PAX5 - Factorbook

This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. RefSeq, Jul 2013

Paired box protein Pax-5 is a protein that in humans is encoded by the PAX5 gene.wikipedia

PAX5
PDB 1K78
PDB	1K78 1MDM
ENCODE	experiments
Ensemble	search
Entrez	5079
GO	search
Gene Card	search
HGNC	search
RefSeq	search
UCSC	browse
UniProt	search
Wikipedia	PAX5

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

GM12878 - Myers - ENCSR000BHD

GM12878 - Myers - ENCSR000BHJ

Legend

Proximal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Distal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

GM12878 - Myers - ENCSR000BHJ

1. 336 / 500 6.5e-178 GTCACGCTTGGCTG		p-value: 0.00 pct_center: 0.24 pct_ratio: 1.38
2. 143 / 500 1.3e-71 AAAGAGGAAGTGAAA		p-value: 0.00 pct_center: 0.37 pct_ratio: 0.65
3. 32 / 500 3.4e-25 GTGTGTGTGTGTGTGTGTGTG		p-value: 0.02 pct_center: 0.21 pct_ratio: 0.70
4. 52 / 500 5.3e-13 TGCTGTGGTTT		p-value: 0.00 pct_center: 0.23 pct_ratio: 0.76
5. 43 / 500 6.3e-9 GGATATCCAGTTCTGAGTCAG		p-value: 0.00 pct_center: 0.13 pct_ratio: 0.88

MEME output

GM12878 - Myers - ENCSR000BHD

1. 455 / 500 4.3e-325 GCAGCCAAGCGTGAC		p-value: 0.00 pct_center: 0.34 pct_ratio: 1.67
2. 68 / 500 6.8e-39 AAAGAGGAAGTGAGA		p-value: 0.00 pct_center: 0.29 pct_ratio: 0.55
3. 14 / 500 8.8e-34 GTGTGTGTGTGTGTGTGTGTG		p-value: 0.01 pct_center: 0.18 pct_ratio: 0.66
4. 34 / 500 9.1e-12 CCAGCAGGTGGCGC		p-value: 0.01 pct_center: 0.26 pct_ratio: 0.91
5. 12 / 500 3.4e-10 AGGCTGCAGTGAGCTATGATCACGCCACT		p-value: 1.00 pct_center: 0.18 pct_ratio: 0.60

MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12891 - Myers - ENCSR000BJH

1. 499 / 500 9.1e-391 GGGGCAGCCAAGCGTGACC		p-value: 0.00 pct_center: 0.56 pct_ratio: 1.78
2. 53 / 500 1.2e-36 AAAAAGAAAGAGAAA		p-value: 0.00 pct_center: 0.28 pct_ratio: 0.48
3. 8 / 500 1.7e-25 TGGAGTGCAGTGGTGCGATCACAGCTCACT		p-value: 0.62 pct_center: 0.15 pct_ratio: 0.63
4. 7 / 500 1.1e-7 TTCCGAGCAGCTGGGACTACAGGTGCGTGC		p-value: 1.00 pct_center: 0.20 pct_ratio: 0.49
5. 15 / 500 0.000015 TGGGAGAATCAGTTGAGTCCAGGAAGTGG		p-value: 0.99 pct_center: 0.15 pct_ratio: 0.44

MEME output

Notes

GM12892 - Myers - ENCSR000BJI

1. 393 / 500 2.6e-262 GGGCAGCCGAGCGTGAC		p-value: 0.00 pct_center: 0.64 pct_ratio: 1.03
2. 43 / 500 1.3e-13 GCAGCGAGCGTGAC		p-value: 0.00 pct_center: 0.24 pct_ratio: 0.91
3. 23 / 500 0.00080 TCTGGGAACTGAAGT		p-value: 0.19 pct_center: 0.08 pct_ratio: 0.45
4. 50 / 500 0.00067 AGAGGAAG		p-value: 0.00 pct_center: 0.20 pct_ratio: 0.56
5. 15 / 500 11 AAATTCAAACTGAGA		p-value: 0.07 pct_center: 0.04 pct_ratio: 0.34

