NR2C2

This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms. RefSeq, Apr 2014
Testicular receptor 4 also known as NR2C2 (nuclear receptor subfamily 2, group C, member 2) is a protein that in humans is encoded by the NR2C2 gene. The testicular receptor 4 is a member of the nuclear receptor family of transcription factors.wikipedia

NR2C2

PDB image
PDB 3P0U

PDB 3P0U
ENCODE experiments
Ensemble search
Entrez 7182
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia NR2C2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

GM12878 - Farnham - ENCSR000EUL

loading

HeLa-S3 - Farnham - ENCSR000EVN

loading

HepG2 - Farnham - ENCSR000EVS

loading

K562 - Farnham - ENCSR000EWH

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

GM12878 - Farnham - ENCSR000EUL

1.
188 / 500
4.3e-309
AGGGGTCAAAGGTCA
small heat map img p-value: 0.07
pct_center: 0.23
pct_ratio: 0.83
2.
110 / 500
7.0e-164
TGACCCGGAAGCGAT
small heat map img p-value: 0.14
pct_center: 0.07
pct_ratio: 0.72
3.
68 / 500
2.2e-74
TGTGTGTGGTGAGTTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.62
pct_ratio: 0.62
4.
52 / 500
1.5e-69
CAGGCCGGAGCAGTCGAGCGCCGAG
small heat map img p-value: 1.00
pct_center: 0.16
pct_ratio: 0.43
5.
26 / 500
1.1e-62
TGTGTGTGGTGTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.44
pct_ratio: 0.65
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Farnham - ENCSR000EVN

1.
305 / 500
4.6e-457
ACCCGGAAGCGGT
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 1.96
2.
76 / 500
4.3e-74
AGAGGTCAAAGGTCA
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 0.91
3.
98 / 500
3.4e-46
GATCGATTGCTTATGCCTG
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 0.83
4.
22 / 500
1.6e-41
CGCGGTGCATTCTGGGAAATGTAGTTC
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.64
5.
143 / 500
6.3e-33
CCGGAAGTGGC
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 1.41
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Farnham - ENCSR000EVS

1.
442 / 500
1.3e-424
GACCCGGAAGCGGAT
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 1.13
2.
93 / 500
8.2e-112
GGGGTCAGAGGTCA
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 0.85
3.
25 / 500
2.5e-49
GGCATTCTGGGAAATGTAGTC
small heat map img p-value: 0.72
pct_center: 0.26
pct_ratio: 0.57
4.
145 / 500
1.8e-34
CCGGAAGT
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 1.76
5.
35 / 500
1.4e-17
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.75
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Farnham - ENCSR000EWH

1.
171 / 500
4.8e-255
ACCCGGAAGCAGTTGC
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 1.64
2.
119 / 500
3.7e-190
GAGGTCAGAGGTCA
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 1.00
3.
98 / 500
1.4e-131
GCGATCGATTGGTCATGCCTG
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 1.21
4.
30 / 500
4.1e-28
CGAGCGCCGAGCGCGTCGAT
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.98
5.
23 / 500
1.2e-16
GAGCGCCGAGCGATCGATGG
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.79
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at NR2C2 peaks

GM12878 - Farnham - ENCSR000EUL

GM12878
Farnham
NR2C2
ENCSR000EUL
r=1.00

small heat map img

GM12878
Farnham
H2AFZ
ENCSR000AOV
r=0.56

small heat map img

GM12878
Farnham
H3K9ac
ENCSR000AKH
r=0.52

small heat map img

GM12878
Farnham
H3K4me3
ENCSR000DRY
r=0.50

small heat map img

GM12878
Farnham
H3K4me3
ENCSR000AKA
r=0.48

small heat map img

GM12878
Farnham
H3K27ac
ENCSR000AKC
r=0.47

small heat map img

GM12878
Farnham
H3K4me2
ENCSR000AKG
r=0.35

small heat map img

GM12878
Farnham
H3K79me2
ENCSR000AOW
r=0.25

small heat map img

GM12878
Farnham
H3K9me3
ENCSR000AOX
r=0.08

small heat map img

GM12878
Farnham
H3K4me1
ENCSR000AKF
r=0.08

small heat map img

GM12878
Farnham
H4K20me1
ENCSR000AKI
r=-0.01

small heat map img

GM12878
Farnham
H3K27me3
ENCSR000AKD
r=-0.02

small heat map img

GM12878
Farnham
H3K36me3
ENCSR000DRW
r=-0.03

small heat map img

GM12878
Farnham
H3K27me3
ENCSR000DRX
r=-0.05

small heat map img

GM12878
Farnham
H3K36me3
ENCSR000AKE
r=-0.09

small heat map img
1,263 peaks (download )

HeLa-S3 - Farnham - ENCSR000EVN

HeLa-S3
Farnham
NR2C2
ENCSR000EVN
r=1.00

small heat map img

HeLa-S3
Farnham
H3K4me3
ENCSR000AOF
r=0.55

small heat map img

HeLa-S3
Farnham
H3K4me3
ENCSR000DUA
r=0.55

small heat map img

HeLa-S3
Farnham
H3K9ac
ENCSR000AOH
r=0.54

small heat map img

HeLa-S3
Farnham
H2AFZ
ENCSR000AQN
r=0.50

small heat map img

HeLa-S3
Farnham
H3K27ac
ENCSR000AOC
r=0.48

small heat map img

HeLa-S3
Farnham
H3K4me2
ENCSR000AOE
r=0.35

small heat map img

HeLa-S3
Farnham
H3K79me2
ENCSR000AOG
r=0.10

small heat map img

HeLa-S3
Farnham
H3K27me3
ENCSR000DTY
r=0.05

small heat map img

HeLa-S3
Farnham
H3K4me1
ENCSR000APW
r=0.04

small heat map img

HeLa-S3
Farnham
H3K9me3
ENCSR000AQO
r=-0.03

small heat map img

HeLa-S3
Farnham
H3K36me3
ENCSR000DTZ
r=-0.04

small heat map img

HeLa-S3
Farnham
H4K20me1
ENCSR000AOI
r=-0.05

small heat map img

HeLa-S3
Farnham
H3K27me3
ENCSR000APB
r=-0.06

small heat map img

HeLa-S3
Farnham
H3K36me3
ENCSR000AOD
r=-0.15

small heat map img
2,115 peaks (download )

