MYC

The protein encoded by this gene is a multifunctional, nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. It functions as a transcription factor that regulates transcription of specific target genes. Mutations, overexpression, rearrangement and translocation of this gene have been associated with a variety of hematopoietic tumors, leukemias and lymphomas, including Burkitt lymphoma. There is evidence to show that alternative translation initiations from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site result in the production of two isoforms with distinct N-termini. The synthesis of non-AUG initiated protein is suppressed in Burkitt's lymphomas, suggesting its importance in the normal function of this gene. RefSeq, Jul 2008
Myc (c-Myc) is a regulator gene that codes for a transcription factor. The protein encoded by this gene is a multifunctional, nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation.wikipedia

MYC

PDB image
PDB 1A93

PDB 1A93 1EE4 1MV0 1NKP 2A93 2OR9 4Y7R
ENCODE experiments
Ensemble search
Entrez 4609
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia MYC

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

A549 - Snyder - ENCSR000DYC

loading

endothelial cell of umbilical vein - Iyer - ENCSR000DLU

loading

GM12878 - Iyer - ENCSR000DKU

loading

H1-hESC - Iyer - ENCSR000DLI

loading

H1-hESC - Snyder - ENCSR000EBY

loading

HeLa-S3 - Iyer - ENCSR000DLN

loading

HeLa-S3 - Weissman - ENCSR000EZD

loading

HepG2 - Iyer - ENCSR000DLR

loading

K562 - Iyer - ENCSR000DLZ

loading

K562 - Snyder - ENCSR000EGJ

loading

K562 - Snyder - ENCSR000EGS

loading

K562 - Weissman - ENCSR000EZU

loading

K562 - Weissman - ENCSR000EZV

loading

K562 - Weissman - ENCSR000FAG

loading

K562 - Weissman - ENCSR000FAZ

loading

MCF-7 - Iyer - ENCSR000DMJ

loading

MCF-7 - Iyer - ENCSR000DMM

loading

MCF-7 - Iyer - ENCSR000DMP

loading

MCF-7 - Iyer - ENCSR000DMQ

loading

NB4 - Snyder - ENCSR000EHR

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

A549 - Snyder - ENCSR000DYC

1.
407 / 500
1.1e-231
GCACGTGGCCGCGG
small heat map img p-value: 0.00
pct_center: 0.52
pct_ratio: 1.78
2.
23 / 500
9.7e-18
AGCAAACAGACAGCTTTAAAGAAAAAAAA
small heat map img p-value: 0.00
pct_center: 0.09
pct_ratio: 0.32
3.
85 / 500
1.2e-11
TGGGGGAGGGG
small heat map img p-value: 0.97
pct_center: 0.51
pct_ratio: 0.52
4.
25 / 500
0.0000082
CAAGATGGCGGCAG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.60
5.
10 / 500
0.00064
TGTGTGTGTGTGTGTGCGTGT
small heat map img p-value: 0.34
pct_center: 0.09
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Iyer - ENCSR000DKU

1.
252 / 500
2.4e-110
GCGCACGTGGC
small heat map img p-value: 0.00
pct_center: 0.37
pct_ratio: 1.47
2.
23 / 500
3.0e-23
TGTGTGTGTGTGTGT
small heat map img p-value: 0.74
pct_center: 0.18
pct_ratio: 0.62
3.
23 / 500
0.000036
AAGATGGCGGCGGAT
small heat map img p-value: 0.05
pct_center: 0.16
pct_ratio: 0.54
4.
23 / 500
0.68
CTGAAAAAAAA
small heat map img p-value: 0.78
pct_center: 0.04
pct_ratio: 0.17
5.
47 / 500
2.6e+2
TGGGGGAGGGG
small heat map img p-value: 1.00
pct_center: 0.40
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Iyer - ENCSR000DLI

1.
61 / 500
3.3e-91
GTGTGTGTGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.68
2.
64 / 500
8.4e-47
TGTGTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.63
3.
153 / 500
1.9e-62
GGGTGGTGGGGGTGGTGTGTG
small heat map img p-value: 0.83
pct_center: 0.61
pct_ratio: 0.63
4.
20 / 500
3.6e-13
TGTGTGGTGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.65
5.
8 / 500
0.00013
GATGATGGTGGTGATGGTGGTGGTGAT
small heat map img p-value: 0.14
pct_center: 0.18
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Snyder - ENCSR000EBY

1.
405 / 500
2.2e-248
GAGCACGTGGC
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 2.47
2.
103 / 500
1.3e-101
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.46
pct_ratio: 0.99
3.
9 / 500
1.9e-31
CATTTGCATAATAAAAGATTAGGGTGG
small heat map img p-value: 0.00
pct_center: 0.03
pct_ratio: 0.38
4.
16 / 500
1.6e-25
TATCTGGAGGCTGCCATGTT
small heat map img p-value: 0.01
pct_center: 0.12
pct_ratio: 0.69
5.
82 / 500
1.2e-18
ACAAGGAAAGGAGGGTGGAAG
small heat map img p-value: 0.73
pct_center: 0.44
pct_ratio: 0.50
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Iyer - ENCSR000DLN

1.
370 / 500
3.5e-253
GAGCACGTGGC
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 2.42
2.
70 / 500
3.9e-26
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 2.15
3.
63 / 500
5.5e-9
AGGGGGAAGGG
small heat map img p-value: 1.00
pct_center: 0.41
pct_ratio: 0.48
4.
8 / 500
3.3e-8
CGCGCTGCATGCTGGGAGTTGTAGTTC
small heat map img p-value: 0.31
pct_center: 0.16
pct_ratio: 0.60
5.
38 / 500
0.00013
ACGGCGCCCTCTGGTGGCCGG
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 0.70
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Weissman - ENCSR000EZD

1.
438 / 500
1.0e-298
AGCACGTGGCC
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 1.89
2.
83 / 500
2.3e-62
CGGCCACCAGGGGGCGCTG
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 0.85
3.
13 / 500
1.5e-26
CGCGCGGCATTCTGGGAGTTGTAGTCC
small heat map img p-value: 0.05
pct_center: 0.13
pct_ratio: 0.69
4.
49 / 500
1.1e-8
GTGACTCA
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 2.41
5.
11 / 500
2.7e-10
TCTGTGTGTGTGTGTGTGCGTGTGTGCGTG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Iyer - ENCSR000DLR