MEME output

Notes

Binding of other histone marks at PAX5 peaks

GM12878 - Myers - ENCSR000BHD

GM12878 Myers PAX5 ENCSR000BHD r=1.00
GM12878 Myers PAX5 ENCSR000BHJ r=0.57
GM12878 Myers H2AFZ ENCSR000AOV r=0.31
GM12878 Myers H3K4me2 ENCSR000AKG r=0.28
GM12878 Myers H3K9ac ENCSR000AKH r=0.28
GM12878 Myers H3K27ac ENCSR000AKC r=0.28
GM12878 Myers H3K4me3 ENCSR000AKA r=0.27
GM12878 Myers H3K4me3 ENCSR000DRY r=0.22
GM12878 Myers H3K4me1 ENCSR000AKF r=0.19
GM12878 Myers H3K79me2 ENCSR000AOW r=0.12
GM12878 Myers H3K9me3 ENCSR000AOX r=0.02
GM12878 Myers H4K20me1 ENCSR000AKI r=0.01
GM12878 Myers H3K36me3 ENCSR000DRW r=-0.01
GM12878 Myers H3K36me3 ENCSR000AKE r=-0.04
GM12878 Myers H3K27me3 ENCSR000DRX r=-0.04
GM12878 Myers H3K27me3 ENCSR000AKD r=-0.05

10,000 randomly-selected peaks from a total of 25,342 (download )

GM12878 - Myers - ENCSR000BHJ

GM12878 Myers PAX5 ENCSR000BHJ r=1.00
GM12878 Myers PAX5 ENCSR000BHD r=0.60
GM12878 Myers H3K27ac ENCSR000AKC r=0.21
GM12878 Myers H3K4me2 ENCSR000AKG r=0.20
GM12878 Myers H2AFZ ENCSR000AOV r=0.20
GM12878 Myers H3K9ac ENCSR000AKH r=0.18
GM12878 Myers H3K4me3 ENCSR000AKA r=0.17
GM12878 Myers H3K4me1 ENCSR000AKF r=0.16
GM12878 Myers H3K4me3 ENCSR000DRY r=0.10
GM12878 Myers H3K79me2 ENCSR000AOW r=0.04
GM12878 Myers H3K9me3 ENCSR000AOX r=0.01
GM12878 Myers H4K20me1 ENCSR000AKI r=0.00
GM12878 Myers H3K36me3 ENCSR000DRW r=-0.02
GM12878 Myers H3K27me3 ENCSR000DRX r=-0.03
GM12878 Myers H3K27me3 ENCSR000AKD r=-0.04
GM12878 Myers H3K36me3 ENCSR000AKE r=-0.04

10,000 randomly-selected peaks from a total of 19,740 (download )

GM12891 - Myers - ENCSR000BJH

GM12891 Myers PAX5 ENCSR000BJH r=1.00

3,156 peaks (download )

GM12892 - Myers - ENCSR000BJI

GM12892 Myers PAX5 ENCSR000BJI r=1.00

10,000 randomly-selected peaks from a total of 10,300 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