HepG2 - Farnham - ENCSR000EVS

HepG2
Farnham
NR2C2
ENCSR000EVS
r=1.00

small heat map img

HepG2
Farnham
H3K4me3
ENCSR000AMP
r=0.48

small heat map img

HepG2
Farnham
H3K4me3
ENCSR000DUF
r=0.47

small heat map img

HepG2
Farnham
H3K9ac
ENCSR000AMD
r=0.45

small heat map img

HepG2
Farnham
H2AFZ
ENCSR000AOK
r=0.40

small heat map img

HepG2
Farnham
H3K27ac
ENCSR000AMO
r=0.40

small heat map img

HepG2
Farnham
H3K4me2
ENCSR000AMC
r=0.35

small heat map img

HepG2
Farnham
H3K27me3
ENCSR000AOL
r=0.32

small heat map img

HepG2
Farnham
H3K79me2
ENCSR000AOM
r=0.11

small heat map img

HepG2
Farnham
H3K27me3
ENCSR000DUE
r=0.05

small heat map img

HepG2
Farnham
H3K9me3
ENCSR000ATD
r=0.02

small heat map img

HepG2
Farnham
H4K20me1
ENCSR000AMQ
r=0.01

small heat map img

HepG2
Farnham
H3K4me1
ENCSR000APV
r=-0.02

small heat map img

HepG2
Farnham
H3K36me3
ENCSR000DUD
r=-0.07

small heat map img

HepG2
Farnham
H3K36me3
ENCSR000AMB
r=-0.10

small heat map img
2,953 peaks (download )

K562 - Farnham - ENCSR000EWH

K562
Farnham
NR2C2
ENCSR000EWH
r=1.00

small heat map img

K562
Farnham
H2AFZ
ENCSR000APC
r=0.57

small heat map img

K562
Farnham
H3K4me3
ENCSR000EWA
r=0.55

small heat map img

K562
Farnham
H3K4me3
ENCSR000DWD
r=0.53

small heat map img

K562
Farnham
H3K9ac
ENCSR000EVZ
r=0.52

small heat map img

K562
Farnham
H3K4me3
ENCSR000AKU
r=0.52

small heat map img

K562
Farnham
H3K27ac
ENCSR000AKP
r=0.51

small heat map img

K562
Farnham
H3K4me2
ENCSR000AKT
r=0.51

small heat map img

K562
Farnham
H3K9ac
ENCSR000AKV
r=0.50

small heat map img

K562
Farnham
H3K4me1
ENCSR000EWC
r=0.16

small heat map img

K562
Farnham
H3K79me2
ENCSR000APD
r=0.12

small heat map img

K562
Farnham
H3K9me3
ENCSR000APE
r=0.10

small heat map img

K562
Farnham
H3K27me3
ENCSR000AKQ
r=0.08

small heat map img

K562
Farnham
H4K20me1
ENCSR000AKX
r=0.08

small heat map img

K562
Farnham
H3K27me3
ENCSR000DWC
r=0.06

small heat map img

K562
Farnham
H3K9me1
ENCSR000AKW
r=0.05

small heat map img

K562
Farnham
H3K27me3
ENCSR000EWB
r=0.05

small heat map img

K562
Farnham
H3K4me1
ENCSR000AKS
r=-0.02

small heat map img

K562
Farnham
H3K36me3
ENCSR000DWB
r=-0.07

small heat map img

K562
Farnham
H3K36me3
ENCSR000AKR
r=-0.11

small heat map img
587 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at NR2C2 peaks

