI
r=0.74

small heat map img

A549
Iyer
POLR2A
ENCSR000BHH
r=0.72

small heat map img

A549
Iyer
TAF1
ENCSR000BPF
r=0.59

small heat map img

A549
Iyer
MAX
ENCSR000BTJ
r=0.52

small heat map img

A549
Iyer
MAX
ENCSR000DYG
r=0.48

small heat map img

A549
Iyer
MYC
ENCSR000DYC
r=0.47

small heat map img

A549
Iyer
YY1
ENCSR000BPM
r=0.43

small heat map img

A549
Iyer
CREB1
ENCSR000BRB
r=0.42

small heat map img

A549
Iyer
E2F6
ENCSR000BTC
r=0.41

small heat map img

A549
Iyer
SP1
ENCSR000BPE
r=0.40

small heat map img

A549
Iyer
REST
ENCSR000BQP
r=0.36

small heat map img

A549
Iyer
GATA3
ENCSR000BTI
r=0.34

small heat map img

A549
Iyer
TEAD4
ENCSR000BUD
r=0.34

small heat map img

A549
Iyer
PBX3
ENCSR000BTN
r=0.34

small heat map img

A549
Iyer
NR3C1
ENCSR000BJR
r=0.33

small heat map img

A549
Iyer
ETS1
ENCSR000BPU
r=0.32

small heat map img

A549
Iyer
SIN3A
ENCSR000BRM
r=0.31

small heat map img

A549
Iyer
GABPA
ENCSR000BPY
r=0.30

small heat map img

A549
Iyer
BHLHE40
ENCSR000DYJ
r=0.28

small heat map img

A549
Iyer
ZBTB33
ENCSR000BPZ
r=0.27

small heat map img

A549
Iyer
SIX5
ENCSR000BRL
r=0.26

small heat map img

A549
Iyer
CEBPB
ENCSR000BUB
r=0.25

small heat map img

A549
Iyer
RAD21
ENCSR000DYE
r=0.25

small heat map img

A549
Iyer
CTCF
ENCSR000DNA
r=0.24

small heat map img

A549
Iyer
ELF1
ENCSR000BPT
r=0.24

small heat map img

A549
Iyer
FOXA2
ENCSR000BRE
r=0.23

small heat map img

A549
Iyer
USF1
ENCSR000BHX
r=0.23

small heat map img

A549
Iyer
RAD21
ENCSR000BUC
r=0.23

small heat map img

A549
Iyer
CTCF
ENCSR000DYD
r=0.21

small heat map img

A549
Iyer
TCF12
ENCSR000BQQ
r=0.20

small heat map img

A549
Iyer
CEBPB
ENCSR000DYI
r=0.19

small heat map img

A549
Iyer
USF1
ENCSR000BJB
r=0.19

small heat map img

A549
Iyer
JUND
ENCSR000BRF
r=0.18

small heat map img

A549
Iyer
ATF3
ENCSR000BPS
r=0.17

small heat map img

A549
Iyer
USF1
ENCSR000BPV
r=0.16

small heat map img

A549
Iyer
FOSL2
ENCSR000BQO
r=0.15

small heat map img

A549
Iyer
BCL3
ENCSR000BQH
r=0.15

small heat map img

A549
Iyer
CTCF
ENCSR000AUF
r=0.14

small heat map img

A549
Iyer
EP300
ENCSR000BPW
r=0.12

small heat map img

A549
Iyer
CTCF
ENCSR000AUE
r=0.11

small heat map img

A549
Iyer
NR3C1
ENCSR000BHF
r=0.11

small heat map img

A549
Iyer
NR3C1
ENCSR000BHE
r=0.07

small heat map img

A549
Iyer
CTCF
ENCSR000BHV
r=0.07

small heat map img

A549
Iyer
CTCF
ENCSR000DPF
r=0.06

small heat map img

A549
Iyer
CTCF
ENCSR000BHW
r=0.06

small heat map img

A549
Iyer
NR3C1
ENCSR000BHG
r=0.02

small heat map img

A549
Iyer
FOXA1
ENCSR000BPX
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 17,011 (download )

A549 - Myers - ENCSR000BHH

A549
Myers
POLR2A
ENCSR000BHH
r=1.00

small heat map img

A549
Myers
POLR2A
ENCSR000BHI
r=0.95

small heat map img

A549
Myers
POLR2A
ENCSR000DMZ
r=0.70

small heat map img

A549
Myers
MAX
ENCSR000BTJ
r=0.51

small heat map img

A549
Myers
TAF1
ENCSR000BPF
r=0.51

small heat map img

A549
Myers
MAX
ENCSR000DYG
r=0.44

small heat map img

A549
Myers
MYC
ENCSR000DYC
r=0.43

small heat map img

A549
Myers
CREB1
ENCSR000BRB
r=0.42

small heat map img

A549
Myers
NR3C1
ENCSR000BJR
r=0.41

small heat map img

A549
Myers
YY1
ENCSR000BPM
r=0.41

small heat map img

A549
Myers
E2F6
ENCSR000BTC
r=0.38

small heat map img

A549
Myers
SP1
ENCSR000BPE
r=0.36

small heat map img

A549
Myers
PBX3
ENCSR000BTN
r=0.36

small heat map img

A549
Myers
REST
ENCSR000BQP
r=0.35

small heat map img

A549
Myers
GATA3
ENCSR000BTI
r=0.34

small heat map img

A549
Myers
SIN3A
ENCSR000BRM
r=0.33

small heat map img

A549
Myers
TEAD4
ENCSR000BUD
r=0.32

small heat map img

A549
Myers
ETS1
ENCSR000BPU
r=0.32

small heat map img

A549
Myers
BHLHE40
ENCSR000DYJ
r=0.26

small heat map img

A549
Myers
GABPA
ENCSR000BPY
r=0.26

small heat map img

A549
Myers
SIX5
ENCSR000BRL
r=0.25

small heat map img

A549
Myers
ZBTB33
ENCSR000BPZ
r=0.25

small heat map img

A549
Myers
USF1
ENCSR000BHX
r=0.23

small heat map img

A549
Myers
TCF12
ENCSR000BQQ
r=0.22

small heat map img

A549
Myers
RAD21
ENCSR000DYE
r=0.21

small heat map img

A549
Myers
ELF1
ENCSR000BPT
r=0.20

small heat map img

A549
Myers
CEBPB
ENCSR000BUB
r=0.20

small heat map img

A549
Myers
USF1
ENCSR000BJB
r=0.19

small heat map img

A549
Myers
RAD21
ENCSR000BUC
r=0.19

small heat map img

A549
Myers
CTCF
ENCSR000DYD
r=0.19

small heat map img

A549
Myers
JUND
ENCSR000BRF
r=0.18

small heat map img

A549
Myers
FOXA2
ENCSR000BRE
r=0.18

small heat map img

A549
Myers
CTCF
ENCSR000DNA
r=0.18

small heat map img

A549
Myers
ATF3
ENCSR000BPS
r=0.18

small heat map img

A549
Myers
FOSL2
ENCSR000BQO
r=0.15

small heat map img

A549
Myers
USF1
ENCSR000BPV
r=0.15

small heat map img

A549
Myers
CEBPB
ENCSR000DYI
r=0.15

small heat map img

A549
Myers
BCL3
ENCSR000BQH
r=0.14

small heat map img

A549
Myers
CTCF
ENCSR000AUF
r=0.12

small heat map img

A549
Myers
NR3C1
ENCSR000BHF
r=0.12

small heat map img

A549
Myers
NR3C1
ENCSR000BHE
r=0.11

small heat map img

A549
Myers
CTCF
ENCSR000AUE
r=0.10

small heat map img

A549
Myers
EP300
ENCSR000BPW
r=0.09

small heat map img

A549
Myers
CTCF
ENCSR000BHV
r=0.09

small heat map img

A549
Myers
CTCF
ENCSR000BHW
r=0.08

small heat map img

A549
Myers
CTCF
ENCSR000DPF
r=0.05

small heat map img

A549
Myers
NR3C1
ENCSR000BHG
r=0.04

small heat map img

A549
Myers
FOXA1
ENCSR000BPX
r=0.00

small heat map img
10,000 randomly-selected peaks from a total of 27,685 (download )