Binding of other TFs at PAX5 peaks

GM12878 - Myers - ENCSR000BHD

GM12878 Myers PAX5 ENCSR000BHD r=1.00
GM12878 Myers PAX5 ENCSR000BHJ r=0.57
GM12878 Myers RUNX3 ENCSR000BRI r=0.51
GM12878 Myers TBL1XR1 ENCSR000DYZ r=0.50
GM12878 Myers BHLHE40 ENCSR000DZJ r=0.49
GM12878 Myers MAX ENCSR000DZF r=0.48
GM12878 Myers EP300 ENCSR000DZG r=0.48
GM12878 Myers EP300 ENCSR000DZD r=0.47
GM12878 Myers RCOR1 ENCSR000DZC r=0.47
GM12878 Myers MXI1 ENCSR000DZI r=0.47
GM12878 Myers TCF12 ENCSR000BGZ r=0.46
GM12878 Myers RELA ENCSR000EAG r=0.45
GM12878 Myers STAT1 ENCSR000DZM r=0.45
GM12878 Myers JUND ENCSR000DYS r=0.44
GM12878 Myers ELK1 ENCSR000DZB r=0.44
GM12878 Myers CREB1 ENCSR000BUF r=0.44
GM12878 Myers FOXM1 ENCSR000BRU r=0.42
GM12878 Myers SP1 ENCSR000BHK r=0.42
GM12878 Myers ATF2 ENCSR000BQK r=0.41
GM12878 Myers TCF3 ENCSR000BQT r=0.41
GM12878 Myers ESRRA ENCSR000DYQ r=0.40
GM12878 Myers ELF1 ENCSR000BMB r=0.39
GM12878 Myers CUX1 ENCSR000DYR r=0.38
GM12878 Myers SIN3A ENCSR000DYX r=0.38
GM12878 Myers SREBF1 ENCSR000DYU r=0.38
GM12878 Myers WRNIP1 ENCSR000EAA r=0.37
GM12878 Myers NFIC ENCSR000BRN r=0.37
GM12878 Myers BCL11A ENCSR000BHA r=0.37
GM12878 Myers STAT3 ENCSR000DZV r=0.37
GM12878 Myers SMC3 ENCSR000DZP r=0.37
GM12878 Myers POU2F2 ENCSR000BGP r=0.37
GM12878 Myers PML ENCSR000BQM r=0.37
GM12878 Myers MYC ENCSR000DKU r=0.36
GM12878 Myers POLR2A ENCSR000EAD r=0.36
GM12878 Myers TBP ENCSR000DZZ r=0.36
GM12878 Myers POLR2A ENCSR000EYW r=0.36
GM12878 Myers BCL3 ENCSR000BNQ r=0.36
GM12878 Myers POLR2A ENCSR000DKT r=0.35
GM12878 Myers BRCA1 ENCSR000DZS r=0.35
GM12878 Myers MAFK ENCSR000DYV r=0.35
GM12878 Myers YY1 ENCSR000BNP r=0.35
GM12878 Myers RAD21 ENCSR000EAC r=0.35
GM12878 Myers CHD1 ENCSR000DZE r=0.35
GM12878 Myers EBF1 ENCSR000BGU r=0.35
GM12878 Myers E2F4 ENCSR000DYY r=0.34
GM12878 Myers POLR2A ENCSR000BGD r=0.34
GM12878 Myers IRF4 ENCSR000BGY r=0.34
GM12878 Myers USF2 ENCSR000DZU r=0.34
GM12878 Myers NRF1 ENCSR000DZO r=0.34
GM12878 Myers CEBPB ENCSR000BRX r=0.34
GM12878 Myers RFX5 ENCSR000DZW r=0.34
GM12878 Myers EBF1 ENCSR000DZQ r=0.33
GM12878 Myers SREBF2 ENCSR000DYT r=0.32
GM12878 Myers EP300 ENCSR000BHB r=0.32
GM12878 Myers ZNF384 ENCSR000DYP r=0.32
GM12878 Myers IKZF1 ENCSR000EUJ r=0.31
GM12878 Myers NFATC1 ENCSR000BQL r=0.31
GM12878 Myers ETS1 ENCSR000BKA r=0.31
GM12878 Myers FOS ENCSR000EYZ r=0.30
GM12878 Myers STAT5A ENCSR000BQZ r=0.30
GM12878 Myers MEF2A ENCSR000BKB r=0.30
GM12878 Myers ZNF143 ENCSR000DZL r=0.29
GM12878 Myers IRF3 ENCSR000DZX r=0.28
GM12878 Myers MTA3 ENCSR000BRH r=0.28
GM12878 Myers EGR1 ENCSR000BMQ r=0.27
GM12878 Myers SRF ENCSR000BMI r=0.27
GM12878 Myers BATF ENCSR000BGT r=0.27
GM12878 Myers TAF1 ENCSR000BGS r=0.26
GM12878 Myers EGR1 ENCSR000BRG r=0.25
GM12878 Myers GABPA ENCSR000BGC r=0.25
GM12878 Myers NFE2 ENCSR000DZY r=0.25
GM12878 Myers SIX5 ENCSR000BJE r=0.23
GM12878 Myers SPI1 ENCSR000BGQ r=0.23
GM12878 Myers CTCF ENCSR000DKV r=0.23
GM12878 Myers CTCF ENCSR000DZN r=0.23
GM12878 Myers JUND ENCSR000EYV r=0.21
GM12878 Myers SRF ENCSR000BGE r=0.21
GM12878 Myers NFYB ENCSR000DNM r=0.21
GM12878 Myers NR2C2 ENCSR000EUL r=0.21
GM12878 Myers CTCF ENCSR000AKB r=0.21
GM12878 Myers RAD21 ENCSR000BMY r=0.21
GM12878 Myers PBX3 ENCSR000BGR r=0.20
GM12878 Myers USF1 ENCSR000BGI r=0.20
GM12878 Myers RXRA ENCSR000BJD r=0.20
GM12878 Myers KAT2A ENCSR000DNO r=0.20
GM12878 Myers NFYA ENCSR000DNN r=0.20
GM12878 Myers ZBTB33 ENCSR000BHC r=0.19
GM12878 Myers CTCF ENCSR000DRZ r=0.18
GM12878 Myers YY1 ENCSR000EUM r=0.15
GM12878 Myers EZH2 ENCSR000ARD r=0.15
GM12878 Myers SUPT20H ENCSR000DNP r=0.14
GM12878 Myers MEF2C ENCSR000BNG r=0.13
GM12878 Myers POLR3G ENCSR000EYU r=0.12
GM12878 Myers ZEB1 ENCSR000BND r=0.12
GM12878 Myers ATF3 ENCSR000BJY r=0.11
GM12878 Myers REST ENCSR000BGF r=0.11
GM12878 Myers REST ENCSR000BQS r=0.08
GM12878 Myers ZZZ3 ENCSR000DNQ r=0.03
GM12878 Myers ZNF274 ENCSR000EUK r=-0.07