GM12878 - Farnham - ENCSR000EUL

GM12878
Farnham
NR2C2
ENCSR000EUL
r=1.00

small heat map img

GM12878
Farnham
SREBF1
ENCSR000DYU
r=0.61

small heat map img

GM12878
Farnham
TBL1XR1
ENCSR000DYZ
r=0.58

small heat map img

GM12878
Farnham
ELK1
ENCSR000DZB
r=0.58

small heat map img

GM12878
Farnham
MAX
ENCSR000DZF
r=0.57

small heat map img

GM12878
Farnham
MXI1
ENCSR000DZI
r=0.56

small heat map img

GM12878
Farnham
ELF1
ENCSR000BMB
r=0.54

small heat map img

GM12878
Farnham
SIN3A
ENCSR000DYX
r=0.54

small heat map img

GM12878
Farnham
STAT1
ENCSR000DZM
r=0.54

small heat map img

GM12878
Farnham
GABPA
ENCSR000BGC
r=0.53

small heat map img

GM12878
Farnham
CREB1
ENCSR000BUF
r=0.53

small heat map img

GM12878
Farnham
ESRRA
ENCSR000DYQ
r=0.52

small heat map img

GM12878
Farnham
YY1
ENCSR000BNP
r=0.51

small heat map img

GM12878
Farnham
SIX5
ENCSR000BJE
r=0.50

small heat map img

GM12878
Farnham
POLR2A
ENCSR000EAD
r=0.50

small heat map img

GM12878
Farnham
POLR2A
ENCSR000EYW
r=0.50

small heat map img

GM12878
Farnham
RCOR1
ENCSR000DZC
r=0.49

small heat map img

GM12878
Farnham
SRF
ENCSR000BMI
r=0.49

small heat map img

GM12878
Farnham
TBP
ENCSR000DZZ
r=0.48

small heat map img

GM12878
Farnham
CUX1
ENCSR000DYR
r=0.48

small heat map img

GM12878
Farnham
SREBF2
ENCSR000DYT
r=0.48

small heat map img

GM12878
Farnham
BHLHE40
ENCSR000DZJ
r=0.48

small heat map img

GM12878
Farnham
ETS1
ENCSR000BKA
r=0.48

small heat map img

GM12878
Farnham
RUNX3
ENCSR000BRI
r=0.48

small heat map img

GM12878
Farnham
MYC
ENCSR000DKU
r=0.48

small heat map img

GM12878
Farnham
POLR2A
ENCSR000DKT
r=0.48

small heat map img

GM12878
Farnham
EP300
ENCSR000DZG
r=0.47

small heat map img

GM12878
Farnham
RELA
ENCSR000EAG
r=0.47

small heat map img

GM12878
Farnham
EP300
ENCSR000DZD
r=0.47

small heat map img

GM12878
Farnham
PAX5
ENCSR000BHD
r=0.46

small heat map img

GM12878
Farnham
POLR2A
ENCSR000BGD
r=0.46

small heat map img

GM12878
Farnham
JUND
ENCSR000DYS
r=0.46

small heat map img

GM12878
Farnham
BRCA1
ENCSR000DZS
r=0.45

small heat map img

GM12878
Farnham
E2F4
ENCSR000DYY
r=0.45

small heat map img

GM12878
Farnham
USF2
ENCSR000DZU
r=0.44

small heat map img

GM12878
Farnham
RFX5
ENCSR000DZW
r=0.43

small heat map img

GM12878
Farnham
WRNIP1
ENCSR000EAA
r=0.43

small heat map img

GM12878
Farnham
MAFK
ENCSR000DYV
r=0.42

small heat map img

GM12878
Farnham
NRF1
ENCSR000DZO
r=0.42

small heat map img

GM12878
Farnham
SRF
ENCSR000BGE
r=0.41

small heat map img

GM12878
Farnham
PML
ENCSR000BQM
r=0.41

small heat map img

GM12878
Farnham
ZNF143
ENCSR000DZL
r=0.40

small heat map img

GM12878
Farnham
STAT3
ENCSR000DZV
r=0.39

small heat map img

GM12878
Farnham
EGR1
ENCSR000BRG
r=0.39

small heat map img

GM12878
Farnham
CHD1
ENCSR000DZE
r=0.38

small heat map img

GM12878
Farnham
ZNF384
ENCSR000DYP
r=0.38

small heat map img

GM12878
Farnham
SP1
ENCSR000BHK
r=0.37

small heat map img

GM12878
Farnham
SMC3
ENCSR000DZP
r=0.37

small heat map img

GM12878
Farnham
TCF12
ENCSR000BGZ
r=0.37

small heat map img

GM12878
Farnham
IRF3
