NANOG

The protein encoded by this gene is a DNA binding homeobox transcription factor involved in embryonic stem (ES) cell proliferation, renewal, and pluripotency. The encoded protein can block ES cell differentiation and can also autorepress its own expression in differentiating cells. Two transcript variants encoding different isoforms have been found for this gene. RefSeq, Sep 2015
NANOG (pron. nanOg) is a transcription factor critically involved with self-renewal of undifferentiated embryonic stem cells.wikipedia

NANOG

PDB image
PDB 2KT0

PDB 2KT0
ENCODE experiments
Ensemble search
Entrez 79923
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia Homeobox_protein_NANOG

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

H1-hESC - Myers - ENCSR000BMT

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

H1-hESC - Myers - ENCSR000BMT

1.
272 / 500
2.2e-152
CACAGCAGGGG
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 1.24
2.
300 / 500
6.1e-109
AAAACAAAGGC
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 1.26
3.
135 / 500
9.0e-91
CTTTGAAATGCAAAT
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 1.52
4.
8 / 500
9.7e-34
TTGAGTCAACACCACTAGAGGGTAATTAAC
small heat map img p-value: 0.00
pct_center: 0.05
pct_ratio: 0.54
5.
11 / 500
0.0012
GATCTTTCATGGGCAGGATGG
small heat map img p-value: 0.02
pct_center: 0.09
pct_ratio: 0.73
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at NANOG peaks

H1-hESC - Myers - ENCSR000BMT

H1-hESC
Myers
NANOG
ENCSR000BMT
r=1.00

small heat map img

H1-hESC
Myers
H3K4me2
ENCSR000ANC
r=0.22

small heat map img

H1-hESC
Myers
H3K4me1
ENCSR000ANA
r=0.16

small heat map img

H1-hESC
Myers
H3K27ac
ENCSR000ANP
r=0.16

small heat map img

H1-hESC
Myers
H3K4me3
ENCSR000AMG
r=0.11

small heat map img

H1-hESC
Myers
H3K9ac
ENCSR000AND
r=0.09

small heat map img

H1-hESC
Myers
H4K20me1
ENCSR000AMH
r=0.06

small heat map img

H1-hESC
Myers
H2AFZ
ENCSR000APX
r=0.06

small heat map img

H1-hESC
Myers
H3K27me3
ENCSR000ALU
r=0.02

small heat map img

H1-hESC
Myers
H3K9me3
ENCSR000APZ
r=-0.01

small heat map img

H1-hESC
Myers
H3K79me2
ENCSR000APY
r=-0.03

small heat map img

H1-hESC
Myers
H3K36me3
ENCSR000ANB
r=-0.04

small heat map img
5,473 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at NANOG peaks