10,000 randomly-selected peaks from a total of 25,342 (download )

GM12878 - Myers - ENCSR000BHJ

GM12878 Myers PAX5 ENCSR000BHJ r=1.00
GM12878 Myers PAX5 ENCSR000BHD r=0.60
GM12878 Myers RUNX3 ENCSR000BRI r=0.45
GM12878 Myers EP300 ENCSR000DZD r=0.45
GM12878 Myers BCL11A ENCSR000BHA r=0.44
GM12878 Myers EP300 ENCSR000DZG r=0.44
GM12878 Myers SP1 ENCSR000BHK r=0.43
GM12878 Myers TBL1XR1 ENCSR000DYZ r=0.42
GM12878 Myers BHLHE40 ENCSR000DZJ r=0.41
GM12878 Myers TCF12 ENCSR000BGZ r=0.41
GM12878 Myers RELA ENCSR000EAG r=0.40
GM12878 Myers FOXM1 ENCSR000BRU r=0.39
GM12878 Myers JUND ENCSR000DYS r=0.39
GM12878 Myers ATF2 ENCSR000BQK r=0.38
GM12878 Myers RCOR1 ENCSR000DZC r=0.38
GM12878 Myers NFIC ENCSR000BRN r=0.36
GM12878 Myers EP300 ENCSR000BHB r=0.35
GM12878 Myers IRF4 ENCSR000BGY r=0.35
GM12878 Myers BCL3 ENCSR000BNQ r=0.34
GM12878 Myers MXI1 ENCSR000DZI r=0.34
GM12878 Myers CUX1 ENCSR000DYR r=0.34
GM12878 Myers EBF1 ENCSR000BGU r=0.34
GM12878 Myers TCF3 ENCSR000BQT r=0.34
GM12878 Myers BATF ENCSR000BGT r=0.33
GM12878 Myers STAT3 ENCSR000DZV r=0.33
GM12878 Myers MAX ENCSR000DZF r=0.32
GM12878 Myers CREB1 ENCSR000BUF r=0.32
GM12878 Myers SMC3 ENCSR000DZP r=0.32
GM12878 Myers RAD21 ENCSR000EAC r=0.32
GM12878 Myers NFATC1 ENCSR000BQL r=0.32
GM12878 Myers IKZF1 ENCSR000EUJ r=0.31
GM12878 Myers STAT1 ENCSR000DZM r=0.31
GM12878 Myers POU2F2 ENCSR000BGP r=0.31
GM12878 Myers ELK1 ENCSR000DZB r=0.31
GM12878 Myers SREBF1 ENCSR000DYU r=0.30
GM12878 Myers CEBPB ENCSR000BRX r=0.30
GM12878 Myers MEF2A ENCSR000BKB r=0.30
GM12878 Myers ESRRA ENCSR000DYQ r=0.30
GM12878 Myers EBF1 ENCSR000DZQ r=0.30
GM12878 Myers PML ENCSR000BQM r=0.29
GM12878 Myers TBP ENCSR000DZZ r=0.28
GM12878 Myers STAT5A ENCSR000BQZ r=0.28
GM12878 Myers MAFK ENCSR000DYV r=0.28
GM12878 Myers WRNIP1 ENCSR000EAA r=0.27
GM12878 Myers MTA3 ENCSR000BRH r=0.27
GM12878 Myers ELF1 ENCSR000BMB r=0.26
GM12878 Myers JUND ENCSR000EYV r=0.26
GM12878 Myers ZNF384 ENCSR000DYP r=0.26
GM12878 Myers SPI1 ENCSR000BGQ r=0.25
GM12878 Myers RFX5 ENCSR000DZW r=0.25
GM12878 Myers FOS ENCSR000EYZ r=0.24
GM12878 Myers USF2 ENCSR000DZU r=0.24
GM12878 Myers SREBF2 ENCSR000DYT r=0.24
GM12878 Myers ETS1 ENCSR000BKA r=0.24
GM12878 Myers BRCA1 ENCSR000DZS r=0.24
GM12878 Myers CHD1 ENCSR000DZE r=0.24
GM12878 Myers YY1 ENCSR000BNP r=0.23
GM12878 Myers SRF ENCSR000BMI r=0.22
GM12878 Myers SIN3A ENCSR000DYX r=0.22
GM12878 Myers IRF3 ENCSR000DZX r=0.21
GM12878 Myers E2F4 ENCSR000DYY r=0.21
GM12878 Myers POLR2A ENCSR000EAD r=0.21
GM12878 Myers MYC ENCSR000DKU r=0.21
GM12878 Myers EGR1 ENCSR000BMQ r=0.21
GM12878 Myers POLR2A ENCSR000EYW r=0.20
GM12878 Myers NRF1 ENCSR000DZO r=0.19
GM12878 Myers NFE2 ENCSR000DZY r=0.19
GM12878 Myers EZH2 ENCSR000ARD r=0.19
GM12878 Myers POLR2A ENCSR000DKT r=0.19
GM12878 Myers PBX3 ENCSR000BGR r=0.18
GM12878 Myers POLR2A ENCSR000BGD r=0.18
GM12878 Myers TAF1 ENCSR000BGS r=0.17
GM12878 Myers RXRA ENCSR000BJD r=0.17
GM12878 Myers ZNF143 ENCSR000DZL r=0.16
GM12878 Myers ZBTB33 ENCSR000BHC r=0.16
GM12878 Myers RAD21 ENCSR000BMY r=0.15
GM12878 Myers NFYA ENCSR000DNN r=0.15
GM12878 Myers NFYB ENCSR000DNM r=0.15
GM12878 Myers YY1 ENCSR000EUM r=0.15
GM12878 Myers SIX5 ENCSR000BJE r=0.15
GM12878 Myers EGR1 ENCSR000BRG r=0.14
GM12878 Myers KAT2A ENCSR000DNO r=0.14
GM12878 Myers CTCF ENCSR000DZN r=0.13
GM12878 Myers GABPA ENCSR000BGC r=0.13
GM12878 Myers MEF2C ENCSR000BNG r=0.13
GM12878 Myers SUPT20H ENCSR000DNP r=0.13
GM12878 Myers USF1 ENCSR000BGI r=0.12
GM12878 Myers SRF ENCSR000BGE r=0.12
GM12878 Myers NR2C2 ENCSR000EUL r=0.12
GM12878 Myers CTCF ENCSR000DKV r=0.11
GM12878 Myers CTCF ENCSR000AKB r=0.10
GM12878 Myers REST ENCSR000BGF r=0.09
GM12878 Myers POLR3G ENCSR000EYU r=0.08
GM12878 Myers ZEB1 ENCSR000BND r=0.08
GM12878 Myers CTCF ENCSR000DRZ r=0.08
GM12878 Myers REST ENCSR000BQS r=0.07
GM12878 Myers ATF3 ENCSR000BJY r=0.06
GM12878 Myers ZZZ3 ENCSR000DNQ r=0.02
GM12878 Myers ZNF274 ENCSR000EUK r=-0.03