ENCSR000DZX
r=0.37

small heat map img

GM12878
Farnham
FOS
ENCSR000EYZ
r=0.35

small heat map img

GM12878
Farnham
POU2F2
ENCSR000BGP
r=0.35

small heat map img

GM12878
Farnham
ATF2
ENCSR000BQK
r=0.34

small heat map img

GM12878
Farnham
FOXM1
ENCSR000BRU
r=0.34

small heat map img

GM12878
Farnham
TAF1
ENCSR000BGS
r=0.33

small heat map img

GM12878
Farnham
CEBPB
ENCSR000BRX
r=0.33

small heat map img

GM12878
Farnham
KAT2A
ENCSR000DNO
r=0.32

small heat map img

GM12878
Farnham
NFE2
ENCSR000DZY
r=0.31

small heat map img

GM12878
Farnham
RAD21
ENCSR000EAC
r=0.31

small heat map img

GM12878
Farnham
NFIC
ENCSR000BRN
r=0.30

small heat map img

GM12878
Farnham
EGR1
ENCSR000BMQ
r=0.29

small heat map img

GM12878
Farnham
TCF3
ENCSR000BQT
r=0.29

small heat map img

GM12878
Farnham
YY1
ENCSR000EUM
r=0.27

small heat map img

GM12878
Farnham
EBF1
ENCSR000DZQ
r=0.27

small heat map img

GM12878
Farnham
BCL3
ENCSR000BNQ
r=0.27

small heat map img

GM12878
Farnham
STAT5A
ENCSR000BQZ
r=0.26

small heat map img

GM12878
Farnham
NFYB
ENCSR000DNM
r=0.26

small heat map img

GM12878
Farnham
MEF2A
ENCSR000BKB
r=0.25

small heat map img

GM12878
Farnham
IRF4
ENCSR000BGY
r=0.25

small heat map img

GM12878
Farnham
CTCF
ENCSR000DZN
r=0.24

small heat map img

GM12878
Farnham
USF1
ENCSR000BGI
r=0.24

small heat map img

GM12878
Farnham
NFYA
ENCSR000DNN
r=0.23

small heat map img

GM12878
Farnham
PAX5
ENCSR000BHJ
r=0.22

small heat map img

GM12878
Farnham
MTA3
ENCSR000BRH
r=0.22

small heat map img

GM12878
Farnham
NFATC1
ENCSR000BQL
r=0.22

small heat map img

GM12878
Farnham
EZH2
ENCSR000ARD
r=0.20

small heat map img

GM12878
Farnham
SUPT20H
ENCSR000DNP
r=0.19

small heat map img

GM12878
Farnham
CTCF
ENCSR000AKB
r=0.19

small heat map img

GM12878
Farnham
CTCF
ENCSR000DKV
r=0.19

small heat map img

GM12878
Farnham
EP300
ENCSR000BHB
r=0.18

small heat map img

GM12878
Farnham
POLR3G
ENCSR000EYU
r=0.18

small heat map img

GM12878
Farnham
RXRA
ENCSR000BJD
r=0.18

small heat map img

GM12878
Farnham
ZBTB33
ENCSR000BHC
r=0.18

small heat map img

GM12878
Farnham
REST
ENCSR000BGF
r=0.16

small heat map img

GM12878
Farnham
IKZF1
ENCSR000EUJ
r=0.15

small heat map img

GM12878
Farnham
PBX3
ENCSR000BGR
r=0.15

small heat map img

GM12878
Farnham
CTCF
ENCSR000DRZ
r=0.14

small heat map img

GM12878
Farnham
EBF1
ENCSR000BGU
r=0.14

small heat map img

GM12878
Farnham
ZEB1
ENCSR000BND
r=0.14

small heat map img

GM12878
Farnham
ATF3
ENCSR000BJY
r=0.13

small heat map img

GM12878
Farnham
ZZZ3
ENCSR000DNQ
r=0.12

small heat map img

GM12878
Farnham
MEF2C
ENCSR000BNG
r=0.12

small heat map img

GM12878
Farnham
BCL11A
ENCSR000BHA
r=0.12

small heat map img

GM12878
Farnham
SPI1
ENCSR000BGQ
r=0.12

small heat map img

GM12878
Farnham
REST
ENCSR000BQS
r=0.11

small heat map img

GM12878
Farnham
JUND
ENCSR000EYV
r=0.11

small heat map img

GM12878
Farnham
RAD21
ENCSR000BMY
r=0.07

small heat map img

GM12878
Farnham
BATF
ENCSR000BGT
r=0.07

small heat map img

GM12878
Farnham
ZNF274
ENCSR000EUK
r=0.01

small heat map img
1,263 peaks (download )