1.
402 / 500
5.3e-294
CGAGCACGTGG
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 2.20
2.
16 / 500
8.9e-22
GCATTCTGGGAGTTGTAGT
small heat map img p-value: 0.55
pct_center: 0.15
pct_ratio: 0.66
3.
33 / 500
4.3e-16
AAAGATGGCGGCG
small heat map img p-value: 0.03
pct_center: 0.13
pct_ratio: 0.61
4.
55 / 500
1.5e-16
GTGGGGGAGGGGAAG
small heat map img p-value: 0.44
pct_center: 0.63
pct_ratio: 0.60
5.
90 / 500
1.7e-9
AACCGGAAGT
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.83
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Iyer - ENCSR000DLZ

1.
457 / 500
2.0e-280
GGCCACGTGG
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 1.52
2.
78 / 500
1.0e-37
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.50
pct_ratio: 0.78
3.
46 / 500
5.0e-24
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.55
4.
134 / 500
6.4e-14
CCGGAAGC
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.91
5.
57 / 500
6.6e-12
TGGGGGAGGGG
small heat map img p-value: 0.17
pct_center: 0.62
pct_ratio: 0.60
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Snyder - ENCSR000EGJ

1.
438 / 500
5.6e-248
GGCCACGTGGT
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 1.81
2.
70 / 500
1.4e-70
GGTTGCATCAG
small heat map img p-value: 0.00
pct_center: 0.09
pct_ratio: 0.78
3.
53 / 500
1.6e-29
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.63
4.
13 / 500
8.6e-12
GCATTCTGGGAGTTGTAGTCT
small heat map img p-value: 0.00
pct_center: 0.07
pct_ratio: 0.63
5.
27 / 500
3.1e-7
AGCAGGAAGAAGAGAAAAAG
small heat map img p-value: 0.76
pct_center: 0.25
pct_ratio: 0.43
MEME output

K562 - Snyder - ENCSR000EGS

1.
445 / 500
1.8e-287
GACCACGTGGC
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 1.62
2.
141 / 500
3.6e-33
CCGGAAGTGGC
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.86
3.
39 / 500
5.7e-25
TGGCCACCAGGGGGCGCTG
small heat map img p-value: 0.00
pct_center: 0.38
pct_ratio: 1.09
4.
12 / 500
1.9e-19
CGCGCGGCATTCTGGGAATTGTAGTTT
small heat map img p-value: 0.00
pct_center: 0.09
pct_ratio: 0.69
5.
38 / 500
1.5e-16
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.49
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Weissman - ENCSR000FAG

1.
418 / 500
2.8e-241
GGCCACGTGGT
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 2.63
2.
60 / 500
2.9e-52
GGTTGCATCAG
small heat map img p-value: 0.01
pct_center: 0.08
pct_ratio: 0.69
3.
39 / 500
1.4e-25
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.68
4.
11 / 500
1.3e-18
GCGCTGCACTCTGGGAAATGTAGTTC
small heat map img p-value: 0.65
pct_center: 0.16
pct_ratio: 0.54
5.
39 / 500
2.9e-16
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 0.93
MEME output

K562 - Weissman - ENCSR000FAZ

1.
352 / 500
1.8e-250
GAGCACGTGG
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 2.27
2.
13 / 500
4.6e-21
CGCGTGGCACTCTGGGAAATGTAGTTT
small heat map img p-value: 0.02
pct_center: 0.12
pct_ratio: 0.58
3.
44 / 500
9.4e-19
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.67
4.
32 / 500
1.6e-15
CGGCCACCAGGGGGCGCTGCGGGCCC
small heat map img p-value: 0.01
pct_center: 0.28
pct_ratio: 0.80
5.
65 / 500
1.2e-10
CCGGAAGT
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 1.08
MEME output

K562 - Weissman - ENCSR000EZV

1.
375 / 500
5.2e-265
GAGCACGTGG
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 2.11
2.
20 / 500
5.1e-30
GCATTCTGGGAAATGTAGTCT
small heat map img p-value: 0.22
pct_center: 0.13
pct_ratio: 0.55
3.
126 / 500
4.9e-17
CCGGAAGTGGC
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 0.84
4.
33 / 500
6.7e-17
TGGCCACCAGGGGGCGCTGC
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 0.87
5.
39 / 500
2.8e-16
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.64
MEME output

K562 - Weissman - ENCSR000EZU

1.
397 / 500
5.8e-302
GAGCACGTGGC
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 1.95
2.
49 / 500
5.1e-24
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.72
3.
13 / 500
1.2e-21
CCCGCGCGGCATTCTGGGAATTGTAGTTT
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.65
4.
39 / 500
1.3e-20
GCCACCAGGGGGCGCTG
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 0.84
5.
105 / 500
1.8e-19
CCGGAAGTGGC
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.89
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF 10A - Struhl - ENCSR000DOM

1.
461 / 500
2.3e-468
GAAAGCACATGGCA
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 1.60
2.
229 / 500
4.3e-104
ATGAGTCA
small heat map img p-value: 0.00
pct_center: 0.38
pct_ratio: 3.10
3.
6 / 500
7.1e-22
TGTAACCACGCCACGTGAGGCGCATTAGGT
small heat map img p-value: 0.02
pct_center: 0.05
pct_ratio: 0.65
4.
74 / 500
1.5e-11
ATTGTGCAAT
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 1.43
5.
19 / 500
0.89
TGTGTGTGTGTGTGT
small heat map img p-value: 0.89
pct_center: 0.15
pct_ratio: 0.50
MEME output

MCF 10A - Struhl - ENCSR000DOS

1.
500 / 500
8.6e-477
GAGCACGTGGC
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 1.87
2.
99 / 500
5.2e-55
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 3.25
3.
6 / 500
2.3e-27
TAATGCGCCTCACGTGGCGTGGTTACATAA
small heat map img p-value: 0.00
pct_center: 0.04
pct_ratio: 0.72
4.
54 / 500
0.000020
GGGGCGGGGCC
small heat map img p-value: 0.62
pct_center: 0.36
pct_ratio: 0.58
5.
90 / 500
0.0000020
ATTATGCAAT
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 1.22
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF-7 - Iyer - ENCSR000DMJ

1.
219 / 500
4.8e-105
CACGTGGT
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 1.80
2.
37 / 500
9.5e-39
TGTGTGTGTGTGCGTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.78
3.
13 / 500
1.0e-48
AGGCTGAGGTGGGAGGATCACTTGA
small heat map img p-value: 1.00
pct_center: 0.18
pct_ratio: 0.48
4.
10 / 500
1.5e-25
CCCGGGAGGTGGAGGCTGCAGTGAGCCGTG
small heat map img p-value: 1.00
pct_center: 0.37
pct_ratio: 0.67
5.
12 / 500
3.7e-9
CAAGTAGCTGGGATCACAGGCGTGCGCCAC
small heat map img p-value: 1.00
pct_center: 0.24
pct_ratio: 0.55
MEME output