A549 - Myers - ENCSR000BHI

A549
Myers
POLR2A
ENCSR000BHI
r=1.00

small heat map img

A549
Myers
POLR2A
ENCSR000BHH
r=0.94

small heat map img

A549
Myers
POLR2A
ENCSR000DMZ
r=0.74

small heat map img

A549
Myers
MAX
ENCSR000BTJ
r=0.54

small heat map img

A549
Myers
TAF1
ENCSR000BPF
r=0.52

small heat map img

A549
Myers
MAX
ENCSR000DYG
r=0.47

small heat map img

A549
Myers
MYC
ENCSR000DYC
r=0.46

small heat map img

A549
Myers
CREB1
ENCSR000BRB
r=0.44

small heat map img

A549
Myers
YY1
ENCSR000BPM
r=0.42

small heat map img

A549
Myers
E2F6
ENCSR000BTC
r=0.40

small heat map img

A549
Myers
NR3C1
ENCSR000BJR
r=0.40

small heat map img

A549
Myers
SP1
ENCSR000BPE
r=0.37

small heat map img

A549
Myers
PBX3
ENCSR000BTN
r=0.35

small heat map img

A549
Myers
REST
ENCSR000BQP
r=0.34

small heat map img

A549
Myers
GATA3
ENCSR000BTI
r=0.33

small heat map img

A549
Myers
ETS1
ENCSR000BPU
r=0.31

small heat map img

A549
Myers
TEAD4
ENCSR000BUD
r=0.31

small heat map img

A549
Myers
SIN3A
ENCSR000BRM
r=0.31

small heat map img

A549
Myers
GABPA
ENCSR000BPY
r=0.27

small heat map img

A549
Myers
BHLHE40
ENCSR000DYJ
r=0.27

small heat map img

A549
Myers
SIX5
ENCSR000BRL
r=0.26

small heat map img

A549
Myers
USF1
ENCSR000BHX
r=0.24

small heat map img

A549
Myers
ZBTB33
ENCSR000BPZ
r=0.24

small heat map img

A549
Myers
RAD21
ENCSR000DYE
r=0.21

small heat map img

A549
Myers
ELF1
ENCSR000BPT
r=0.21

small heat map img

A549
Myers
USF1
ENCSR000BJB
r=0.21

small heat map img

A549
Myers
TCF12
ENCSR000BQQ
r=0.20

small heat map img

A549
Myers
CTCF
ENCSR000DYD
r=0.19

small heat map img

A549
Myers
CEBPB
ENCSR000BUB
r=0.19

small heat map img

A549
Myers
CTCF
ENCSR000DNA
r=0.19

small heat map img

A549
Myers
RAD21
ENCSR000BUC
r=0.19

small heat map img

A549
Myers
FOXA2
ENCSR000BRE
r=0.18

small heat map img

A549
Myers
ATF3
ENCSR000BPS
r=0.17

small heat map img

A549
Myers
JUND
ENCSR000BRF
r=0.17

small heat map img

A549
Myers
USF1
ENCSR000BPV
r=0.16

small heat map img

A549
Myers
FOSL2
ENCSR000BQO
r=0.14

small heat map img

A549
Myers
CEBPB
ENCSR000DYI
r=0.14

small heat map img

A549
Myers
CTCF
ENCSR000AUF
r=0.13

small heat map img

A549
Myers
BCL3
ENCSR000BQH
r=0.13

small heat map img

A549
Myers
CTCF
ENCSR000AUE
r=0.11

small heat map img

A549
Myers
NR3C1
ENCSR000BHE
r=0.10

small heat map img

A549
Myers
NR3C1
ENCSR000BHF
r=0.10

small heat map img

A549
Myers
CTCF
ENCSR000BHV
r=0.08

small heat map img

A549
Myers
EP300
ENCSR000BPW
r=0.08

small heat map img

A549
Myers
CTCF
ENCSR000BHW
r=0.08

small heat map img

A549
Myers
CTCF
ENCSR000DPF
r=0.05

small heat map img

A549
Myers
NR3C1
ENCSR000BHG
r=0.03

small heat map img

A549
Myers
FOXA1
ENCSR000BPX
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 27,603 (download )

GM10847 - Snyder - ENCSR000DYO

GM10847
Snyder
POLR2A
ENCSR000DYO
r=1.00

small heat map img
9,683 peaks (download )