HeLa-S3 - Farnham - ENCSR000EVN

HeLa-S3
Farnham
NR2C2
ENCSR000EVN
r=1.00

small heat map img

HeLa-S3
Farnham
HCFC1
ENCSR000ECH
r=0.71

small heat map img

HeLa-S3
Farnham
ELK1
ENCSR000ECI
r=0.60

small heat map img

HeLa-S3
Farnham
GABPA
ENCSR000BHS
r=0.60

small heat map img

HeLa-S3
Farnham
MYC
ENCSR000EZD
r=0.54

small heat map img

HeLa-S3
Farnham
MAX
ENCSR000ECN
r=0.54

small heat map img

HeLa-S3
Farnham
MAX
ENCSR000EZF
r=0.52

small heat map img

HeLa-S3
Farnham
MXI1
ENCSR000ECU
r=0.52

small heat map img

HeLa-S3
Farnham
ELK4
ENCSR000EVI
r=0.51

small heat map img

HeLa-S3
Farnham
RCOR1
ENCSR000ECM
r=0.50

small heat map img

HeLa-S3
Farnham
ZKSCAN1
ENCSR000ECJ
r=0.48

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000DLM
r=0.48

small heat map img

HeLa-S3
Farnham
MAFK
ENCSR000ECK
r=0.46

small heat map img

HeLa-S3
Farnham
RFX5
ENCSR000ECX
r=0.45

small heat map img

HeLa-S3
Farnham
MYC
ENCSR000DLN
r=0.44

small heat map img

HeLa-S3
Farnham
BRCA1
ENCSR000EDB
r=0.44

small heat map img

HeLa-S3
Farnham
TBP
ENCSR000EDD
r=0.43

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000EZL
r=0.43

small heat map img

HeLa-S3
Farnham
E2F4
ENCSR000EVL
r=0.42

small heat map img

HeLa-S3
Farnham
STAT1
ENCSR000EZK
r=0.41

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000BGO
r=0.41

small heat map img

HeLa-S3
Farnham
E2F6
ENCSR000EVK
r=0.39

small heat map img

HeLa-S3
Farnham
SMC3
ENCSR000ECS
r=0.39

small heat map img

HeLa-S3
Farnham
ZNF143
ENCSR000ECO
r=0.38

small heat map img

HeLa-S3
Farnham
E2F1
ENCSR000EVJ
r=0.37

small heat map img

HeLa-S3
Farnham
SMARCB1
ENCSR000EDK
r=0.36

small heat map img

HeLa-S3
Farnham
TCF7L2
ENCSR000EVE
r=0.34

small heat map img

HeLa-S3
Farnham
NFYA
ENCSR000DNS
r=0.33

small heat map img

HeLa-S3
Farnham
USF2
ENCSR000ECW
r=0.31

small heat map img

HeLa-S3
Farnham
NRF1
ENCSR000EDJ
r=0.30

small heat map img

HeLa-S3
Farnham
KAT2A
ENCSR000ECR
r=0.30

small heat map img

HeLa-S3
Farnham
FOS
ENCSR000EZE
r=0.30

small heat map img

HeLa-S3
Farnham
JUND
ENCSR000EDH
r=0.30

small heat map img

HeLa-S3
Farnham
TAF1
ENCSR000BHT
r=0.29

small heat map img

HeLa-S3
Farnham
STAT3
ENCSR000EDC
r=0.28

small heat map img

HeLa-S3
Farnham
IRF3
ENCSR000EDF
r=0.28

small heat map img

HeLa-S3
Farnham
PRDM1
ENCSR000ECY
r=0.26

small heat map img

HeLa-S3
Farnham
SMARCC2
ENCSR000EDL
r=0.26

small heat map img

HeLa-S3
Farnham
SMARCC1
ENCSR000EDM
r=0.26

small heat map img

HeLa-S3
Farnham
NFYB
ENCSR000DNR
r=0.26

small heat map img

HeLa-S3
Farnham
CEBPB
ENCSR000EDA
r=0.25

small heat map img

HeLa-S3
Farnham
JUN
ENCSR000EDG
r=0.24

small heat map img

HeLa-S3
Farnham
SUPT20H
ENCSR000ECQ
r=0.24

small heat map img

HeLa-S3
Farnham
TCF7L2
ENCSR000EVF
r=0.22

small heat map img

HeLa-S3
Farnham
SMARCA4
ENCSR000EZC
r=0.18

small heat map img

HeLa-S3
Farnham
RAD21
ENCSR000EDE
r=0.17

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000DLO
r=0.17

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000DUB
r=0.17

small heat map img

HeLa-S3
Farnham
EP300
ENCSR000ECV
r=0.16

small heat map img

HeLa-S3
Farnham
ZNF274
ENCSR000EVG
r=0.15

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000AOA
r=0.13

small heat map img

HeLa-S3
Farnham
EZH2
ENCSR000ATC
r=0.10

small heat map img

HeLa-S3
Farnham
REST
ENCSR000BMN
r=0.06

small heat map img

HeLa-S3
Farnham
ZZZ3
ENCSR000DNT
r=0.04

small heat map img

HeLa-S3
Farnham
BRF2
ENCSR000DNV
r=0.04

small heat map img

HeLa-S3
Farnham
GTF3C2
ENCSR000DNY
r=0.02

small heat map img

HeLa-S3
Farnham
POLR3A
ENCSR000DNU
r=0.00

small heat map img

HeLa-S3
Farnham
BDP1
ENCSR000DNX
r=-0.06

small heat map img

HeLa-S3
Farnham
BRF1
ENCSR000DNW
r=-0.10

small heat map img
2,115 peaks (download )