10,000 randomly-selected peaks from a total of 19,740 (download )

GM12891 - Myers - ENCSR000BJH

GM12891 Myers PAX5 ENCSR000BJH r=1.00
GM12891 Myers POU2F2 ENCSR000BII r=0.33
GM12891 Myers SPI1 ENCSR000BIJ r=0.26
GM12891 Myers TAF1 ENCSR000BIM r=0.21
GM12891 Myers POLR2A ENCSR000EAJ r=0.20
GM12891 Myers YY1 ENCSR000BKJ r=0.19
GM12891 Myers CTCF ENCSR000DKX r=0.17
GM12891 Myers POLR2A ENCSR000BIK r=0.17

3,156 peaks (download )

GM12892 - Myers - ENCSR000BJI

GM12892 Myers PAX5 ENCSR000BJI r=1.00
GM12892 Myers RELA ENCSR000EAN r=0.30
GM12892 Myers POLR2A ENCSR000EAM r=0.20
GM12892 Myers POLR2A ENCSR000BHZ r=0.19
GM12892 Myers YY1 ENCSR000BLT r=0.18
GM12892 Myers TAF1 ENCSR000BIB r=0.16
GM12892 Myers CTCF ENCSR000DKY r=0.15

10,000 randomly-selected peaks from a total of 10,300 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Myers - ENCSR000BHD

GM12878 - Myers - ENCSR000BHJ

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.