MCF-7 - Iyer - ENCSR000DMQ

1.
377 / 500
8.6e-206
AGCACGTGGCC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 1.48
2.
18 / 500
6.5e-36
TGTGTGTGCGCGTGTGTGTGTGTGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.80
3.
47 / 500
2.4e-17
CAAGATGGCGG
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.61
4.
10 / 500
6.0e-15
CTGCATTCTGGGAATTGTAGT
small heat map img p-value: 0.89
pct_center: 0.16
pct_ratio: 0.55
5.
72 / 500
0.0000013
CGGAAGTGGCG
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.72
MEME output

MCF-7 - Iyer - ENCSR000DMP

1.
406 / 500
3.9e-223
AGCACGTGGCC
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 1.92
2.
17 / 500
2.5e-17
GTGTGTGTGTGCGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.80
3.
33 / 500
4.7e-8
AGGAAGAGAGGGTGGGAGGGAAGGAGGGAG
small heat map img p-value: 0.00
pct_center: 0.47
pct_ratio: 0.57
4.
20 / 500
0.00036
GGCGCACGCTGATGACGTCA
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.77
5.
27 / 500
0.0013
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.77
MEME output

MCF-7 - Iyer - ENCSR000DMM

1.
417 / 500
1.7e-192
GCCACGTG
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 1.57
2.
70 / 500
1.2e-26
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.73
3.
13 / 500
1.8e-21
GTGTGTGCGTGTGTGTGCGCGTGTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 0.79
4.
8 / 500
1.5e-9
CGCGGTGCATGCTGGGAATTGTAGTC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.67
5.
46 / 500
3.0e-7
TGGGGGAGGGG
small heat map img p-value: 0.95
pct_center: 0.61
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

NB4 - Snyder - ENCSR000EHR

1.
480 / 500
5.3e-346
GAGCACGTGG
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 1.72
2.
220 / 500
2.3e-46
CAGGAAGT
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 1.04
3.
16 / 500
3.5e-25
GGCACTCTGGGAATTGTAGTC
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.61
4.
65 / 500
6.0e-21
GCCACCAGGGGGCGC
small heat map img p-value: 0.01
pct_center: 0.36
pct_ratio: 0.81
5.
24 / 500
7.6e-7
AAGATGGCGGC
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.68
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

endothelial cell of umbilical vein - Iyer - ENCSR000DLU

1.
436 / 500
5.1e-311
GAGCACGTGG
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 2.17
2.
187 / 500
6.9e-52
GGCAGGAAGTG
small heat map img p-value: 0.00
pct_center: 0.48
pct_ratio: 0.85
3.
10 / 500
4.2e-35
GTGCGTGTGTGTGTGTGTGTGTGTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.75
4.
15 / 500
4.8e-28
CGCGGGGCATTCTGGGAATTGTAGTCC
small heat map img p-value: 0.34
pct_center: 0.19
pct_ratio: 0.63
5.
60 / 500
4.2e-19
TGGGGGAGGGG
small heat map img p-value: 0.78
pct_center: 0.55
pct_ratio: 0.57
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at MYC peaks

A549 - Snyder - ENCSR000DYC

A549
Snyder
MYC
ENCSR000DYC
r=1.00

small heat map img

A549
Snyder
H3K27ac
ENCSR000AVF
r=0.51

small heat map img

A549
Snyder
H3K4me3
ENCSR000ASH
r=0.51

small heat map img

A549
Snyder
H2AFZ
ENCSR000AUG
r=0.51

small heat map img

A549
Snyder
H3K9ac
ENCSR000ASV
r=0.50

small heat map img

A549
Snyder
H3K4me3
ENCSR000AST
r=0.50

small heat map img

A549
Snyder
H3K4me3
ENCSR000DPD
r=0.49

small heat map img

A549
Snyder
H2AFZ
ENCSR000AUH
r=0.48

small heat map img

A549
Snyder
H3K27ac
ENCSR000AUI
r=0.48

small heat map img

A549
Snyder
H3K4me2
ENCSR000AVI
r=0.42

small heat map img

A549
Snyder
H3K4me2
ENCSR000ATO
r=0.40

small heat map img

A549
Snyder
H3K79me2
ENCSR000ASU
r=0.18

small heat map img

A549
Snyder
H3K79me2
ENCSR000ATP
r=0.18

small heat map img

A549
Snyder
H3K4me1
ENCSR000AUM
r=0.12

small heat map img

A549
Snyder
H3K4me1
ENCSR000AVH
r=0.11

small heat map img

A549
Snyder
H3K36me3
ENCSR000AUL
r=0.03

small heat map img

A549
Snyder
H4K20me1
ENCSR000AUO
r=0.03

small heat map img

A549
Snyder
H3K36me3
ENCSR000AVG
r=0.02

small heat map img

A549
Snyder
H3K9me3
ENCSR000AUN
r=0.01

small heat map img

A549
Snyder
H3K27me3
ENCSR000AUK
r=-0.03

small heat map img

A549
Snyder
H3K27me3
ENCSR000AUJ
r=-0.08

small heat map img
5,780 peaks (download )

GM12878 - Iyer - ENCSR000DKU

GM12878
Iyer
MYC
ENCSR000DKU
r=1.00

small heat map img

GM12878
Iyer
H2AFZ
ENCSR000AOV
r=0.48

small heat map img

GM12878
Iyer
H3K9ac
ENCSR000AKH
r=0.48

small heat map img

GM12878
Iyer
H3K4me3
ENCSR000DRY
r=0.46

small heat map img

GM12878
Iyer
H3K4me3
ENCSR000AKA
r=0.43

small heat map img

GM12878
Iyer
H3K27ac
ENCSR000AKC
r=0.39

small heat map img

GM12878
Iyer
H3K4me2
ENCSR000AKG
r=0.35

small heat map img

GM12878
Iyer
H3K79me2
ENCSR000AOW
r=0.23

small heat map img

GM12878
Iyer
H3K4me1
ENCSR000AKF
r=0.04

small heat map img

GM12878
Iyer
H3K9me3
ENCSR000AOX
r=0.02

small heat map img

GM12878
Iyer
H4K20me1
ENCSR000AKI
r=-0.03

small heat map img

GM12878
Iyer
H3K27me3
ENCSR000DRX
r=-0.04

small heat map img

GM12878
Iyer
H3K27me3
ENCSR000AKD
r=-0.05

small heat map img

GM12878
Iyer
H3K36me3
ENCSR000DRW
r=-0.08

small heat map img

GM12878
Iyer
H3K36me3
ENCSR000AKE
r=-0.17

small heat map img
3,690 peaks (download )