HepG2 - Farnham - ENCSR000EVS

HepG2
Farnham
NR2C2
ENCSR000EVS
r=1.00

small heat map img

HepG2
Farnham
ELF1
ENCSR000BMZ
r=0.56

small heat map img

HepG2
Farnham
MXI1
ENCSR000EDU
r=0.52

small heat map img

HepG2
Farnham
MAX
ENCSR000BTM
r=0.48

small heat map img

HepG2
Farnham
NR2F2
ENCSR000BVM
r=0.48

small heat map img

HepG2
Farnham
RCOR1
ENCSR000EDQ
r=0.47

small heat map img

HepG2
Farnham
MYC
ENCSR000DLR
r=0.46

small heat map img

HepG2
Farnham
MAX
ENCSR000EDS
r=0.46

small heat map img

HepG2
Farnham
HNF4A
ENCSR000EEU
r=0.45

small heat map img

HepG2
Farnham
EP300
ENCSR000EDV
r=0.44

small heat map img

HepG2
Farnham
CREB1
ENCSR000BVL
r=0.43

small heat map img

HepG2
Farnham
ZEB1
ENCSR000BVN
r=0.43

small heat map img

HepG2
Farnham
HSF1
ENCSR000EET
r=0.41

small heat map img

HepG2
Farnham
SREBF1
ENCSR000EEO
r=0.41

small heat map img

HepG2
Farnham
YY1
ENCSR000BNT
r=0.40

small heat map img

HepG2
Farnham
GABPA
ENCSR000BJK
r=0.40

small heat map img

HepG2
Farnham
ARID3A
ENCSR000EDP
r=0.39

small heat map img

HepG2
Farnham
BRCA1
ENCSR000EDY
r=0.39

small heat map img

HepG2
Farnham
POLR2A
ENCSR000EEP
r=0.39

small heat map img

HepG2
Farnham
TAF1
ENCSR000BJN
r=0.38

small heat map img

HepG2
Farnham
FOSL2
ENCSR000BHP
r=0.38

small heat map img

HepG2
Farnham
MAFF
ENCSR000EEC
r=0.37

small heat map img

HepG2
Farnham
TBP
ENCSR000EEL
r=0.37

small heat map img

HepG2
Farnham
ESRRA
ENCSR000EEW
r=0.36

small heat map img

HepG2
Farnham
HNF4G
ENCSR000BNJ
r=0.36

small heat map img

HepG2
Farnham
MAFK
ENCSR000EDZ
r=0.36

small heat map img

HepG2
Farnham
POLR2A
ENCSR000DLQ
r=0.36

small heat map img

HepG2
Farnham
BHLHE40
ENCSR000EDT
r=0.36

small heat map img

HepG2
Farnham
SP1
ENCSR000BJX
r=0.36

small heat map img

HepG2
Farnham
SIN3A
ENCSR000BGL
r=0.35

small heat map img

HepG2
Farnham
MYBL2
ENCSR000BRO
r=0.35

small heat map img

HepG2
Farnham
POLR2A
ENCSR000BJM
r=0.35

small heat map img

HepG2
Farnham
HDAC2
ENCSR000BMC
r=0.34

small heat map img

HepG2
Farnham
NFIC
ENCSR000BQX
r=0.34

small heat map img

HepG2
Farnham
MAFK
ENCSR000EEB
r=0.34

small heat map img

HepG2
Farnham
RFX5
ENCSR000EEA
r=0.34

small heat map img

HepG2
Farnham
CEBPB
ENCSR000EEX
r=0.34

small heat map img

HepG2
Farnham
NR3C1
ENCSR000EEV
r=0.33

small heat map img

HepG2
Farnham
JUND
ENCSR000BGK
r=0.33

small heat map img

HepG2
Farnham
TCF12
ENCSR000BJG
r=0.33

small heat map img

HepG2
Farnham
POLR2A
ENCSR000EEM
r=0.33

small heat map img

HepG2
Farnham
SRF
ENCSR000BLV
r=0.30

small heat map img

HepG2
Farnham
JUND
ENCSR000EEI
r=0.29

small heat map img

HepG2
Farnham
POLR2A
ENCSR000EZQ
r=0.28

small heat map img

HepG2
Farnham
CEBPD
ENCSR000BQJ
r=0.27

small heat map img

HepG2
Farnham
EP300
ENCSR000BLW
r=0.26

small heat map img

HepG2
Farnham
SMC3
ENCSR000EDW
r=0.25

small heat map img

HepG2
Farnham
HNF4A
ENCSR000BLF
r=0.25

small heat map img

HepG2
Farnham
TEAD4
ENCSR000BRP
r=0.25

small heat map img

HepG2
Farnham
MBD4
ENCSR000BQW
r=0.24

small heat map img

HepG2
Farnham
RAD21
ENCSR000EEG
r=0.24

small heat map img

HepG2
Farnham
CEBPB
ENCSR000EEE
r=0.24

small heat map img

HepG2
Farnham
SREBF1
ENCSR000EZP
r=0.23

small heat map img

HepG2
Farnham
USF2
ENCSR000EEF
r=0.23

small heat map img

HepG2
Farnham
SREBF2
ENCSR000EZO
r=0.21

small heat map img

HepG2
Farnham
RXRA
ENCSR000BHU
r=0.20

small heat map img

HepG2
Farnham
REST
ENCSR000BJL
r=0.20

small heat map img

HepG2
Farnham
RAD21
ENCSR000BLS
r=0.20

small heat map img

HepG2
Farnham
NRF1
ENCSR000EEH
r=0.20

small heat map img

HepG2
Farnham
IRF3
ENCSR000EEJ
r=0.19

small heat map img

HepG2
Farnham
REST
ENCSR000BOT
r=0.19

small heat map img

HepG2
Farnham
ATF3
ENCSR000BKE
r=0.18

small heat map img

HepG2
Farnham
ZBTB7A
ENCSR000BQA
r=0.18

small heat map img

HepG2
Farnham
USF1
ENCSR000BGM
r=0.18

small heat map img

HepG2
Farnham
JUN
ENCSR000EEK
r=0.18

small heat map img

HepG2
Farnham
ZBTB33
ENCSR000BHR
r=0.18

small heat map img

HepG2
Farnham
ZBTB33
ENCSR000BNA
r=0.18

small heat map img

HepG2
Farnham
CTCF
ENCSR000BIE
r=0.17

small heat map img

HepG2
Farnham
FOXA1
ENCSR000BMO
r=0.17

small heat map img

HepG2
Farnham
SP2
ENCSR000BOU
r=0.17

small heat map img

HepG2
Farnham
FOXA1
ENCSR000BLE
r=0.16

small heat map img

HepG2
Farnham
CTCF
ENCSR000DLS
r=0.16

small heat map img

HepG2
Farnham
BHLHE40
ENCSR000BID
r=0.15

small heat map img

HepG2
Farnham
CTCF
ENCSR000DUG
r=0.15

small heat map img

HepG2
Farnham
CTCF
ENCSR000AMA
r=0.14

small heat map img

HepG2
Farnham
CEBPB
ENCSR000BQI
r=0.10

small heat map img

HepG2
Farnham
EZH2
ENCSR000ARI
r=0.09

small heat map img

HepG2
Farnham
FOXA2
ENCSR000BNI
r=0.05

small heat map img

HepG2
Farnham
TCF7L2
ENCSR000EVQ
r=0.02

small heat map img

HepG2
Farnham
ZNF274
ENCSR000EVR
r=-0.06

small heat map img
2,953 peaks (download )