GM12878 - Iyer - ENCSR000DKT

GM12878
Iyer
POLR2A
ENCSR000DKT
r=1.00

small heat map img

GM12878
Iyer
POLR2A
ENCSR000EAD
r=0.82

small heat map img

GM12878
Iyer
POLR2A
ENCSR000EYW
r=0.77

small heat map img

GM12878
Iyer
POLR2A
ENCSR000BGD
r=0.75

small heat map img

GM12878
Iyer
MAX
ENCSR000DZF
r=0.63

small heat map img

GM12878
Iyer
STAT1
ENCSR000DZM
r=0.62

small heat map img

GM12878
Iyer
PML
ENCSR000BQM
r=0.59

small heat map img

GM12878
Iyer
TBL1XR1
ENCSR000DYZ
r=0.59

small heat map img

GM12878
Iyer
MXI1
ENCSR000DZI
r=0.58

small heat map img

GM12878
Iyer
RCOR1
ENCSR000DZC
r=0.58

small heat map img

GM12878
Iyer
POU2F2
ENCSR000BGP
r=0.58

small heat map img

GM12878
Iyer
SIN3A
ENCSR000DYX
r=0.57

small heat map img

GM12878
Iyer
ELK1
ENCSR000DZB
r=0.57

small heat map img

GM12878
Iyer
CHD1
ENCSR000DZE
r=0.54

small heat map img

GM12878
Iyer
TBP
ENCSR000DZZ
r=0.54

small heat map img

GM12878
Iyer
MYC
ENCSR000DKU
r=0.52

small heat map img

GM12878
Iyer
KAT2A
ENCSR000DNO
r=0.51

small heat map img

GM12878
Iyer
ESRRA
ENCSR000DYQ
r=0.50

small heat map img

GM12878
Iyer
ELF1
ENCSR000BMB
r=0.50

small heat map img

GM12878
Iyer
RELA
ENCSR000EAG
r=0.49

small heat map img

GM12878
Iyer
BRCA1
ENCSR000DZS
r=0.46

small heat map img

GM12878
Iyer
TAF1
ENCSR000BGS
r=0.45

small heat map img

GM12878
Iyer
EP300
ENCSR000DZG
r=0.44

small heat map img

GM12878
Iyer
JUND
ENCSR000DYS
r=0.44

small heat map img

GM12878
Iyer
PAX5
ENCSR000BHD
r=0.44

small heat map img

GM12878
Iyer
BHLHE40
ENCSR000DZJ
r=0.44

small heat map img

GM12878
Iyer
MAFK
ENCSR000DYV
r=0.43

small heat map img

GM12878
Iyer
RUNX3
ENCSR000BRI
r=0.43

small heat map img

GM12878
Iyer
CREB1
ENCSR000BUF
r=0.43

small heat map img

GM12878
Iyer
TCF12
ENCSR000BGZ
r=0.43

small heat map img

GM12878
Iyer
NRF1
ENCSR000DZO
r=0.42

small heat map img

GM12878
Iyer
SREBF1
ENCSR000DYU
r=0.42

small heat map img

GM12878
Iyer
TCF3
ENCSR000BQT
r=0.42

small heat map img

GM12878
Iyer
YY1
ENCSR000BNP
r=0.41

small heat map img

GM12878
Iyer
EP300
ENCSR000DZD
r=0.40

small heat map img

GM12878
Iyer
E2F4
ENCSR000DYY
r=0.40

small heat map img

GM12878
Iyer
SMC3
ENCSR000DZP
r=0.39

small heat map img

GM12878
Iyer
SREBF2
ENCSR000DYT
r=0.39

small heat map img

GM12878
Iyer
WRNIP1
ENCSR000EAA
r=0.38

small heat map img

GM12878
Iyer
USF2
ENCSR000DZU
r=0.38

small heat map img

GM12878
Iyer
CUX1
ENCSR000DYR
r=0.38

small heat map img

GM12878
Iyer
ATF2
ENCSR000BQK
r=0.36

small heat map img

GM12878
Iyer
FOXM1
ENCSR000BRU
r=0.36

small heat map img

GM12878
Iyer
RFX5
ENCSR000DZW
r=0.36

small heat map img

GM12878
Iyer
STAT3
ENCSR000DZV
r=0.35

small heat map img

GM12878
Iyer
IRF3
ENCSR000DZX
r=0.35

small heat map img

GM12878
Iyer
BCL3
ENCSR000BNQ
r=0.34

small heat map img

GM12878
Iyer
ETS1
ENCSR000BKA
r=0.34

small heat map img

GM12878
Iyer
NFIC
ENCSR000BRN
r=0.33

small heat map img

GM12878
Iyer
STAT5A
ENCSR000BQZ
r=0.32

small heat map img

GM12878
Iyer
EGR1
ENCSR000BRG
r=0.31

small heat map img

GM12878
Iyer
CEBPB
ENCSR000BRX
r=0.31

small heat map img

GM12878
Iyer
GABPA
ENCSR000BGC
r=0.31

small heat map img

GM12878
Iyer
NFATC1
ENCSR000BQL
r=0.30

small heat map img

GM12878
Iyer
EGR1
ENCSR000BMQ
r=0.28

small heat map img

GM12878
Iyer
NFYA
ENCSR000DNN
r=0.28

small heat map img

GM12878
Iyer
ZNF143
ENCSR000DZL
r=0.28

small heat map img

GM12878
Iyer
SP1
ENCSR000BHK
r=0.28

small heat map img

GM12878
Iyer
NFE2
ENCSR000DZY
r=0.28

small heat map img

GM12878
Iyer
MTA3
ENCSR000BRH
r=0.27

small heat map img

GM12878
Iyer
NFYB
ENCSR000DNM
r=0.27

small heat map img

GM12878
Iyer
FOS
ENCSR000EYZ
r=0.27

small heat map img

GM12878
Iyer
RAD21
ENCSR000EAC
r=0.26

small heat map img

GM12878
Iyer
ZNF384
ENCSR000DYP
r=0.24

small heat map img

GM12878
Iyer
SRF
ENCSR000BMI
r=0.24

small heat map img

GM12878
Iyer
PAX5
ENCSR000BHJ
r=0.24

small heat map img

GM12878
Iyer
SIX5
ENCSR000BJE
r=0.23

small heat map img

GM12878
Iyer
PBX3
ENCSR000BGR
r=0.23

small heat map img

GM12878
Iyer
SRF
ENCSR000BGE
r=0.21

small heat map img

GM12878
Iyer
CTCF
ENCSR000DZN
r=0.21

small heat map img

GM12878
Iyer
USF1
ENCSR000BGI
r=0.21

small heat map img

GM12878
Iyer
EBF1
ENCSR000DZQ
r=0.20

small heat map img

GM12878
Iyer
MEF2A
ENCSR000BKB
r=0.20

small heat map img

GM12878
Iyer
ZBTB33
ENCSR000BHC
r=0.20

small heat map img

GM12878
Iyer
NR2C2
ENCSR000EUL
r=0.20

small heat map img

GM12878
Iyer
SUPT20H
ENCSR000DNP
r=0.19

small heat map img

GM12878
Iyer
REST
ENCSR000BGF
r=0.19

small heat map img

GM12878
Iyer
EP300
ENCSR000BHB
r=0.19

small heat map img

GM12878
Iyer
IRF4
ENCSR000BGY
r=0.19

small heat map img

GM12878
Iyer
CTCF
ENCSR000DKV
r=0.18

small heat map img

GM12878
Iyer
RXRA
ENCSR000BJD
r=0.17

small heat map img

GM12878
Iyer
BCL11A
ENCSR000BHA
r=0.17

small heat map img

GM12878
Iyer
CTCF
ENCSR000AKB
r=0.16

small heat map img

GM12878
Iyer
EBF1
ENCSR000BGU
r=0.15

small heat map img

GM12878
Iyer
IKZF1
ENCSR000EUJ
r=0.15

small heat map img

GM12878
Iyer
POLR3G
ENCSR000EYU
r=0.14

small heat map img

GM12878
Iyer
REST
ENCSR000BQS
r=0.13

small heat map img

GM12878
Iyer
ZEB1
ENCSR000BND
r=0.13

small heat map img

GM12878
Iyer
SPI1
ENCSR000BGQ
r=0.12

small heat map img

GM12878
Iyer
CTCF
ENCSR000DRZ
r=0.12

small heat map img

GM12878
Iyer
MEF2C
ENCSR000BNG
r=0.12

small heat map img

GM12878
Iyer
ATF3
ENCSR000BJY
r=0.12

small heat map img

GM12878
Iyer
YY1
ENCSR000EUM
r=0.11

small heat map img

GM12878
Iyer
RAD21
ENCSR000BMY
r=0.06

small heat map img

GM12878
Iyer
BATF
ENCSR000BGT
r=0.06

small heat map img

GM12878
Iyer
JUND
ENCSR000EYV
r=0.05

small heat map img

GM12878
Iyer
EZH2
ENCSR000ARD
r=0.04

small heat map img

GM12878
Iyer
ZZZ3
ENCSR000DNQ
r=0.02

small heat map img

GM12878
Iyer
ZNF274
ENCSR000EUK
r=-0.17

small heat map img
10,000 randomly-selected peaks from a total of 14,237 (download )