H1-hESC - Iyer - ENCSR000DLI

H1-hESC
Iyer
MYC
ENCSR000DLI
r=1.00

small heat map img

H1-hESC
Iyer
H3K9ac
ENCSR000AND
r=0.14

small heat map img

H1-hESC
Iyer
MYC
ENCSR000EBY
r=0.14

small heat map img

H1-hESC
Iyer
H3K27ac
ENCSR000ANP
r=0.13

small heat map img

H1-hESC
Iyer
H3K4me3
ENCSR000AMG
r=0.12

small heat map img

H1-hESC
Iyer
H3K4me2
ENCSR000ANC
r=0.12

small heat map img

H1-hESC
Iyer
H2AFZ
ENCSR000APX
r=0.09

small heat map img

H1-hESC
Iyer
H3K4me1
ENCSR000ANA
r=0.08

small heat map img

H1-hESC
Iyer
H3K27me3
ENCSR000ALU
r=0.06

small heat map img

H1-hESC
Iyer
H4K20me1
ENCSR000AMH
r=0.05

small heat map img

H1-hESC
Iyer
H3K36me3
ENCSR000ANB
r=0.03

small heat map img

H1-hESC
Iyer
H3K9me3
ENCSR000APZ
r=0.02

small heat map img

H1-hESC
Iyer
H3K79me2
ENCSR000APY
r=0.00

small heat map img
1,217 peaks (download )

H1-hESC - Snyder - ENCSR000EBY

H1-hESC
Snyder
MYC
ENCSR000EBY
r=1.00

small heat map img

H1-hESC
Snyder
H3K9ac
ENCSR000AND
r=0.49

small heat map img

H1-hESC
Snyder
H3K4me3
ENCSR000AMG
r=0.47

small heat map img

H1-hESC
Snyder
H3K4me2
ENCSR000ANC
r=0.47

small heat map img

H1-hESC
Snyder
H3K27ac
ENCSR000ANP
r=0.47

small heat map img

H1-hESC
Snyder
H2AFZ
ENCSR000APX
r=0.40

small heat map img

H1-hESC
Snyder
MYC
ENCSR000DLI
r=0.26

small heat map img

H1-hESC
Snyder
H3K4me1
ENCSR000ANA
r=0.22

small heat map img

H1-hESC
Snyder
H3K79me2
ENCSR000APY
r=0.12

small heat map img

H1-hESC
Snyder
H4K20me1
ENCSR000AMH
r=0.04

small heat map img

H1-hESC
Snyder
H3K27me3
ENCSR000ALU
r=0.04

small heat map img

H1-hESC
Snyder
H3K9me3
ENCSR000APZ
r=0.00

small heat map img

H1-hESC
Snyder
H3K36me3
ENCSR000ANB
r=-0.05

small heat map img
4,551 peaks (download )

HeLa-S3 - Iyer - ENCSR000DLN

HeLa-S3
Iyer
MYC
ENCSR000DLN
r=1.00

small heat map img

HeLa-S3
Iyer
MYC
ENCSR000EZD
r=0.81

small heat map img

HeLa-S3
Iyer
H2AFZ
ENCSR000AQN
r=0.43

small heat map img

HeLa-S3
Iyer
H3K4me3
ENCSR000AOF
r=0.42

small heat map img

HeLa-S3
Iyer
H3K9ac
ENCSR000AOH
r=0.42

small heat map img

HeLa-S3
Iyer
H3K27ac
ENCSR000AOC
r=0.42

small heat map img

HeLa-S3
Iyer
H3K4me3
ENCSR000DUA
r=0.38

small heat map img

HeLa-S3
Iyer
H3K4me2
ENCSR000AOE
r=0.38

small heat map img

HeLa-S3
Iyer
H3K4me1
ENCSR000APW
r=0.19

small heat map img

HeLa-S3
Iyer
H3K79me2
ENCSR000AOG
r=0.08

small heat map img

HeLa-S3
Iyer
H3K27me3
ENCSR000DTY
r=0.04

small heat map img

HeLa-S3
Iyer
H4K20me1
ENCSR000AOI
r=-0.04

small heat map img

HeLa-S3
Iyer
H3K9me3
ENCSR000AQO
r=-0.05

small heat map img

HeLa-S3
Iyer
H3K36me3
ENCSR000DTZ
r=-0.06

small heat map img

HeLa-S3
Iyer
H3K27me3
ENCSR000APB
r=-0.07

small heat map img

HeLa-S3
Iyer
H3K36me3
ENCSR000AOD
r=-0.15

small heat map img
2,835 peaks (download )

HeLa-S3 - Weissman - ENCSR000EZD

HeLa-S3
Weissman
MYC
ENCSR000EZD
r=1.00

small heat map img

HeLa-S3
Weissman
MYC
ENCSR000DLN
r=0.77

small heat map img

HeLa-S3
Weissman
H3K4me3
ENCSR000AOF
r=0.46

small heat map img

HeLa-S3
Weissman
H3K9ac
ENCSR000AOH
r=0.45

small heat map img

HeLa-S3
Weissman
H2AFZ
ENCSR000AQN
r=0.44

small heat map img

HeLa-S3
Weissman
H3K27ac
ENCSR000AOC
r=0.44

small heat map img

HeLa-S3
Weissman
H3K4me2
ENCSR000AOE
r=0.41

small heat map img

HeLa-S3
Weissman
H3K4me3
ENCSR000DUA
r=0.41

small heat map img

HeLa-S3
Weissman
H3K4me1
ENCSR000APW
r=0.22

small heat map img

HeLa-S3
Weissman
H3K79me2
ENCSR000AOG
r=0.13

small heat map img

HeLa-S3
Weissman
H3K27me3
ENCSR000DTY
r=0.05

small heat map img

HeLa-S3
Weissman
H4K20me1
ENCSR000AOI
r=-0.00

small heat map img

HeLa-S3
Weissman
H3K36me3
ENCSR000DTZ
r=-0.01

small heat map img

HeLa-S3
Weissman
H3K9me3
ENCSR000AQO
r=-0.03

small heat map img

HeLa-S3
Weissman
H3K27me3
ENCSR000APB
r=-0.05

small heat map img

HeLa-S3
Weissman
H3K36me3
ENCSR000AOD
r=-0.10

small heat map img
10,000 randomly-selected peaks from a total of 10,226 (download )