K562 - Farnham - ENCSR000EWH

K562
Farnham
NR2C2
ENCSR000EWH
r=1.00

small heat map img

K562
Farnham
HCFC1
ENCSR000EFN
r=0.62

small heat map img

K562
Farnham
JUN
ENCSR000EGH
r=0.59

small heat map img

K562
Farnham
IRF1
ENCSR000EGT
r=0.58

small heat map img

K562
Farnham
JUND
ENCSR000EGN
r=0.58

small heat map img

K562
Farnham
SRF
ENCSR000BLK
r=0.58

small heat map img

K562
Farnham
IRF1
ENCSR000EGL
r=0.57

small heat map img

K562
Farnham
RCOR1
ENCSR000EGG
r=0.57

small heat map img

K562
Farnham
IRF1
ENCSR000EGK
r=0.57

small heat map img

K562
Farnham
JUN
ENCSR000EFS
r=0.56

small heat map img

K562
Farnham
TBL1XR1
ENCSR000EGB
r=0.56

small heat map img

K562
Farnham
MYC
ENCSR000EZV
r=0.56

small heat map img

K562
Farnham
EP300
ENCSR000EGE
r=0.56

small heat map img

K562
Farnham
STAT1
ENCSR000EHJ
r=0.56

small heat map img

K562
Farnham
STAT2
ENCSR000FAT
r=0.55

small heat map img

K562
Farnham
MYC
ENCSR000EGS
r=0.55

small heat map img

K562
Farnham
MYC
ENCSR000FAZ
r=0.55

small heat map img

K562
Farnham
MYC
ENCSR000FAG
r=0.55

small heat map img

K562
Farnham
TBL1XR1
ENCSR000EGA
r=0.55

small heat map img

K562
Farnham
MAX
ENCSR000EFV
r=0.54

small heat map img

K562
Farnham
MYC
ENCSR000EZU
r=0.54

small heat map img

K562
Farnham
ATF1
ENCSR000DNZ
r=0.54

small heat map img

K562
Farnham
ELK1
ENCSR000EFU
r=0.53

small heat map img

K562
Farnham
JUN
ENCSR000FAH
r=0.53

small heat map img

K562
Farnham
ZMIZ1
ENCSR000EFQ
r=0.53

small heat map img

K562
Farnham
E2F4
ENCSR000EWL
r=0.53

small heat map img

K562
Farnham
GABPA
ENCSR000BLO
r=0.52

small heat map img

K562
Farnham
STAT1
ENCSR000EHK
r=0.52

small heat map img

K562
Farnham
CUX1
ENCSR000EFO
r=0.52

small heat map img

K562
Farnham
MYC
ENCSR000EGJ
r=0.51

small heat map img

K562
Farnham
ELF1
ENCSR000BMD
r=0.51

small heat map img

K562
Farnham
MYC
ENCSR000DLZ
r=0.51

small heat map img

K562
Farnham
STAT1
ENCSR000FAU
r=0.50

small heat map img

K562
Farnham
MXI1
ENCSR000EGZ
r=0.49

small heat map img

K562
Farnham
CREB1
ENCSR000BSO
r=0.49

small heat map img

K562
Farnham
STAT1
ENCSR000FAV
r=0.48

small heat map img

K562
Farnham
YY1
ENCSR000BKU
r=0.48

small heat map img

K562
Farnham
POLR2A
ENCSR000EHP
r=0.47

small heat map img

K562
Farnham
MAX
ENCSR000FAE
r=0.46

small heat map img

K562
Farnham
POLR2A
ENCSR000FAW
r=0.46

small heat map img

K562
Farnham
POLR2A
ENCSR000FAY
r=0.46

small heat map img

K562
Farnham
POLR2A
ENCSR000FAJ
r=0.46

small heat map img

K562
Farnham
STAT2
ENCSR000FBC
r=0.46

small heat map img

K562
Farnham
HMGN3
ENCSR000DOB
r=0.45

small heat map img

K562
Farnham
POLR2A
ENCSR000FAX
r=0.45

small heat map img

K562
Farnham
MAFK
ENCSR000EGX
r=0.45

small heat map img

K562
Farnham
RCOR1
ENCSR000EGC
r=0.45

small heat map img

K562
Farnham
MAX
ENCSR000BLP
r=0.45

small heat map img

K562
Farnham
GTF2B
ENCSR000DOE
r=0.45

small heat map img

K562
Farnham
BHLHE40
ENCSR000EGV
r=0.45

small heat map img

K562
Farnham
GATA1
ENCSR000EFT
r=0.45

small heat map img

K562
Farnham
ARID3A
ENCSR000EFY
r=0.45

small heat map img

K562
Farnham
CBX3
ENCSR000BRT
r=0.44

small heat map img

K562
Farnham
ETS1
ENCSR000BKQ
r=0.44

small heat map img

K562
Farnham
TRIM28
ENCSR000BRW
r=0.44

small heat map img

K562
Farnham
SETDB1
ENCSR000EWI
r=0.43

small heat map img

K562
Farnham
CCNT2
ENCSR000DOA
r=0.43

small heat map img

K562
Farnham
JUN
ENCSR000EZX
r=0.42

small heat map img

K562
Farnham
SETDB1
ENCSR000AUT
r=0.42

small heat map img

K562
Farnham
POLR2A
ENCSR000BMR
r=0.42

small heat map img

K562
Farnham
NR2F2
ENCSR000BRS
r=0.42

small heat map img

K562
Farnham
POLR2A
ENCSR000DLY
r=0.42

small heat map img

K562
Farnham
KDM5B
ENCSR000AQA
r=0.42

small heat map img

K562
Farnham
RBBP5
ENCSR000AQI
r=0.41

small heat map img

K562
Farnham
JUN
ENCSR000EZT
r=0.41

small heat map img

K562
Farnham
TAF1
ENCSR000BKS
r=0.41

small heat map img

K562
Farnham
E2F6
ENCSR000EWJ
r=0.40

small heat map img

K562
Farnham
SMC3
ENCSR000EGW
r=0.39

small heat map img

K562
Farnham
YY1
ENCSR000EWF
r=0.39

small heat map img

K562
Farnham
STAT5A
ENCSR000BRR
r=0.38

small heat map img

K562
Farnham
IRF1
ENCSR000EGU
r=0.37

small heat map img

K562
Farnham
TBP
ENCSR000EHA
r=0.37

small heat map img

K562
Farnham
CEBPD
ENCSR000BVY
r=0.37

small heat map img

K562
Farnham
ZNF143
ENCSR000EGP
r=0.36

small heat map img

K562
Farnham
TAL1
ENCSR000EHB
r=0.36

small heat map img

K562
Farnham
JUN
ENCSR000EZW
r=0.35

small heat map img

K562
Farnham
ZNF384
ENCSR000EFP
r=0.35

small heat map img

K562
Farnham
EP300
ENCSR000EGY
r=0.34

small heat map img

K562
Farnham
SIX5
ENCSR000BGX
r=0.34

small heat map img

K562
Farnham
KAT2B
ENCSR000ATZ
r=0.34

small heat map img

K562
Farnham
HDAC1
ENCSR000AQF
r=0.32

small heat map img

K562
Farnham
FOS
ENCSR000FAI
r=0.32

small heat map img

K562
Farnham
EGR1