GM12878 - Myers - ENCSR000BGD

GM12878
Myers
POLR2A
ENCSR000BGD
r=1.00

small heat map img

GM12878
Myers
POLR2A
ENCSR000EYW
r=0.79

small heat map img

GM12878
Myers
POLR2A
ENCSR000EAD
r=0.78

small heat map img

GM12878
Myers
POLR2A
ENCSR000DKT
r=0.74

small heat map img

GM12878
Myers
POU2F2
ENCSR000BGP
r=0.60

small heat map img

GM12878
Myers
MAX
ENCSR000DZF
r=0.53

small heat map img

GM12878
Myers
PML
ENCSR000BQM
r=0.53

small heat map img

GM12878
Myers
MXI1
ENCSR000DZI
r=0.51

small heat map img

GM12878
Myers
SIN3A
ENCSR000DYX
r=0.49

small heat map img

GM12878
Myers
TCF3
ENCSR000BQT
r=0.47

small heat map img

GM12878
Myers
STAT1
ENCSR000DZM
r=0.47

small heat map img

GM12878
Myers
MYC
ENCSR000DKU
r=0.47

small heat map img

GM12878
Myers
TAF1
ENCSR000BGS
r=0.46

small heat map img

GM12878
Myers
CHD1
ENCSR000DZE
r=0.45

small heat map img

GM12878
Myers
ELK1
ENCSR000DZB
r=0.45

small heat map img

GM12878
Myers
ELF1
ENCSR000BMB
r=0.44

small heat map img

GM12878
Myers
TBL1XR1
ENCSR000DYZ
r=0.44

small heat map img

GM12878
Myers
TCF12
ENCSR000BGZ
r=0.44

small heat map img

GM12878
Myers
RCOR1
ENCSR000DZC
r=0.43

small heat map img

GM12878
Myers
YY1
ENCSR000BNP
r=0.43

small heat map img

GM12878
Myers
TBP
ENCSR000DZZ
r=0.43

small heat map img

GM12878
Myers
KAT2A
ENCSR000DNO
r=0.42

small heat map img

GM12878
Myers
PAX5
ENCSR000BHD
r=0.40

small heat map img

GM12878
Myers
BRCA1
ENCSR000DZS
r=0.40

small heat map img

GM12878
Myers
ESRRA
ENCSR000DYQ
r=0.39

small heat map img

GM12878
Myers
CREB1
ENCSR000BUF
r=0.38

small heat map img

GM12878
Myers
BHLHE40
ENCSR000DZJ
r=0.37

small heat map img

GM12878
Myers
NRF1
ENCSR000DZO
r=0.36

small heat map img

GM12878
Myers
JUND
ENCSR000DYS
r=0.36

small heat map img

GM12878
Myers
RUNX3
ENCSR000BRI
r=0.35

small heat map img

GM12878
Myers
RELA
ENCSR000EAG
r=0.34

small heat map img

GM12878
Myers
EGR1
ENCSR000BRG
r=0.34

small heat map img

GM12878
Myers
E2F4
ENCSR000DYY
r=0.34

small heat map img

GM12878
Myers
EP300
ENCSR000DZG
r=0.32

small heat map img

GM12878
Myers
MAFK
ENCSR000DYV
r=0.32

small heat map img

GM12878
Myers
GABPA
ENCSR000BGC
r=0.32

small heat map img

GM12878
Myers
USF2
ENCSR000DZU
r=0.31

small heat map img

GM12878
Myers
SREBF1
ENCSR000DYU
r=0.30

small heat map img

GM12878
Myers
EP300
ENCSR000DZD
r=0.30

small heat map img

GM12878
Myers
RFX5
ENCSR000DZW
r=0.30

small heat map img

GM12878
Myers
BCL3
ENCSR000BNQ
r=0.29

small heat map img

GM12878
Myers
ETS1
ENCSR000BKA
r=0.29

small heat map img

GM12878
Myers
FOXM1
ENCSR000BRU
r=0.28

small heat map img

GM12878
Myers
ATF2
ENCSR000BQK
r=0.28

small heat map img

GM12878
Myers
SREBF2
ENCSR000DYT
r=0.27

small heat map img

GM12878
Myers
SMC3
ENCSR000DZP
r=0.27

small heat map img

GM12878
Myers
EGR1
ENCSR000BMQ
r=0.26

small heat map img

GM12878
Myers
STAT5A
ENCSR000BQZ
r=0.26

small heat map img

GM12878
Myers
REST
ENCSR000BGF
r=0.25

small heat map img

GM12878
Myers
WRNIP1
ENCSR000EAA
r=0.25

small heat map img

GM12878
Myers
CUX1
ENCSR000DYR
r=0.25

small heat map img

GM12878
Myers
ZNF143
ENCSR000DZL
r=0.24

small heat map img

GM12878
Myers
PAX5
ENCSR000BHJ
r=0.24

small heat map img

GM12878
Myers
NFIC
ENCSR000BRN
r=0.24

small heat map img

GM12878
Myers
SRF
ENCSR000BGE
r=0.23

small heat map img

GM12878
Myers
CEBPB
ENCSR000BRX
r=0.23

small heat map img

GM12878
Myers
PBX3
ENCSR000BGR
r=0.23

small heat map img

GM12878
Myers
ZBTB33
ENCSR000BHC
r=0.22

small heat map img

GM12878
Myers
NFATC1
ENCSR000BQL
r=0.22

small heat map img

GM12878
Myers
IRF3
ENCSR000DZX
r=0.22

small heat map img

GM12878
Myers
USF1
ENCSR000BGI
r=0.21

small heat map img

GM12878
Myers
NFYB
ENCSR000DNM
r=0.20

small heat map img

GM12878
Myers
MTA3
ENCSR000BRH
r=0.20

small heat map img

GM12878
Myers
STAT3
ENCSR000DZV
r=0.19

small heat map img

GM12878
Myers
SRF
ENCSR000BMI
r=0.19

small heat map img

GM12878
Myers
SP1
ENCSR000BHK
r=0.19

small heat map img

GM12878
Myers
SIX5
ENCSR000BJE
r=0.18

small heat map img

GM12878
Myers
CTCF
ENCSR000DZN
r=0.18

small heat map img

GM12878
Myers
NFYA
ENCSR000DNN
r=0.17

small heat map img

GM12878
Myers
ZNF384
ENCSR000DYP
r=0.17

small heat map img

GM12878
Myers
FOS
ENCSR000EYZ
r=0.17

small heat map img

GM12878
Myers
EP300
ENCSR000BHB
r=0.17

small heat map img

GM12878
Myers
NFE2
ENCSR000DZY
r=0.17

small heat map img

GM12878
Myers
BCL11A
ENCSR000BHA
r=0.17

small heat map img

GM12878
Myers
RAD21
ENCSR000EAC
r=0.17

small heat map img

GM12878
Myers
MEF2A
ENCSR000BKB
r=0.16

small heat map img

GM12878
Myers
IRF4
ENCSR000BGY
r=0.16

small heat map img

GM12878
Myers
NR2C2
ENCSR000EUL
r=0.15

small heat map img

GM12878
Myers
CTCF
ENCSR000DKV
r=0.15

small heat map img

GM12878
Myers
RXRA
ENCSR000BJD
r=0.15

small heat map img

GM12878
Myers
CTCF
ENCSR000AKB
r=0.14

small heat map img

GM12878
Myers
REST
ENCSR000BQS
r=0.14

small heat map img

GM12878
Myers
EBF1
ENCSR000DZQ
r=0.13

small heat map img

GM12878
Myers
EBF1
ENCSR000BGU
r=0.12

small heat map img

GM12878
Myers
ZEB1
ENCSR000BND
r=0.12

small heat map img

GM12878
Myers
SUPT20H
ENCSR000DNP
r=0.11

small heat map img

GM12878
Myers
CTCF
ENCSR000DRZ
r=0.11

small heat map img

GM12878
Myers
MEF2C
ENCSR000BNG
r=0.11

small heat map img

GM12878
Myers
POLR3G
ENCSR000EYU
r=0.10

small heat map img

GM12878
Myers
ATF3
ENCSR000BJY
r=0.09

small heat map img

GM12878
Myers
SPI1
ENCSR000BGQ
r=0.06

small heat map img

GM12878
Myers
RAD21
ENCSR000BMY
r=0.05

small heat map img

GM12878
Myers
IKZF1
ENCSR000EUJ
r=0.04

small heat map img

GM12878
Myers
BATF
ENCSR000BGT
r=0.04

small heat map img

GM12878
Myers
YY1
ENCSR000EUM
r=0.03

small heat map img

GM12878
Myers
ZZZ3
ENCSR000DNQ
r=-0.01

small heat map img

GM12878
Myers
JUND
ENCSR000EYV
r=-0.03

small heat map img

GM12878
Myers
EZH2
ENCSR000ARD
r=-0.03

small heat map img

GM12878
Myers
ZNF274
ENCSR000EUK
r=-0.17

small heat map img
10,000 randomly-selected peaks from a total of 27,558 (download )

GM12878 - Snyder - ENCSR000EAD

GM12878
Snyder
POLR2A
ENCSR000EAD
r=1.00

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EYW
r=0.92

small heat map img

GM12878
Snyder
POLR2A
ENCSR000DKT
r=0.80

small heat map img

GM12878
Snyder
POLR2A
ENCSR000BGD
r=0.77

small heat map img

GM12878
Snyder
POU2F2
ENCSR000BGP
r=0.67

small heat map img

GM12878
Snyder
PML
ENCSR000BQM
r=0.65

small heat map img

GM12878
Snyder
TBP
ENCSR000DZZ
r=0.60

small heat map img

GM12878
Snyder
MAX
ENCSR000DZF
r=0.54

small heat map img

GM12878
Snyder
CHD1
ENCSR000DZE
r=0.54

small heat map img

GM12878
Snyder
TBL1XR1
ENCSR000DYZ
r=0.53

small heat map img

GM12878
Snyder
MXI1
ENCSR000DZI
r=0.53

small heat map img

GM12878
Snyder
ELK1
ENCSR000DZB
r=0.52

small heat map img

GM12878
Snyder
STAT1
ENCSR000DZM
r=0.52

small heat map img

GM12878
Snyder
RCOR1
ENCSR000DZC
r=0.52

small heat map img

GM12878
Snyder
SIN3A
ENCSR000DYX
r=0.51

small heat map img

GM12878
Snyder
RELA
ENCSR000EAG
r=0.51

small heat map img

GM12878
Snyder
KAT2A
ENCSR000DNO
r=0.51

small heat map img

GM12878
Snyder
TAF1
ENCSR000BGS
r=0.47

small heat map img

GM12878
Snyder
ESRRA
ENCSR000DYQ
r=0.47

small heat map img

GM12878
Snyder
ELF1
ENCSR000BMB
r=0.45

small heat map img

GM12878
Snyder
BRCA1
ENCSR000DZS
r=0.43

small heat map img

GM12878
Snyder
MAFK
ENCSR000DYV
r=0.42

small heat map img

GM12878
Snyder
TCF12
ENCSR000BGZ
r=0.41

small heat map img

GM12878
Snyder
RUNX3
ENCSR000BRI
r=0.41

small heat map img

GM12878
Snyder
WRNIP1
ENCSR000EAA
r=0.40

small heat map img

GM12878
Snyder
YY1
ENCSR000BNP
r=0.39

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHD
r=0.39

small heat map img

GM12878
Snyder
JUND
ENCSR000DYS
r=0.39

small heat map img

GM12878
Snyder
SREBF1
ENCSR000DYU
r=0.39

small heat map img

GM12878
Snyder
E2F4
ENCSR000DYY
r=0.39

small heat map img

GM12878
Snyder
EP300
ENCSR000DZG
r=0.38

small heat map img

GM12878
Snyder
BHLHE40
ENCSR000DZJ
r=0.38

small heat map img

GM12878
Snyder
NRF1
ENCSR000DZO
r=0.37

small heat map img

GM12878
Snyder
CUX1
ENCSR000DYR
r=0.37

small heat map img

GM12878
Snyder
MYC
ENCSR000DKU
r=0.37

small heat map img

GM12878
Snyder
TCF3
ENCSR000BQT
r=0.37

small heat map img

GM12878
Snyder
SMC3
ENCSR000DZP
r=0.37

small heat map img

GM12878
Snyder
SREBF2
ENCSR000DYT
r=0.37

small heat map img

GM12878
Snyder
FOXM1
ENCSR000BRU
r=0.37

small heat map img

GM12878
Snyder
CREB1
ENCSR000BUF
r=0.37

small heat map img

GM12878
Snyder
ATF2
ENCSR000BQK
r=0.37

small heat map img

GM12878
Snyder
STAT3
ENCSR000DZV
r=0.36

small heat map img

GM12878
Snyder
EP300
ENCSR000DZD
r=0.36

small heat map img

GM12878
Snyder
STAT5A
ENCSR000BQZ
r=0.35

small heat map img

GM12878
Snyder
NFIC
ENCSR000BRN
r=0.34

small heat map img

GM12878
Snyder
NFATC1
ENCSR000BQL
r=0.34

small heat map img

GM12878
Snyder
IRF3
ENCSR000DZX
r=0.34

small heat map img

GM12878
Snyder
RFX5
ENCSR000DZW
r=0.34

small heat map img

GM12878
Snyder
CEBPB
ENCSR000BRX
r=0.33

small heat map img

GM12878
Snyder
ETS1
ENCSR000BKA
r=0.33

small heat map img

GM12878
Snyder
BCL3
ENCSR000BNQ
r=0.33

small heat map img

GM12878
Snyder
USF2
ENCSR000DZU
r=0.32

small heat map img

GM12878
Snyder
MTA3
ENCSR000BRH
r=0.32

small heat map img

GM12878
Snyder
RAD21
ENCSR000EAC
r=0.27

small heat map img

GM12878
Snyder
EGR1
ENCSR000BRG
r=0.26

small heat map img

GM12878
Snyder
NFYA
ENCSR000DNN
r=0.26

small heat map img

GM12878
Snyder
NFE2
ENCSR000DZY
r=0.25

small heat map img

GM12878
Snyder
EGR1
ENCSR000BMQ
r=0.25

small heat map img

GM12878
Snyder
PBX3
ENCSR000BGR
r=0.25

small heat map img

GM12878
Snyder
ZNF384
ENCSR000DYP
r=0.24

small heat map img

GM12878
Snyder
SP1
ENCSR000BHK
r=0.24

small heat map img

GM12878
Snyder
NFYB
ENCSR000DNM
r=0.24

small heat map img

GM12878
Snyder
FOS
ENCSR000EYZ
r=0.23

small heat map img

GM12878
Snyder
GABPA
ENCSR000BGC
r=0.23

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHJ
r=0.23

small heat map img

GM12878
Snyder
ZNF143
ENCSR000DZL
r=0.23

small heat map img

GM12878
Snyder
SRF
ENCSR000BMI
r=0.22

small heat map img

GM12878
Snyder
MEF2A
ENCSR000BKB
r=0.21

small heat map img

GM12878
Snyder
ZBTB33
ENCSR000BHC
r=0.21

small heat map img

GM12878
Snyder
SIX5
ENCSR000BJE
r=0.20

small heat map img

GM12878
Snyder
SUPT20H
ENCSR000DNP
r=0.20

small heat map img

GM12878
Snyder
EP300
ENCSR000BHB
r=0.20

small heat map img

GM12878
Snyder
NR2C2
ENCSR000EUL
r=0.18

small heat map img

GM12878
Snyder
REST
ENCSR000BGF
r=0.18

small heat map img

GM12878
Snyder
IRF4
ENCSR000BGY
r=0.18

small heat map img

GM12878
Snyder
EBF1
ENCSR000DZQ
r=0.18

small heat map img

GM12878
Snyder
IKZF1
ENCSR000EUJ
r=0.18

small heat map img

GM12878
Snyder
BCL11A
ENCSR000BHA
r=0.17

small heat map img

GM12878
Snyder
YY1
ENCSR000EUM
r=0.17

small heat map img

GM12878
Snyder
RXRA
ENCSR000BJD
r=0.17

small heat map img

GM12878
Snyder
CTCF
ENCSR000DZN
r=0.17

small heat map img

GM12878
Snyder
SRF
ENCSR000BGE
r=0.17

small heat map img

GM12878
Snyder
EBF1
ENCSR000BGU
r=0.14

small heat map img

GM12878
Snyder
USF1
ENCSR000BGI
r=0.14

small heat map img

GM12878
Snyder
CTCF
ENCSR000DKV
r=0.14

small heat map img

GM12878
Snyder
REST
ENCSR000BQS
r=0.14

small heat map img

GM12878
Snyder
POLR3G
ENCSR000EYU
r=0.14

small heat map img

GM12878
Snyder
CTCF
ENCSR000AKB
r=0.14

small heat map img

GM12878
Snyder
MEF2C
ENCSR000BNG
r=0.13

small heat map img

GM12878
Snyder
SPI1
ENCSR000BGQ
r=0.12

small heat map img

GM12878
Snyder
ZEB1
ENCSR000BND
r=0.12

small heat map img

GM12878
Snyder
JUND
ENCSR000EYV
r=0.11

small heat map img

GM12878
Snyder
EZH2
ENCSR000ARD
r=0.10

small heat map img

GM12878
Snyder
ATF3
ENCSR000BJY
r=0.10

small heat map img

GM12878
Snyder
CTCF
ENCSR000DRZ
r=0.10

small heat map img

GM12878
Snyder
ZZZ3
ENCSR000DNQ
r=0.08

small heat map img

GM12878
Snyder
BATF
ENCSR000BGT
r=0.07

small heat map img

GM12878
Snyder
RAD21
ENCSR000BMY
r=0.07

small heat map img

GM12878
Snyder
ZNF274
ENCSR000EUK
r=-0.08

small heat map img
10,000 randomly-selected peaks from a total of 21,947 (download )