HepG2 - Iyer - ENCSR000DLR

HepG2
Iyer
MYC
ENCSR000DLR
r=1.00

small heat map img

HepG2
Iyer
H3K4me3
ENCSR000AMP
r=0.47

small heat map img

HepG2
Iyer
H3K9ac
ENCSR000AMD
r=0.45

small heat map img

HepG2
Iyer
H3K4me3
ENCSR000DUF
r=0.43

small heat map img

HepG2
Iyer
H3K4me2
ENCSR000AMC
r=0.41

small heat map img

HepG2
Iyer
H3K27ac
ENCSR000AMO
r=0.40

small heat map img

HepG2
Iyer
H2AFZ
ENCSR000AOK
r=0.32

small heat map img

HepG2
Iyer
H3K27me3
ENCSR000AOL
r=0.28

small heat map img

HepG2
Iyer
H3K79me2
ENCSR000AOM
r=0.15

small heat map img

HepG2
Iyer
H3K4me1
ENCSR000APV
r=0.07

small heat map img

HepG2
Iyer
H3K27me3
ENCSR000DUE
r=0.03

small heat map img

HepG2
Iyer
H4K20me1
ENCSR000AMQ
r=0.02

small heat map img

HepG2
Iyer
H3K9me3
ENCSR000ATD
r=-0.06

small heat map img

HepG2
Iyer
H3K36me3
ENCSR000DUD
r=-0.06

small heat map img

HepG2
Iyer
H3K36me3
ENCSR000AMB
r=-0.11

small heat map img
4,413 peaks (download )

K562 - Iyer - ENCSR000DLZ

K562
Iyer
MYC
ENCSR000DLZ
r=1.00

small heat map img

K562
Iyer
MYC
ENCSR000EGJ
r=0.86

small heat map img

K562
Iyer
MYC
ENCSR000EGS
r=0.86

small heat map img

K562
Iyer
MYC
ENCSR000EZU
r=0.81

small heat map img

K562
Iyer
MYC
ENCSR000FAG
r=0.81

small heat map img

K562
Iyer
MYC
ENCSR000EZV
r=0.79

small heat map img

K562
Iyer
MYC
ENCSR000FAZ
r=0.78

small heat map img

K562
Iyer
H3K4me3
ENCSR000AKU
r=0.43

small heat map img

K562
Iyer
H3K9ac
ENCSR000AKV
r=0.43

small heat map img

K562
Iyer
H3K4me2
ENCSR000AKT
r=0.42

small heat map img

K562
Iyer
H3K9ac
ENCSR000EVZ
r=0.42

small heat map img

K562
Iyer
H3K4me3
ENCSR000DWD
r=0.42

small heat map img

K562
Iyer
H3K4me3
ENCSR000EWA
r=0.39

small heat map img

K562
Iyer
H3K27ac
ENCSR000AKP
r=0.39

small heat map img

K562
Iyer
H2AFZ
ENCSR000APC
r=0.37

small heat map img

K562
Iyer
H3K79me2
ENCSR000APD
r=0.22

small heat map img

K562
Iyer
H3K4me1
ENCSR000EWC
r=0.21

small heat map img

K562
Iyer
H3K4me1
ENCSR000AKS
r=0.08

small heat map img

K562
Iyer
H4K20me1
ENCSR000AKX
r=0.08

small heat map img

K562
Iyer
H3K9me1
ENCSR000AKW
r=0.02

small heat map img

K562
Iyer
H3K9me3
ENCSR000APE
r=0.01

small heat map img

K562
Iyer
H3K27me3
ENCSR000DWC
r=-0.01

small heat map img

K562
Iyer
H3K27me3
ENCSR000AKQ
r=-0.01

small heat map img

K562
Iyer
H3K36me3
ENCSR000AKR
r=-0.03

small heat map img

K562
Iyer
H3K36me3
ENCSR000DWB
r=-0.05

small heat map img

K562
Iyer
H3K27me3
ENCSR000EWB
r=-0.08

small heat map img
10,000 randomly-selected peaks from a total of 11,738 (download )

K562 - Snyder - ENCSR000EGJ

K562
Snyder
MYC
ENCSR000EGJ
r=1.00

small heat map img

K562
Snyder
MYC
ENCSR000EGS
r=0.93

small heat map img

K562
Snyder
MYC
ENCSR000EZU
r=0.87

small heat map img

K562
Snyder
MYC
ENCSR000FAG
r=0.87

small heat map img

K562
Snyder
MYC
ENCSR000DLZ
r=0.85

small heat map img

K562
Snyder
MYC
ENCSR000EZV
r=0.85

small heat map img

K562
Snyder
MYC
ENCSR000FAZ
r=0.83

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.50

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.49

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.49

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.45

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.45

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.45

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.42

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.42

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.29

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.23

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.18

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.13

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.10

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.09

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=0.06

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=0.01

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=-0.00

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=-0.00

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.09

small heat map img
10,000 randomly-selected peaks from a total of 24,153 (download )

K562 - Snyder - ENCSR000EGS

K562
Snyder
MYC
ENCSR000EGS
r=1.00

small heat map img

K562
Snyder
MYC
ENCSR000EGJ
r=0.94

small heat map img

K562
Snyder
MYC
ENCSR000EZU
r=0.91

small heat map img

K562
Snyder
MYC
ENCSR000EZV
r=0.89

small heat map img

K562
Snyder
MYC
ENCSR000FAZ
r=0.87

small heat map img

K562
Snyder
MYC
ENCSR000FAG
r=0.86

small heat map img

K562
Snyder
MYC
ENCSR000DLZ
r=0.85

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.47

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.46

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.46

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.43

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.42

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.42

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.39

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.39

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.28

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.23

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.20

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.13

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.11

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.09

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=0.08

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=0.01

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=0.00

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=-0.01

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.09

small heat map img
10,000 randomly-selected peaks from a total of 31,092 (download )