ENCSR000BNE
r=0.32

small heat map img

K562
Farnham
CHD7
ENCSR000AVD
r=0.32

small heat map img

K562
Farnham
SAP30
ENCSR000AQJ
r=0.32

small heat map img

K562
Farnham
TEAD4
ENCSR000BRK
r=0.31

small heat map img

K562
Farnham
HDAC6
ENCSR000ATJ
r=0.31

small heat map img

K562
Farnham
CEBPB
ENCSR000BRQ
r=0.31

small heat map img

K562
Farnham
YY1
ENCSR000BMH
r=0.31

small heat map img

K562
Farnham
SIRT6
ENCSR000DOH
r=0.30

small heat map img

K562
Farnham
NRF1
ENCSR000EHH
r=0.30

small heat map img

K562
Farnham
PML
ENCSR000BQY
r=0.30

small heat map img

K562
Farnham
HDAC2
ENCSR000AQG
r=0.30

small heat map img

K562
Farnham
EP300
ENCSR000AQB
r=0.29

small heat map img

K562
Farnham
ATF3
ENCSR000DOG
r=0.29

small heat map img

K562
Farnham
NFYA
ENCSR000EGR
r=0.29

small heat map img

K562
Farnham
NFE2
ENCSR000FAF
r=0.29

small heat map img

K562
Farnham
PHF8
ENCSR000AQH
r=0.29

small heat map img

K562
Farnham
SIN3A
ENCSR000BLR
r=0.29

small heat map img

K562
Farnham
ATF3
ENCSR000BNU
r=0.28

small heat map img

K562
Farnham
BACH1
ENCSR000EGD
r=0.28

small heat map img

K562
Farnham
REST
ENCSR000BMW
r=0.28

small heat map img

K562
Farnham
WHSC1
ENCSR000AVE
r=0.28

small heat map img

K562
Farnham
CBX3
ENCSR000ATV
r=0.28

small heat map img

K562
Farnham
SP2
ENCSR000BNL
r=0.27

small heat map img

K562
Farnham
USF1
ENCSR000BKT
r=0.27

small heat map img

K562
Farnham
GATA1
ENCSR000EWM
r=0.27

small heat map img

K562
Farnham
MAFF
ENCSR000EGI
r=0.27

small heat map img

K562
Farnham
CTCF
ENCSR000EGM
r=0.26

small heat map img

K562
Farnham
ZNF263
ENCSR000EWN
r=0.26

small heat map img

K562
Farnham
CEBPB
ENCSR000EHE
r=0.26

small heat map img

K562
Farnham
GATA2
ENCSR000EWG
r=0.26

small heat map img

K562
Farnham
SETDB1
ENCSR000EWD
r=0.26

small heat map img

K562
Farnham
HDAC2
ENCSR000BMG
r=0.25

small heat map img

K562
Farnham
POLR2A
ENCSR000EHL
r=0.25

small heat map img

K562
Farnham
SPI1
ENCSR000BGW
r=0.25

small heat map img

K562
Farnham
RFX5
ENCSR000EGO
r=0.25

small heat map img

K562
Farnham
THAP1
ENCSR000BNN
r=0.25

small heat map img

K562
Farnham
NCOR1
ENCSR000ATY
r=0.24

small heat map img

K562
Farnham
KDM1A
ENCSR000ATX
r=0.24

small heat map img

K562
Farnham
TRIM28
ENCSR000EVY
r=0.23

small heat map img

K562
Farnham
GTF3C2
ENCSR000DOD
r=0.23

small heat map img

K562
Farnham
RAD21
ENCSR000FAD
r=0.23

small heat map img

K562
Farnham
SIX5
ENCSR000BNW
r=0.22

small heat map img

K562
Farnham
CTCFL
ENCSR000BNK
r=0.22

small heat map img

K562
Farnham
SIRT6
ENCSR000AUB
r=0.22

small heat map img

K562
Farnham
E2F6
ENCSR000BLI
r=0.22

small heat map img

K562
Farnham
CTCF
ENCSR000DWE
r=0.22

small heat map img

K562
Farnham
NFYB
ENCSR000EGQ
r=0.22

small heat map img

K562
Farnham
TAF7
ENCSR000BNM
r=0.22

small heat map img

K562
Farnham
BRF2
ENCSR000DOC
r=0.21

small heat map img

K562
Farnham
SP1
ENCSR000BKO
r=0.21

small heat map img

K562
Farnham
EZH2
ENCSR000AQE
r=0.21

small heat map img

K562
Farnham
ZBTB7A
ENCSR000BME
r=0.21

small heat map img

K562
Farnham
CREBBP
ENCSR000ATT
r=0.21

small heat map img

K562
Farnham
XRCC4
ENCSR000FAC
r=0.21

small heat map img

K562
Farnham
RNF2
ENCSR000AUA
r=0.21

small heat map img

K562
Farnham
CTCF
ENCSR000AKO
r=0.21

small heat map img

K562
Farnham
REST
ENCSR000ATM
r=0.20

small heat map img

K562
Farnham
SUZ12
ENCSR000AUC
r=0.20

small heat map img

K562
Farnham
USF2
ENCSR000EHG
r=0.20

small heat map img

K562
Farnham
MEF2A
ENCSR000BNV
r=0.19

small heat map img

K562
Farnham
FOSL1
ENCSR000BMV
r=0.18

small heat map img

K562
Farnham
CTCF
ENCSR000BPJ
r=0.18

small heat map img

K562
Farnham
ZNF274
ENCSR000EVX
r=0.18

small heat map img

K562
Farnham
CTCF
ENCSR000DMA
r=0.17

small heat map img

K562
Farnham
SMARCB1
ENCSR000EHN
r=0.17

small heat map img

K562
Farnham
GATA2
ENCSR000BKM
r=0.16

small heat map img

K562
Farnham
SMARCA4
ENCSR000EHO
r=0.16

small heat map img

K562
Farnham
CHD4
ENCSR000ATL
r=0.15

small heat map img

K562
Farnham
ZBTB33
ENCSR000BKF
r=0.15

small heat map img

K562
Farnham
UBTF
ENCSR000EFZ
r=0.14

small heat map img

K562
Farnham
UBTF
ENCSR000EFW
r=0.14

small heat map img

K562
Farnham
CHD1
ENCSR000AQD
r=0.13

small heat map img

K562
Farnham
RAD21
ENCSR000BKV
r=0.12

small heat map img

K562
Farnham
POLR3G
ENCSR000EHQ
r=0.12

small heat map img

K562
Farnham
CBX2
ENCSR000ATU
r=0.12

small heat map img

K562
Farnham
BDP1
ENCSR000DOK
r=0.11

small heat map img

K562
Farnham
CBX8
ENCSR000ATW
r=0.11

small heat map img

K562
Farnham
POLR3A
ENCSR000DOI
r=0.10

small heat map img

K562
Farnham
BRF1
ENCSR000DOJ
r=0.09

small heat map img

K562
Farnham
ZNF274
ENCSR000EWE
r=0.03

small heat map img
587 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Farnham - ENCSR000EUL

loading

K562 - Farnham - ENCSR000EWH

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help