GM12878 - Weissman - ENCSR000EYW

GM12878
Weissman
POLR2A
ENCSR000EYW
r=1.00

small heat map img

GM12878
Weissman
POLR2A
ENCSR000EAD
r=0.93

small heat map img

GM12878
Weissman
POLR2A
ENCSR000BGD
r=0.81

small heat map img

GM12878
Weissman
POLR2A
ENCSR000DKT
r=0.78

small heat map img

GM12878
Weissman
POU2F2
ENCSR000BGP
r=0.68

small heat map img

GM12878
Weissman
PML
ENCSR000BQM
r=0.65

small heat map img

GM12878
Weissman
TBP
ENCSR000DZZ
r=0.58

small heat map img

GM12878
Weissman
TBL1XR1
ENCSR000DYZ
r=0.54

small heat map img

GM12878
Weissman
MAX
ENCSR000DZF
r=0.54

small heat map img

GM12878
Weissman
STAT1
ENCSR000DZM
r=0.54

small heat map img

GM12878
Weissman
RCOR1
ENCSR000DZC
r=0.53

small heat map img

GM12878
Weissman
RELA
ENCSR000EAG
r=0.53

small heat map img

GM12878
Weissman
TAF1
ENCSR000BGS
r=0.52

small heat map img

GM12878
Weissman
KAT2A
ENCSR000DNO
r=0.51

small heat map img

GM12878
Weissman
MXI1
ENCSR000DZI
r=0.51

small heat map img

GM12878
Weissman
SIN3A
ENCSR000DYX
r=0.51

small heat map img

GM12878
Weissman
ELK1
ENCSR000DZB
r=0.50

small heat map img

GM12878
Weissman
ESRRA
ENCSR000DYQ
r=0.48

small heat map img

GM12878
Weissman
CHD1
ENCSR000DZE
r=0.47

small heat map img

GM12878
Weissman
TCF12
ENCSR000BGZ
r=0.47

small heat map img

GM12878
Weissman
ELF1
ENCSR000BMB
r=0.45

small heat map img

GM12878
Weissman
RUNX3
ENCSR000BRI
r=0.45

small heat map img

GM12878
Weissman
EP300
ENCSR000DZG
r=0.44

small heat map img

GM12878
Weissman
MAFK
ENCSR000DYV
r=0.43

small heat map img

GM12878
Weissman
PAX5
ENCSR000BHD
r=0.43

small heat map img

GM12878
Weissman
EP300
ENCSR000DZD
r=0.42

small heat map img

GM12878
Weissman
JUND
ENCSR000DYS
r=0.41

small heat map img

GM12878
Weissman
TCF3
ENCSR000BQT
r=0.41

small heat map img

GM12878
Weissman
YY1
ENCSR000BNP
r=0.40

small heat map img

GM12878
Weissman
BRCA1
ENCSR000DZS
r=0.40

small heat map img

GM12878
Weissman
MYC
ENCSR000DKU
r=0.39

small heat map img

GM12878
Weissman
SREBF1
ENCSR000DYU
r=0.38

small heat map img

GM12878
Weissman
CUX1
ENCSR000DYR
r=0.38

small heat map img

GM12878
Weissman
BHLHE40
ENCSR000DZJ
r=0.38

small heat map img

GM12878
Weissman
ATF2
ENCSR000BQK
r=0.38

small heat map img

GM12878
Weissman
SMC3
ENCSR000DZP
r=0.38

small heat map img

GM12878
Weissman
WRNIP1
ENCSR000EAA
r=0.37

small heat map img

GM12878
Weissman
FOXM1
ENCSR000BRU
r=0.37

small heat map img

GM12878
Weissman
CREB1
ENCSR000BUF
r=0.37

small heat map img

GM12878
Weissman
SREBF2
ENCSR000DYT
r=0.36

small heat map img

GM12878
Weissman
E2F4
ENCSR000DYY
r=0.35

small heat map img

GM12878
Weissman
NRF1
ENCSR000DZO
r=0.35

small heat map img

GM12878
Weissman
BCL3
ENCSR000BNQ
r=0.35

small heat map img

GM12878
Weissman
STAT3
ENCSR000DZV
r=0.35

small heat map img

GM12878
Weissman
NFIC
ENCSR000BRN
r=0.34

small heat map img

GM12878
Weissman
STAT5A
ENCSR000BQZ
r=0.34

small heat map img

GM12878
Weissman
ETS1
ENCSR000BKA
r=0.34

small heat map img

GM12878
Weissman
NFATC1
ENCSR000BQL
r=0.32

small heat map img

GM12878
Weissman
CEBPB
ENCSR000BRX
r=0.32

small heat map img

GM12878
Weissman
RFX5
ENCSR000DZW
r=0.32

small heat map img

GM12878
Weissman
IRF3
ENCSR000DZX
r=0.31

small heat map img

GM12878
Weissman
USF2
ENCSR000DZU
r=0.30

small heat map img

GM12878
Weissman
EGR1
ENCSR000BRG
r=0.29

small heat map img

GM12878
Weissman
MTA3
ENCSR000BRH
r=0.29

small heat map img

GM12878
Weissman
RAD21
ENCSR000EAC
r=0.28

small heat map img

GM12878
Weissman
EGR1
ENCSR000BMQ
r=0.27

small heat map img

GM12878
Weissman
PAX5
ENCSR000BHJ
r=0.25

small heat map img

GM12878
Weissman
SP1
ENCSR000BHK
r=0.24

small heat map img

GM12878
Weissman
NFYA
ENCSR000DNN
r=0.24

small heat map img

GM12878
Weissman
ZNF384
ENCSR000DYP
r=0.24

small heat map img

GM12878
Weissman
PBX3
ENCSR000BGR
r=0.24

small heat map img

GM12878
Weissman
NFE2
ENCSR000DZY
r=0.24

small heat map img

GM12878
Weissman
GABPA
ENCSR000BGC
r=0.23

small heat map img

GM12878
Weissman
SRF
ENCSR000BMI
r=0.23

small heat map img

GM12878
Weissman
MEF2A
ENCSR000BKB
r=0.23

small heat map img

GM12878
Weissman
NFYB
ENCSR000DNM
r=0.23

small heat map img

GM12878
Weissman
ZNF143
ENCSR000DZL
r=0.22

small heat map img

GM12878
Weissman
REST
ENCSR000BGF
r=0.22

small heat map img

GM12878
Weissman
FOS
ENCSR000EYZ
r=0.21

small heat map img

GM12878
Weissman
EP300
ENCSR000BHB
r=0.21

small heat map img

GM12878
Weissman
EBF1
ENCSR000DZQ
r=0.21

small heat map img

GM12878
Weissman
ZBTB33
ENCSR000BHC
r=0.20

small heat map img

GM12878
Weissman
SIX5
ENCSR000BJE
r=0.20

small heat map img

GM12878
Weissman
SUPT20H
ENCSR000DNP
r=0.19

small heat map img

GM12878
Weissman
IRF4
ENCSR000BGY
r=0.19

small heat map img

GM12878
Weissman
BCL11A
ENCSR000BHA
r=0.19

small heat map img

GM12878
Weissman
NR2C2
ENCSR000EUL
r=0.18

small heat map img

GM12878
Weissman
SRF
ENCSR000BGE
r=0.18

small heat map img

GM12878
Weissman
CTCF
ENCSR000DZN
r=0.17

small heat map img

GM12878
Weissman
RXRA
ENCSR000BJD
r=0.17

small heat map img

GM12878
Weissman
EBF1
ENCSR000BGU
r=0.16

small heat map img

GM12878
Weissman
IKZF1
ENCSR000EUJ
r=0.16

small heat map img

GM12878
Weissman
USF1
ENCSR000BGI
r=0.16

small heat map img

GM12878
Weissman
REST
ENCSR000BQS
r=0.15

small heat map img

GM12878
Weissman
CTCF
ENCSR000DKV
r=0.15

small heat map img

GM12878
Weissman
YY1
ENCSR000EUM
r=0.15

small heat map img

GM12878
Weissman
POLR3G
ENCSR000EYU
r=0.14

small heat map img

GM12878
Weissman
MEF2C
ENCSR000BNG
r=0.14

small heat map img

GM12878
Weissman
CTCF
ENCSR000AKB
r=0.13

small heat map img

GM12878
Weissman
ZEB1
ENCSR000BND
r=0.13

small heat map img

GM12878
Weissman
SPI1
ENCSR000BGQ
r=0.13

small heat map img

GM12878
Weissman
ATF3
ENCSR000BJY
r=0.11

small heat map img

GM12878
Weissman
CTCF
ENCSR000DRZ
r=0.10

small heat map img

GM12878
Weissman
JUND
ENCSR000EYV
r=0.09

small heat map img

GM12878
Weissman
BATF
ENCSR000BGT
r=0.08

small heat map img

GM12878
Weissman
EZH2
ENCSR000ARD
r=0.07

small heat map img

GM12878
Weissman
RAD21
ENCSR000BMY
r=0.07

small heat map img

GM12878
Weissman
ZZZ3
ENCSR000DNQ
r=0.06

small heat map img

GM12878
Weissman
ZNF274
ENCSR000EUK
r=-0.13

small heat map img
10,000 randomly-selected peaks from a total of 11,086 (download )