K562 - Weissman - ENCSR000EZU

K562
Weissman
MYC
ENCSR000EZU
r=1.00

small heat map img

K562
Weissman
MYC
ENCSR000EZV
r=0.91

small heat map img

K562
Weissman
MYC
ENCSR000EGS
r=0.91

small heat map img

K562
Weissman
MYC
ENCSR000FAZ
r=0.89

small heat map img

K562
Weissman
MYC
ENCSR000EGJ
r=0.87

small heat map img

K562
Weissman
MYC
ENCSR000FAG
r=0.86

small heat map img

K562
Weissman
MYC
ENCSR000DLZ
r=0.80

small heat map img

K562
Weissman
H3K4me3
ENCSR000AKU
r=0.45

small heat map img

K562
Weissman
H3K4me2
ENCSR000AKT
r=0.45

small heat map img

K562
Weissman
H3K9ac
ENCSR000AKV
r=0.45

small heat map img

K562
Weissman
H3K27ac
ENCSR000AKP
r=0.43

small heat map img

K562
Weissman
H2AFZ
ENCSR000APC
r=0.39

small heat map img

K562
Weissman
H3K9ac
ENCSR000EVZ
r=0.39

small heat map img

K562
Weissman
H3K4me3
ENCSR000DWD
r=0.39

small heat map img

K562
Weissman
H3K4me3
ENCSR000EWA
r=0.36

small heat map img

K562
Weissman
H3K79me2
ENCSR000APD
r=0.24

small heat map img

K562
Weissman
H3K4me1
ENCSR000EWC
r=0.20

small heat map img

K562
Weissman
H3K4me1
ENCSR000AKS
r=0.19

small heat map img

K562
Weissman
H4K20me1
ENCSR000AKX
r=0.14

small heat map img

K562
Weissman
H3K9me1
ENCSR000AKW
r=0.10

small heat map img

K562
Weissman
H3K9me3
ENCSR000APE
r=0.09

small heat map img

K562
Weissman
H3K36me3
ENCSR000AKR
r=0.06

small heat map img

K562
Weissman
H3K27me3
ENCSR000AKQ
r=0.03

small heat map img

K562
Weissman
H3K27me3
ENCSR000DWC
r=0.01

small heat map img

K562
Weissman
H3K36me3
ENCSR000DWB
r=-0.01

small heat map img

K562
Weissman
H3K27me3
ENCSR000EWB
r=-0.06

small heat map img
10,000 randomly-selected peaks from a total of 19,290 (download )

K562 - Weissman - ENCSR000EZV

K562
Weissman
MYC
ENCSR000EZV
r=1.00

small heat map img

K562
Weissman
MYC
ENCSR000EZU
r=0.93

small heat map img

K562
Weissman
MYC
ENCSR000FAZ
r=0.91

small heat map img

K562
Weissman
MYC
ENCSR000EGS
r=0.91

small heat map img

K562
Weissman
MYC
ENCSR000FAG
r=0.88

small heat map img

K562
Weissman
MYC
ENCSR000EGJ
r=0.87

small heat map img

K562
Weissman
MYC
ENCSR000DLZ
r=0.80

small heat map img

K562
Weissman
H3K4me2
ENCSR000AKT
r=0.46

small heat map img

K562
Weissman
H3K4me3
ENCSR000AKU
r=0.46

small heat map img

K562
Weissman
H3K9ac
ENCSR000AKV
r=0.46

small heat map img

K562
Weissman
H3K27ac
ENCSR000AKP
r=0.45

small heat map img

K562
Weissman
H2AFZ
ENCSR000APC
r=0.43

small heat map img

K562
Weissman
H3K9ac
ENCSR000EVZ
r=0.41

small heat map img

K562
Weissman
H3K4me3
ENCSR000DWD
r=0.40

small heat map img

K562
Weissman
H3K4me3
ENCSR000EWA
r=0.38

small heat map img

K562
Weissman
H3K79me2
ENCSR000APD
r=0.22

small heat map img

K562
Weissman
H3K4me1
ENCSR000EWC
r=0.20

small heat map img

K562
Weissman
H3K4me1
ENCSR000AKS
r=0.18

small heat map img

K562
Weissman
H4K20me1
ENCSR000AKX
r=0.13

small heat map img

K562
Weissman
H3K9me1
ENCSR000AKW
r=0.10

small heat map img

K562
Weissman
H3K9me3
ENCSR000APE
r=0.09

small heat map img

K562
Weissman
H3K27me3
ENCSR000AKQ
r=0.05

small heat map img

K562
Weissman
H3K36me3
ENCSR000AKR
r=0.02

small heat map img

K562
Weissman
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Weissman
H3K36me3
ENCSR000DWB
r=-0.03

small heat map img

K562
Weissman
H3K27me3
ENCSR000EWB
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 10,583 (download )

K562 - Weissman - ENCSR000FAG

K562
Weissman
MYC
ENCSR000FAG
r=1.00

small heat map img

K562
Weissman
MYC
ENCSR000EGJ
r=0.90

small heat map img

K562
Weissman
MYC
ENCSR000EZU
r=0.90

small heat map img

K562
Weissman
MYC
ENCSR000EZV
r=0.90

small heat map img

K562
Weissman
MYC
ENCSR000EGS
r=0.90

small heat map img

K562
Weissman
MYC
ENCSR000FAZ
r=0.89

small heat map img

K562
Weissman
MYC
ENCSR000DLZ
r=0.83

small heat map img

K562
Weissman
H3K9ac
ENCSR000AKV
r=0.50

small heat map img

K562
Weissman
H3K27ac
ENCSR000AKP
r=0.50

small heat map img

K562
Weissman
H3K4me2
ENCSR000AKT
r=0.50

small heat map img

K562
Weissman
H3K4me3
ENCSR000AKU
r=0.49

small heat map img

K562
Weissman
H2AFZ
ENCSR000APC
r=0.48

small heat map img

K562
Weissman
H3K9ac
ENCSR000EVZ
r=0.47

small heat map img

K562
Weissman
H3K4me3
ENCSR000DWD
r=0.45

small heat map img

K562
Weissman
H3K4me3
ENCSR000EWA
r=0.44

small heat map img

K562
Weissman
H3K79me2
ENCSR000APD
r=0.21

small heat map img

K562
Weissman
H3K4me1
ENCSR000EWC
r=0.21

small heat map img

K562
Weissman
H3K4me1
ENCSR000AKS
r=0.13

small heat map img

K562
Weissman
H4K20me1
ENCSR000AKX
r=0.11

small heat map img

K562
Weissman
H3K9me3
ENCSR000APE
r=0.07

small heat map img

K562
Weissman
H3K9me1
ENCSR000AKW
r=0.06

small heat map img

K562
Weissman
H3K27me3
ENCSR000AKQ
r=0.05

small heat map img

K562
Weissman
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Weissman
H3K27me3
ENCSR000EWB
r=-0.03

small heat map img

K562
Weissman
H3K36me3
ENCSR000AKR
r=-0.03

small heat map img

K562
Weissman
H3K36me3
ENCSR000DWB
r=-0.08

small heat map img
5,023 peaks (download )