H1-hESC - Myers - ENCSR000BMT

H1-hESC
Myers
NANOG
ENCSR000BMT
r=1.00

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BIP
r=0.42

small heat map img

H1-hESC
Myers
CHD7
ENCSR000AVA
r=0.38

small heat map img

H1-hESC
Myers
TEAD4
ENCSR000BRY
r=0.37

small heat map img

H1-hESC
Myers
CEBPB
ENCSR000EBV
r=0.36

small heat map img

H1-hESC
Myers
JUND
ENCSR000EBZ
r=0.36

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BMJ
r=0.35

small heat map img

H1-hESC
Myers
JUN
ENCSR000ECA
r=0.35

small heat map img

H1-hESC
Myers
MAFK
ENCSR000EBS
r=0.34

small heat map img

H1-hESC
Myers
SP1
ENCSR000BIR
r=0.32

small heat map img

H1-hESC
Myers
TCF12
ENCSR000BIT
r=0.32

small heat map img

H1-hESC
Myers
MAX
ENCSR000EUP
r=0.30

small heat map img

H1-hESC
Myers
BRCA1
ENCSR000EBX
r=0.28

small heat map img

H1-hESC
Myers
EP300
ENCSR000BKK
r=0.27

small heat map img

H1-hESC
Myers
JUND
ENCSR000BKP
r=0.27

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000BNR
r=0.26

small heat map img

H1-hESC
Myers
EP300
ENCSR000AUQ
r=0.26

small heat map img

H1-hESC
Myers
ATF2
ENCSR000BQU
r=0.25

small heat map img

H1-hESC
Myers
MXI1
ENCSR000EBR
r=0.24

small heat map img

H1-hESC
Myers
MYC
ENCSR000EBY
r=0.24

small heat map img

H1-hESC
Myers
YY1
ENCSR000BKD
r=0.22

small heat map img

H1-hESC
Myers
CTBP2
ENCSR000EUO
r=0.22

small heat map img

H1-hESC
Myers
RFX5
ENCSR000ECF
r=0.22

small heat map img

H1-hESC
Myers
BACH1
ENCSR000EBQ
r=0.22

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000EBO
r=0.21

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000AVB
r=0.20

small heat map img

H1-hESC
Myers
ZNF143
ENCSR000EBW
r=0.19

small heat map img

H1-hESC
Myers
RAD21
ENCSR000ECE
r=0.18

small heat map img

H1-hESC
Myers
EGR1
ENCSR000BJA
r=0.17

small heat map img

H1-hESC
Myers
CREB1
ENCSR000BSN
r=0.14

small heat map img

H1-hESC
Myers
MAX
ENCSR000BSJ
r=0.14

small heat map img

H1-hESC
Myers
HDAC6
ENCSR000ATQ
r=0.14

small heat map img

H1-hESC
Myers
RXRA
ENCSR000BJW
r=0.14

small heat map img

H1-hESC
Myers
SIRT6
ENCSR000AUS
r=0.14

small heat map img

H1-hESC
Myers
NRF1
ENCSR000ECC
r=0.14

small heat map img

H1-hESC
Myers
USF2
ENCSR000ECD
r=0.13

small heat map img

H1-hESC
Myers
TBP
ENCSR000ECB
r=0.12

small heat map img

H1-hESC
Myers
ZNF274
ENCSR000EUN
r=0.11

small heat map img

H1-hESC
Myers
SAP30
ENCSR000ATR
r=0.11

small heat map img

H1-hESC
Myers
CHD1
ENCSR000EBU
r=0.10

small heat map img

H1-hESC
Myers
SP4
ENCSR000BQV
r=0.10

small heat map img

H1-hESC
Myers
RBBP5
ENCSR000AQC
r=0.10

small heat map img

H1-hESC
Myers
E2F6
ENCSR000BSI
r=0.10

small heat map img

H1-hESC
Myers
FOSL1
ENCSR000BNS
r=0.09

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000ATS
r=0.09

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000BIS
r=0.09

small heat map img

H1-hESC
Myers
RAD21
ENCSR000BLD
r=0.09

small heat map img

H1-hESC
Myers
SRF
ENCSR000BIV
r=0.09

small heat map img

H1-hESC
Myers
EZH2
ENCSR000ASY
r=0.09

small heat map img

H1-hESC
Myers
GABPA
ENCSR000BIW
r=0.08

small heat map img

H1-hESC
Myers
USF1
ENCSR000BIU
r=0.08

small heat map img

H1-hESC
Myers
KDM5A
ENCSR000AQL
r=0.07

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000DLJ
r=0.07

small heat map img

H1-hESC
Myers
KDM5B
ENCSR000AUR
r=0.07

small heat map img

H1-hESC
Myers
REST
ENCSR000BHM
r=0.05

small heat map img

H1-hESC
Myers
CTCF
ENCSR000AMF
r=0.05

small heat map img

H1-hESC
Myers
ATF3
ENCSR000BKC
r=0.05

small heat map img

H1-hESC
Myers
SIX5
ENCSR000BIQ
r=0.04

small heat map img

H1-hESC
Myers
SP2
ENCSR000BQG
r=0.04

small heat map img

H1-hESC
Myers
KDM4A
ENCSR000AVC
r=0.04

small heat map img

H1-hESC
Myers
TAF1
ENCSR000BHO
r=0.04

small heat map img

H1-hESC
Myers
CTCF
ENCSR000BNH
r=0.04

small heat map img

H1-hESC
Myers
TAF7
ENCSR000BLU
r=0.04

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000BHN
r=0.04

small heat map img

H1-hESC
Myers
CHD1
ENCSR000AQK
r=0.03

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000EUQ
r=0.03

small heat map img

H1-hESC
Myers
CTCF
ENCSR000DLK
r=0.02

small heat map img

H1-hESC
Myers
PHF8
ENCSR000ATK
r=0.01

small heat map img

H1-hESC
Myers
MYC
ENCSR000DLI
r=-0.00

small heat map img
5,473 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help