GM12891 - Myers - ENCSR000BIK

GM12891
Myers
POLR2A
ENCSR000BIK
r=1.00

small heat map img

GM12891
Myers
POLR2A
ENCSR000EAJ
r=0.75

small heat map img

GM12891
Myers
POU2F2
ENCSR000BII
r=0.61

small heat map img

GM12891
Myers
TAF1
ENCSR000BIM
r=0.52

small heat map img

GM12891
Myers
YY1
ENCSR000BKJ
r=0.26

small heat map img

GM12891
Myers
PAX5
ENCSR000BJH
r=0.17

small heat map img

GM12891
Myers
SPI1
ENCSR000BIJ
r=0.16

small heat map img

GM12891
Myers
CTCF
ENCSR000DKX
r=0.11

small heat map img
10,000 randomly-selected peaks from a total of 16,585 (download )

GM12891 - Snyder - ENCSR000EAJ

GM12891
Snyder
POLR2A
ENCSR000EAJ
r=1.00

small heat map img

GM12891
Snyder
POLR2A
ENCSR000BIK
r=0.76

small heat map img

GM12891
Snyder
TAF1
ENCSR000BIM
r=0.57

small heat map img

GM12891
Snyder
POU2F2
ENCSR000BII
r=0.53

small heat map img

GM12891
Snyder
YY1
ENCSR000BKJ
r=0.27

small heat map img

GM12891
Snyder
SPI1
ENCSR000BIJ
r=0.18

small heat map img

GM12891
Snyder
PAX5
ENCSR000BJH
r=0.17

small heat map img

GM12891
Snyder
CTCF
ENCSR000DKX
r=0.14

small heat map img
10,000 randomly-selected peaks from a total of 20,390 (download )

GM12892 - Myers - ENCSR000BHZ

GM12892
Myers
POLR2A
ENCSR000BHZ
r=1.00

small heat map img

GM12892
Myers
POLR2A
ENCSR000EAM
r=0.76

small heat map img

GM12892
Myers
TAF1
ENCSR000BIB
r=0.53

small heat map img

GM12892
Myers
RELA
ENCSR000EAN
r=0.51

small heat map img

GM12892
Myers
YY1
ENCSR000BLT
r=0.39

small heat map img

GM12892
Myers
CTCF
ENCSR000DKY
r=0.19

small heat map img

GM12892
Myers
PAX5
ENCSR000BJI
r=0.19

small heat map img
10,000 randomly-selected peaks from a total of 20,075 (download )

GM12892 - Snyder - ENCSR000EAM

GM12892
Snyder
POLR2A
ENCSR000EAM
r=1.00

small heat map img

GM12892
Snyder
POLR2A
ENCSR000BHZ
r=0.77

small heat map img

GM12892
Snyder
RELA
ENCSR000EAN
r=0.62

small heat map img

GM12892
Snyder
TAF1
ENCSR000BIB
r=0.59

small heat map img

GM12892
Snyder
YY1
ENCSR000BLT
r=0.49

small heat map img

GM12892
Snyder
CTCF
ENCSR000DKY
r=0.25

small heat map img

GM12892
Snyder
PAX5
ENCSR000BJI
r=0.20

small heat map img
10,000 randomly-selected peaks from a total of 22,544 (download )

GM15510 - Snyder - ENCSR000EAR

GM15510
Snyder
POLR2A
ENCSR000EAR
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 18,661 (download )

GM18505 - Snyder - ENCSR000EAU

GM18505
Snyder
POLR2A
ENCSR000EAU
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 21,784 (download )

GM18526 - Snyder - ENCSR000EAY

GM18526
Snyder
POLR2A
ENCSR000EAY
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 16,856 (download )

GM18951 - Snyder - ENCSR000EBC

GM18951
Snyder
POLR2A
ENCSR000EBC
r=1.00

small heat map img

GM18951
Snyder
RELA
ENCSR000EBD
r=0.50

small heat map img
10,000 randomly-selected peaks from a total of 21,218 (download )

GM19099 - Snyder - ENCSR000EBG

GM19099
Snyder
POLR2A
ENCSR000EBG
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 22,219 (download )

GM19193 - Snyder - ENCSR000EBK

GM19193
Snyder
POLR2A
ENCSR000EBK
r=1.00

small heat map img

GM19193
Snyder
RELA
ENCSR000EBM
r=0.50

small heat map img
10,000 randomly-selected peaks from a total of 21,404 (download )