K562 - Weissman - ENCSR000FAZ

K562
Weissman
MYC
ENCSR000FAZ
r=1.00

small heat map img

K562
Weissman
MYC
ENCSR000EZU
r=0.93

small heat map img

K562
Weissman
MYC
ENCSR000EZV
r=0.92

small heat map img

K562
Weissman
MYC
ENCSR000EGS
r=0.91

small heat map img

K562
Weissman
MYC
ENCSR000FAG
r=0.88

small heat map img

K562
Weissman
MYC
ENCSR000EGJ
r=0.87

small heat map img

K562
Weissman
MYC
ENCSR000DLZ
r=0.81

small heat map img

K562
Weissman
H3K9ac
ENCSR000AKV
r=0.47

small heat map img

K562
Weissman
H3K4me2
ENCSR000AKT
r=0.46

small heat map img

K562
Weissman
H3K27ac
ENCSR000AKP
r=0.46

small heat map img

K562
Weissman
H3K4me3
ENCSR000AKU
r=0.46

small heat map img

K562
Weissman
H2AFZ
ENCSR000APC
r=0.44

small heat map img

K562
Weissman
H3K9ac
ENCSR000EVZ
r=0.42

small heat map img

K562
Weissman
H3K4me3
ENCSR000DWD
r=0.41

small heat map img

K562
Weissman
H3K4me3
ENCSR000EWA
r=0.38

small heat map img

K562
Weissman
H3K79me2
ENCSR000APD
r=0.21

small heat map img

K562
Weissman
H3K4me1
ENCSR000EWC
r=0.20

small heat map img

K562
Weissman
H3K4me1
ENCSR000AKS
r=0.17

small heat map img

K562
Weissman
H4K20me1
ENCSR000AKX
r=0.13

small heat map img

K562
Weissman
H3K9me1
ENCSR000AKW
r=0.10

small heat map img

K562
Weissman
H3K9me3
ENCSR000APE
r=0.09

small heat map img

K562
Weissman
H3K27me3
ENCSR000AKQ
r=0.06

small heat map img

K562
Weissman
H3K27me3
ENCSR000DWC
r=0.01

small heat map img

K562
Weissman
H3K36me3
ENCSR000AKR
r=0.01

small heat map img

K562
Weissman
H3K27me3
ENCSR000EWB
r=-0.03

small heat map img

K562
Weissman
H3K36me3
ENCSR000DWB
r=-0.05

small heat map img
7,746 peaks (download )

MCF 10A - Struhl - ENCSR000DOM

MCF 10A
Struhl
MYC
ENCSR000DOM
r=1.00

small heat map img

MCF 10A
Struhl
MYC
ENCSR000DOS
r=0.89

small heat map img
10,000 randomly-selected peaks from a total of 25,703 (download )

MCF 10A - Struhl - ENCSR000DOS

MCF 10A
Struhl
MYC
ENCSR000DOS
r=1.00

small heat map img

MCF 10A
Struhl
MYC
ENCSR000DOM
r=0.87

small heat map img
10,000 randomly-selected peaks from a total of 35,153 (download )

MCF-7 - Iyer - ENCSR000DMJ

MCF-7
Iyer
MYC
ENCSR000DMJ
r=1.00

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMM
r=0.86

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMP
r=0.85

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMQ
r=0.82

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.45

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.10

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.15

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.17

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.21

small heat map img
6,930 peaks (download )

MCF-7 - Iyer - ENCSR000DMM

MCF-7
Iyer
MYC
ENCSR000DMM
r=1.00

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMQ
r=0.88

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMJ
r=0.86

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMP
r=0.83

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.46

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.20

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.12

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.14

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.17

small heat map img
10,000 randomly-selected peaks from a total of 20,956 (download )

MCF-7 - Iyer - ENCSR000DMP

MCF-7
Iyer
MYC
ENCSR000DMP
r=1.00

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMQ
r=0.94

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMM
r=0.83

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMJ
r=0.81

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.45

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.17

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.16

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.16

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.18

small heat map img
10,000 randomly-selected peaks from a total of 10,072 (download )

MCF-7 - Iyer - ENCSR000DMQ

MCF-7
Iyer
MYC
ENCSR000DMQ
r=1.00

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMP
r=0.92

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMM
r=0.86

small heat map img

MCF-7
Iyer
MYC
ENCSR000DMJ
r=0.79

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.44

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.23

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.07

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.09

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.15

small heat map img
10,000 randomly-selected peaks from a total of 27,697 (download )

NB4 - Snyder - ENCSR000EHR

NB4
Snyder
MYC
ENCSR000EHR
r=1.00

small heat map img

NB4
Snyder
H3K4me3
ENCSR000DWP
r=0.38

small heat map img
10,000 randomly-selected peaks from a total of 26,252 (download )

endothelial cell of umbilical vein - Iyer - ENCSR000DLU

endothelial cell of umbilical vein
Iyer
MYC
ENCSR000DLU
r=1.00

small heat map img

endothelial cell of umbilical vein
Iyer
H2AFZ
ENCSR000ASC
r=0.46

small heat map img

endothelial cell of umbilical vein
Iyer
H3K9ac
ENCSR000ALD
r=0.45

small heat map img

endothelial cell of umbilical vein
Iyer
H3K4me3
ENCSR000DVN
r=0.41

small heat map img

endothelial cell of umbilical vein
Iyer
H3K4me2
ENCSR000AKM
r=0.40

small heat map img

endothelial cell of umbilical vein
Iyer
H3K4me3
ENCSR000AKN
r=0.40

small heat map img

endothelial cell of umbilical vein
Iyer
H3K27ac
ENCSR000ALB
r=0.40

small heat map img

endothelial cell of umbilical vein
Iyer
H3K4me1
ENCSR000AKL
r=0.26

small heat map img

endothelial cell of umbilical vein
Iyer
H3K79me2
ENCSR000ASD
r=0.12

small heat map img

endothelial cell of umbilical vein
Iyer
H3K9me3
ENCSR000ATB
r=0.02

small heat map img

endothelial cell of umbilical vein
Iyer
H3K9me1
ENCSR000ALE
r=-0.00

small heat map img

endothelial cell of umbilical vein
Iyer
H3K27me3
ENCSR000AKK
r=-0.01

small heat map img

endothelial cell of umbilical vein
Iyer
H4K20me1
ENCSR000ALF
r=-0.05

small heat map img

endothelial cell of umbilical vein
Iyer
H3K36me3
ENCSR000DVM
r=-0.07

small heat map img

endothelial cell of umbilical vein
Iyer
H3K36me3
ENCSR000ALC
r=-0.09

small heat map img

endothelial cell of umbilical vein
Iyer
H3K27me3
ENCSR000DVO
r=-0.10

small heat map img
5,145 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at MYC peaks