H1-hESC - Iyer - ENCSR000DLJ

H1-hESC
Iyer
POLR2A
ENCSR000DLJ
r=1.00

small heat map img

H1-hESC
Iyer
POLR2A
ENCSR000BHN
r=0.69

small heat map img

H1-hESC
Iyer
TAF1
ENCSR000BHO
r=0.69

small heat map img

H1-hESC
Iyer
TBP
ENCSR000ECB
r=0.66

small heat map img

H1-hESC
Iyer
PHF8
ENCSR000ATK
r=0.60

small heat map img

H1-hESC
Iyer
SIRT6
ENCSR000AUS
r=0.52

small heat map img

H1-hESC
Iyer
MYC
ENCSR000EBY
r=0.52

small heat map img

H1-hESC
Iyer
JUND
ENCSR000EBZ
r=0.51

small heat map img

H1-hESC
Iyer
CHD7
ENCSR000AVA
r=0.49

small heat map img

H1-hESC
Iyer
MXI1
ENCSR000EBR
r=0.49

small heat map img

H1-hESC
Iyer
SIN3A
ENCSR000EBO
r=0.48

small heat map img

H1-hESC
Iyer
RBBP5
ENCSR000AQC
r=0.47

small heat map img

H1-hESC
Iyer
HDAC6
ENCSR000ATQ
r=0.47

small heat map img

H1-hESC
Iyer
MAX
ENCSR000BSJ
r=0.45

small heat map img

H1-hESC
Iyer
EP300
ENCSR000AUQ
r=0.44

small heat map img

H1-hESC
Iyer
CHD1
ENCSR000EBU
r=0.43

small heat map img

H1-hESC
Iyer
BRCA1
ENCSR000EBX
r=0.42

small heat map img

H1-hESC
Iyer
TAF7
ENCSR000BLU
r=0.42

small heat map img

H1-hESC
Iyer
CTBP2
ENCSR000EUO
r=0.40

small heat map img

H1-hESC
Iyer
YY1
ENCSR000BKD
r=0.39

small heat map img

H1-hESC
Iyer
HDAC2
ENCSR000AVB
r=0.38

small heat map img

H1-hESC
Iyer
USF2
ENCSR000ECD
r=0.38

small heat map img

H1-hESC
Iyer
NRF1
ENCSR000ECC
r=0.37

small heat map img

H1-hESC
Iyer
MAX
ENCSR000EUP
r=0.36

small heat map img

H1-hESC
Iyer
CREB1
ENCSR000BSN
r=0.35

small heat map img

H1-hESC
Iyer
E2F6
ENCSR000BSI
r=0.35

small heat map img

H1-hESC
Iyer
JUN
ENCSR000ECA
r=0.35

small heat map img

H1-hESC
Iyer
BACH1
ENCSR000EBQ
r=0.34

small heat map img

H1-hESC
Iyer
CEBPB
ENCSR000EBV
r=0.34

small heat map img

H1-hESC
Iyer
MAFK
ENCSR000EBS
r=0.33

small heat map img

H1-hESC
Iyer
ATF2
ENCSR000BQU
r=0.33

small heat map img

H1-hESC
Iyer
TEAD4
ENCSR000BRY
r=0.33

small heat map img

H1-hESC
Iyer
CHD1
ENCSR000AQK
r=0.32

small heat map img

H1-hESC
Iyer
KDM4A
ENCSR000AVC
r=0.31

small heat map img

H1-hESC
Iyer
RAD21
ENCSR000ECE
r=0.31

small heat map img

H1-hESC
Iyer
KDM5A
ENCSR000AQL
r=0.29

small heat map img

H1-hESC
Iyer
ZNF143
ENCSR000EBW
r=0.28

small heat map img

H1-hESC
Iyer
SP1
ENCSR000BIR
r=0.28

small heat map img

H1-hESC
Iyer
SUZ12
ENCSR000ATS
r=0.27

small heat map img

H1-hESC
Iyer
RFX5
ENCSR000ECF
r=0.25

small heat map img

H1-hESC
Iyer
JUND
ENCSR000BKP
r=0.25

small heat map img

H1-hESC
Iyer
GABPA
ENCSR000BIW
r=0.25

small heat map img

H1-hESC
Iyer
SIN3A
ENCSR000BIS
r=0.24

small heat map img

H1-hESC
Iyer
SP4
ENCSR000BQV
r=0.22

small heat map img

H1-hESC
Iyer
KDM5B
ENCSR000AUR
r=0.21

small heat map img

H1-hESC
Iyer
MYC
ENCSR000DLI
r=0.21

small heat map img

H1-hESC
Iyer
SAP30
ENCSR000ATR
r=0.19

small heat map img

H1-hESC
Iyer
CTCF
ENCSR000DLK
r=0.19

small heat map img

H1-hESC
Iyer
CTCF
ENCSR000AMF
r=0.17

small heat map img

H1-hESC
Iyer
USF1
ENCSR000BIU
r=0.16

small heat map img

H1-hESC
Iyer
SRF
ENCSR000BIV
r=0.15

small heat map img

H1-hESC
Iyer
EGR1
ENCSR000BJA
r=0.15

small heat map img

H1-hESC
Iyer
SP2
ENCSR000BQG
r=0.15

small heat map img

H1-hESC
Iyer
ATF3
ENCSR000BKC
r=0.13

small heat map img

H1-hESC
Iyer
EP300
ENCSR000BKK
r=0.13

small heat map img

H1-hESC
Iyer
EZH2
ENCSR000ASY
r=0.12

small heat map img

H1-hESC
Iyer
FOSL1
ENCSR000BNS
r=0.12

small heat map img

H1-hESC
Iyer
BCL11A
ENCSR000BMJ
r=0.11

small heat map img

H1-hESC
Iyer
SIX5
ENCSR000BIQ
r=0.11

small heat map img

H1-hESC
Iyer
HDAC2
ENCSR000BNR
r=0.11

small heat map img

H1-hESC
Iyer
REST
ENCSR000BHM
r=0.10

small heat map img

H1-hESC
Iyer
SUZ12
ENCSR000EUQ
r=0.10

small heat map img

H1-hESC
Iyer
RAD21
ENCSR000BLD
r=0.09

small heat map img

H1-hESC
Iyer
TCF12
ENCSR000BIT
r=0.09

small heat map img

H1-hESC
Iyer
CTCF
ENCSR000BNH
r=0.08

small heat map img

H1-hESC
Iyer
BCL11A
ENCSR000BIP
r=0.07

small heat map img

H1-hESC
Iyer
NANOG
ENCSR000BMT
r=0.05

small heat map img

H1-hESC
Iyer
RXRA
ENCSR000BJW
r=0.04

small heat map img

H1-hESC
Iyer
ZNF274
ENCSR000EUN
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 12,915 (download )

H1-hESC - Myers - ENCSR000BHN

H1-hESC
Myers
POLR2A
ENCSR000BHN
r=1.00

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000DLJ
r=0.67

small heat map img

H1-hESC
Myers
TAF1
ENCSR000BHO
r=0.56

small heat map img

H1-hESC
Myers
TBP
ENCSR000ECB
r=0.53

small heat map img

H1-hESC
Myers
PHF8
ENCSR000ATK
r=0.44

small heat map img

H1-hESC
Myers
SIRT6
ENCSR000AUS
r=0.43

small heat map img

H1-hESC
Myers
CHD1
ENCSR000EBU
r=0.40

small heat map img

H1-hESC
Myers
CHD7
ENCSR000AVA
r=0.39

small heat map img

H1-hESC
Myers
MYC
ENCSR000EBY
r=0.39

small heat map img

H1-hESC
Myers
MXI1
ENCSR000EBR
r=0.38

small heat map img

H1-hESC
Myers
JUND
ENCSR000EBZ
r=0.38

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000EBO
r=0.38

small heat map img

H1-hESC
Myers
HDAC6
ENCSR000ATQ
r=0.35

small heat map img

H1-hESC
Myers
BRCA1
ENCSR000EBX
r=0.34

small heat map img

H1-hESC
Myers
RBBP5
ENCSR000AQC
r=0.34

small heat map img

H1-hESC
Myers
CHD1
ENCSR000AQK
r=0.34

small heat map img

H1-hESC
Myers
TAF7
ENCSR000BLU
r=0.32

small heat map img

H1-hESC
Myers
EP300
ENCSR000AUQ
r=0.31

small heat map img

H1-hESC
Myers
MAX
ENCSR000BSJ
r=0.31

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000AVB
r=0.30

small heat map img

H1-hESC
Myers
USF2
ENCSR000ECD
r=0.29

small heat map img

H1-hESC
Myers
YY1
ENCSR000BKD
r=0.29

small heat map img

H1-hESC
Myers
MAX
ENCSR000EUP
r=0.29

small heat map img

H1-hESC
Myers
CTBP2
ENCSR000EUO
r=0.28

small heat map img

H1-hESC
Myers
NRF1
ENCSR000ECC
r=0.28

small heat map img

H1-hESC
Myers
JUN
ENCSR000ECA
r=0.27

small heat map img

H1-hESC
Myers
ATF2
ENCSR000BQU
r=0.27

small heat map img

H1-hESC
Myers
CEBPB
ENCSR000EBV
r=0.27

small heat map img

H1-hESC
Myers
CREB1
ENCSR000BSN
r=0.27

small heat map img

H1-hESC
Myers
MAFK
ENCSR000EBS
r=0.27

small heat map img

H1-hESC
Myers
KDM5A
ENCSR000AQL
r=0.27

small heat map img

H1-hESC
Myers
TEAD4
ENCSR000BRY
r=0.25

small heat map img

H1-hESC
Myers
BACH1
ENCSR000EBQ
r=0.25

small heat map img

H1-hESC
Myers
E2F6
ENCSR000BSI
r=0.25

small heat map img

H1-hESC
Myers
SAP30
ENCSR000ATR
r=0.24

small heat map img

H1-hESC
Myers
KDM4A
ENCSR000AVC
r=0.23

small heat map img

H1-hESC
Myers
SP1
ENCSR000BIR
r=0.22

small heat map img

H1-hESC
Myers
ZNF143
ENCSR000EBW
r=0.21

small heat map img

H1-hESC
Myers
RAD21
ENCSR000ECE
r=0.20

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000BIS
r=0.20

small heat map img

H1-hESC
Myers
RFX5
ENCSR000ECF
r=0.20

small heat map img

H1-hESC
Myers
KDM5B
ENCSR000AUR
r=0.19

small heat map img

H1-hESC
Myers
JUND
ENCSR000BKP
r=0.18

small heat map img

H1-hESC
Myers
GABPA
ENCSR000BIW
r=0.18

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000ATS
r=0.18

small heat map img

H1-hESC
Myers
SP4
ENCSR000BQV
r=0.16

small heat map img

H1-hESC
Myers
MYC
ENCSR000DLI
r=0.13

small heat map img

H1-hESC
Myers
SP2
ENCSR000BQG
r=0.12

small heat map img

H1-hESC
Myers
CTCF
ENCSR000AMF
r=0.12

small heat map img

H1-hESC
Myers
EZH2
ENCSR000ASY
r=0.12

small heat map img

H1-hESC
Myers
SRF
ENCSR000BIV
r=0.11

small heat map img

H1-hESC
Myers
EGR1
ENCSR000BJA
r=0.11

small heat map img

H1-hESC
Myers
USF1
ENCSR000BIU
r=0.11

small heat map img

H1-hESC
Myers
REST
ENCSR000BHM
r=0.10

small heat map img

H1-hESC
Myers
CTCF
ENCSR000DLK
r=0.10

small heat map img

H1-hESC
Myers
EP300
ENCSR000BKK
r=0.10

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000BNR
r=0.10

small heat map img

H1-hESC
Myers
ATF3
ENCSR000BKC
r=0.09

small heat map img

H1-hESC
Myers
SIX5
ENCSR000BIQ
r=0.09

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BMJ
r=0.09

small heat map img

H1-hESC
Myers
FOSL1
ENCSR000BNS
r=0.09

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000EUQ
r=0.08

small heat map img

H1-hESC
Myers
TCF12
ENCSR000BIT
r=0.07

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BIP
r=0.06

small heat map img

H1-hESC
Myers
RAD21
ENCSR000BLD
r=0.06

small heat map img

H1-hESC
Myers
CTCF
ENCSR000BNH
r=0.05

small heat map img

H1-hESC
Myers
NANOG
ENCSR000BMT
r=0.04

small heat map img

H1-hESC
Myers
ZNF274
ENCSR000EUN
r=0.04

small heat map img

H1-hESC
Myers
RXRA
ENCSR000BJW
r=0.03

small heat map img
10,000 randomly-selected peaks from a total of 20,317 (download )

H54 - Iyer - ENCSR000DKM

H54
Iyer
POLR2A
ENCSR000DKM
r=1.00

small heat map img

H54
Iyer
CTCF
ENCSR000DKN
r=0.20

small heat map img
10,000 randomly-selected peaks from a total of 17,417 (download )

HCT116 - Farnham - ENCSR000EUU

HCT116
Farnham
POLR2A
ENCSR000EUU
r=1.00

small heat map img

HCT116
Farnham
SIN3A
ENCSR000BSG
r=0.61

small heat map img

HCT116
Farnham
JUND
ENCSR000BSA
r=0.52

small heat map img

HCT116
Farnham
MAX
ENCSR000BSH
r=0.49

small heat map img

HCT116
Farnham
CBX3
ENCSR000BUH
r=0.47

small heat map img

HCT116
Farnham
CEBPB
ENCSR000BSD
r=0.47

small heat map img

HCT116
Farnham
ATF3
ENCSR000BUG
r=0.46

small heat map img

HCT116
Farnham
SP1
ENCSR000BSF
r=0.45

small heat map img

HCT116
Farnham
FOSL1
ENCSR000BTE
r=0.44

small heat map img

HCT116
Farnham
SRF
ENCSR000BSC
r=0.43

small heat map img

HCT116
Farnham
RAD21
ENCSR000BSB
r=0.39

small heat map img

HCT116
Farnham
USF1
ENCSR000BVK
r=0.38

small heat map img

HCT116
Farnham
TEAD4
ENCSR000BVJ
r=0.38

small heat map img

HCT116
Farnham
ELF1
ENCSR000BVH
r=0.38

small heat map img

HCT116
Farnham
EGR1
ENCSR000BRZ
r=0.37

small heat map img

HCT116
Farnham
REST
ENCSR000BVI
r=0.35

small heat map img

HCT116
Farnham
TCF7L2
ENCSR000EUV
r=0.35

small heat map img

HCT116
Farnham
ZBTB33
ENCSR000BNY
r=0.32

small heat map img

HCT116
Farnham
YY1
ENCSR000BNX
r=0.22

small heat map img

HCT116
Farnham
CTCF
ENCSR000BSE
r=0.21

small heat map img

HCT116
Farnham
CTCF
ENCSR000DTO
r=0.10

small heat map img
10,000 randomly-selected peaks from a total of 12,864 (download )

HEK293 - Weissman - ENCSR000EZA

HEK293
Weissman
POLR2A
ENCSR000EZA
r=1.00

small heat map img

HEK293
Weissman
TRIM28
ENCSR000EUZ
r=0.37

small heat map img

HEK293
Weissman
ZNF263
ENCSR000EVD
r=0.34

small heat map img

HEK293
Weissman
ELK4
ENCSR000EVB
r=0.33

small heat map img

HEK293
Weissman
TCF7L2
ENCSR000EUY
r=0.20

small heat map img

HEK293
Weissman
CTCF
ENCSR000DTW
r=0.15

small heat map img
10,000 randomly-selected peaks from a total of 11,490 (download )

HGPS cell - Iyer - ENCSR000DNF

HGPS cell
Iyer
POLR2A
ENCSR000DNF
r=1.00

small heat map img

HGPS cell
Iyer
CTCF
ENCSR000DNG
r=0.19

small heat map img
10,000 randomly-selected peaks from a total of 16,338 (download )

HeLa-S3 - Iyer - ENCSR000DLM

HeLa-S3
Iyer
POLR2A
ENCSR000DLM
r=1.00

small heat map img

HeLa-S3
Iyer
POLR2A
ENCSR000EZL
r=0.83

small heat map img

HeLa-S3
Iyer
POLR2A
ENCSR000BGO
r=0.71

small heat map img

HeLa-S3
Iyer
MAX
ENCSR000ECN
r=0.63

small heat map img

HeLa-S3
Iyer
ELK1
ENCSR000ECI
r=0.60

small heat map img

HeLa-S3
Iyer
MXI1
ENCSR000ECU
r=0.60

small heat map img

HeLa-S3
Iyer
ZKSCAN1
ENCSR000ECJ
r=0.58

small heat map img

HeLa-S3
Iyer
RCOR1
ENCSR000ECM
r=0.58

small heat map img

HeLa-S3
Iyer
MYC
ENCSR000EZD
r=0.58

small heat map img

HeLa-S3
Iyer
HCFC1
ENCSR000ECH
r=0.58

small heat map img

HeLa-S3
Iyer
SMARCB1
ENCSR000EDK
r=0.54

small heat map img

HeLa-S3
Iyer
KAT2A
ENCSR000ECR
r=0.53

small heat map img

HeLa-S3
Iyer
MYC
ENCSR000DLN
r=0.52

small heat map img

HeLa-S3
Iyer
MAX
ENCSR000EZF
r=0.52

small heat map img

HeLa-S3
Iyer
MAFK
ENCSR000ECK
r=0.51

small heat map img

HeLa-S3
Iyer
E2F4
ENCSR000EVL
r=0.50

small heat map img

HeLa-S3
Iyer
E2F6
ENCSR000EVK
r=0.48

small heat map img

HeLa-S3
Iyer
ELK4
ENCSR000EVI
r=0.48

small heat map img

HeLa-S3
Iyer
E2F1
ENCSR000EVJ
r=0.47

small heat map img

HeLa-S3
Iyer
TBP
ENCSR000EDD
r=0.46

small heat map img

HeLa-S3
Iyer
SMC3
ENCSR000ECS
r=0.45

small heat map img

HeLa-S3
Iyer
TAF1
ENCSR000BHT
r=0.44

small heat map img

HeLa-S3
Iyer
BRCA1
ENCSR000EDB
r=0.44

small heat map img

HeLa-S3
Iyer
STAT1
ENCSR000EZK
r=0.43

small heat map img

HeLa-S3
Iyer
ZNF143
ENCSR000ECO
r=0.39

small heat map img

HeLa-S3
Iyer
RFX5
ENCSR000ECX
r=0.38

small heat map img

HeLa-S3
Iyer
TCF7L2
ENCSR000EVE
r=0.37

small heat map img

HeLa-S3
Iyer
NFYA
ENCSR000DNS
r=0.35

small heat map img

HeLa-S3
Iyer
SMARCA4
ENCSR000EZC
r=0.32

small heat map img

HeLa-S3
Iyer
NRF1
ENCSR000EDJ
r=0.32

small heat map img

HeLa-S3
Iyer
USF2
ENCSR000ECW
r=0.32

small heat map img

HeLa-S3
Iyer
FOS
ENCSR000EZE
r=0.32

small heat map img

HeLa-S3
Iyer
JUND
ENCSR000EDH
r=0.31

small heat map img

HeLa-S3
Iyer
SMARCC1
ENCSR000EDM
r=0.31

small heat map img

HeLa-S3
Iyer
CEBPB
ENCSR000EDA
r=0.30

small heat map img

HeLa-S3
Iyer
SMARCC2
ENCSR000EDL
r=0.28

small heat map img

HeLa-S3
Iyer
NFYB
ENCSR000DNR
r=0.27

small heat map img

HeLa-S3
Iyer
GABPA
ENCSR000BHS
r=0.26

small heat map img

HeLa-S3
Iyer
NR2C2
ENCSR000EVN
r=0.26

small heat map img

HeLa-S3
Iyer
PRDM1
ENCSR000ECY
r=0.24

small heat map img

HeLa-S3
Iyer
TCF7L2
ENCSR000EVF
r=0.24

small heat map img

HeLa-S3
Iyer
STAT3
ENCSR000EDC
r=0.24

small heat map img

HeLa-S3
Iyer
JUN
ENCSR000EDG
r=0.23

small heat map img

HeLa-S3
Iyer
IRF3
ENCSR000EDF
r=0.22

small heat map img

HeLa-S3
Iyer
SUPT20H
ENCSR000ECQ
r=0.22

small heat map img

HeLa-S3
Iyer
RAD21
ENCSR000EDE
r=0.20

small heat map img

HeLa-S3
Iyer
EP300
ENCSR000ECV
r=0.18

small heat map img

HeLa-S3
Iyer
CTCF
ENCSR000DLO
r=0.17

small heat map img

HeLa-S3
Iyer
CTCF
ENCSR000DUB
r=0.14

small heat map img

HeLa-S3
Iyer
REST
ENCSR000BMN
r=0.11

small heat map img

HeLa-S3
Iyer
ZNF274
ENCSR000EVG
r=0.10

small heat map img

HeLa-S3
Iyer
CTCF
ENCSR000AOA
r=0.09

small heat map img

HeLa-S3
Iyer
BRF2
ENCSR000DNV
r=0.05

small heat map img

HeLa-S3
Iyer
EZH2
ENCSR000ATC
r=0.05

small heat map img

HeLa-S3
Iyer
ZZZ3
ENCSR000DNT
r=0.00

small heat map img

HeLa-S3
Iyer
POLR3A
ENCSR000DNU
r=-0.01

small heat map img

HeLa-S3
Iyer
GTF3C2
ENCSR000DNY
r=-0.02

small heat map img

HeLa-S3
Iyer
BDP1
ENCSR000DNX
r=-0.09

small heat map img

HeLa-S3
Iyer
BRF1
ENCSR000DNW
r=-0.17

small heat map img
10,000 randomly-selected peaks from a total of 15,736 (download )

HeLa-S3 - Myers - ENCSR000BGO

HeLa-S3
Myers
POLR2A
ENCSR000BGO
r=1.00

small heat map img

HeLa-S3
Myers
POLR2A
ENCSR000EZL
r=0.76

small heat map img

HeLa-S3
Myers
POLR2A
ENCSR000DLM
r=0.72

small heat map img

HeLa-S3
Myers
TAF1
ENCSR000BHT
r=0.52

small heat map img

HeLa-S3
Myers
SMARCB1
ENCSR000EDK
r=0.51

small heat map img

HeLa-S3
Myers
MAX
ENCSR000ECN
r=0.51

small heat map img

HeLa-S3
Myers
ZKSCAN1
ENCSR000ECJ
r=0.50

small heat map img

HeLa-S3
Myers
KAT2A
ENCSR000ECR
r=0.50

small heat map img

HeLa-S3
Myers
MXI1
ENCSR000ECU
r=0.49

small heat map img

HeLa-S3
Myers
MYC
ENCSR000EZD
r=0.48

small heat map img

HeLa-S3
Myers
ELK1
ENCSR000ECI
r=0.47

small heat map img

HeLa-S3
Myers
TBP
ENCSR000EDD
r=0.47

small heat map img

HeLa-S3
Myers
HCFC1
ENCSR000ECH
r=0.46