A549 - Snyder - ENCSR000DYC

A549
Snyder
MYC
ENCSR000DYC
r=1.00

small heat map img

A549
Snyder
MAX
ENCSR000DYG
r=0.83

small heat map img

A549
Snyder
MAX
ENCSR000BTJ
r=0.81

small heat map img

A549
Snyder
E2F6
ENCSR000BTC
r=0.62

small heat map img

A549
Snyder
BHLHE40
ENCSR000DYJ
r=0.58

small heat map img

A549
Snyder
SP1
ENCSR000BPE
r=0.56

small heat map img

A549
Snyder
CREB1
ENCSR000BRB
r=0.54

small heat map img

A549
Snyder
POLR2A
ENCSR000DMZ
r=0.51

small heat map img

A549
Snyder
PBX3
ENCSR000BTN
r=0.50

small heat map img

A549
Snyder
POLR2A
ENCSR000BHI
r=0.49

small heat map img

A549
Snyder
TAF1
ENCSR000BPF
r=0.49

small heat map img

A549
Snyder
TEAD4
ENCSR000BUD
r=0.49

small heat map img

A549
Snyder
RAD21
ENCSR000DYE
r=0.49

small heat map img

A549
Snyder
YY1
ENCSR000BPM
r=0.48

small heat map img

A549
Snyder
POLR2A
ENCSR000BHH
r=0.48

small heat map img

A549
Snyder
GATA3
ENCSR000BTI
r=0.48

small heat map img

A549
Snyder
CEBPB
ENCSR000BUB
r=0.45

small heat map img

A549
Snyder
USF1
ENCSR000BHX
r=0.45

small heat map img

A549
Snyder
SIN3A
ENCSR000BRM
r=0.44

small heat map img

A549
Snyder
ETS1
ENCSR000BPU
r=0.43

small heat map img

A549
Snyder
RAD21
ENCSR000BUC
r=0.42

small heat map img

A549
Snyder
NR3C1
ENCSR000BJR
r=0.41

small heat map img

A549
Snyder
CTCF
ENCSR000DYD
r=0.41

small heat map img

A549
Snyder
REST
ENCSR000BQP
r=0.41

small heat map img

A549
Snyder
USF1
ENCSR000BJB
r=0.39

small heat map img

A549
Snyder
CEBPB
ENCSR000DYI
r=0.39

small heat map img

A549
Snyder
SIX5
ENCSR000BRL
r=0.39

small heat map img

A549
Snyder
ZBTB33
ENCSR000BPZ
r=0.38

small heat map img

A549
Snyder
USF1
ENCSR000BPV
r=0.37

small heat map img

A549
Snyder
GABPA
ENCSR000BPY
r=0.37

small heat map img

A549
Snyder
FOXA2
ENCSR000BRE
r=0.36

small heat map img

A549
Snyder
CTCF
ENCSR000DNA
r=0.34

small heat map img

A549
Snyder
TCF12
ENCSR000BQQ
r=0.34

small heat map img

A549
Snyder
FOSL2
ENCSR000BQO
r=0.32

small heat map img

A549
Snyder
ELF1
ENCSR000BPT
r=0.31

small heat map img

A549
Snyder
ATF3
ENCSR000BPS
r=0.30

small heat map img

A549
Snyder
JUND
ENCSR000BRF
r=0.30

small heat map img

A549
Snyder
CTCF
ENCSR000AUF
r=0.29

small heat map img

A549
Snyder
CTCF
ENCSR000BHV
r=0.28

small heat map img

A549
Snyder
BCL3
ENCSR000BQH
r=0.28

small heat map img

A549
Snyder
EP300
ENCSR000BPW
r=0.28

small heat map img

A549
Snyder
CTCF
ENCSR000AUE
r=0.28

small heat map img

A549
Snyder
CTCF
ENCSR000BHW
r=0.26

small heat map img

A549
Snyder
NR3C1
ENCSR000BHF
r=0.24

small heat map img

A549
Snyder
CTCF
ENCSR000DPF
r=0.21

small heat map img

A549
Snyder
FOXA1
ENCSR000BPX
r=0.13

small heat map img

A549
Snyder
NR3C1
ENCSR000BHE
r=0.13

small heat map img

A549
Snyder
NR3C1
ENCSR000BHG
r=0.11

small heat map img
5,780 peaks (download )

GM12878 - Iyer - ENCSR000DKU

GM12878
Iyer
MYC
ENCSR000DKU
r=1.00

small heat map img

GM12878
Iyer
MAX
ENCSR000DZF
r=0.78

small heat map img

GM12878
Iyer
MXI1
ENCSR000DZI
r=0.71

small heat map img

GM12878
Iyer
SIN3A
ENCSR000DYX
r=0.62

small heat map img

GM12878
Iyer
POLR2A
ENCSR000DKT
r=0.58

small heat map img

GM12878
Iyer
STAT1
ENCSR000DZM
r=0.57

small heat map img

GM12878
Iyer
POLR2A
ENCSR000BGD
r=0.56

small heat map img

GM12878
Iyer
TBL1XR1
ENCSR000DYZ
r=0.51

small heat map img

GM12878
Iyer
BHLHE40
ENCSR000DZJ
r=0.51

small heat map img

GM12878
Iyer
ELK1
ENCSR000DZB
r=0.50

small heat map img

GM12878
Iyer
RCOR1
ENCSR000DZC
r=0.50

small heat map img

GM12878
Iyer
POLR2A
ENCSR000EAD
r=0.48

small heat map img

GM12878
Iyer
ESRRA
ENCSR000DYQ
r=0.46

small heat map img

GM12878
Iyer
POLR2A
ENCSR000EYW
r=0.46

small heat map img

GM12878
Iyer
ELF1
ENCSR000BMB
r=0.46

small heat map img

GM12878
Iyer
PAX5
ENCSR000BHD
r=0.44

small heat map img

GM12878
Iyer
EP300
ENCSR000DZG
r=0.44

small heat map img

GM12878
Iyer
USF2
ENCSR000DZU
r=0.42

small heat map img

GM12878
Iyer
TCF3
ENCSR000BQT
r=0.42

small heat map img

GM12878
Iyer
RUNX3
ENCSR000BRI
r=0.42

small heat map img

GM12878
Iyer
CREB1
ENCSR000BUF
r=0.41

small heat map img

GM12878
Iyer
JUND
ENCSR000DYS
r=0.41

small heat map img

GM12878
Iyer
YY1
ENCSR000BNP
r=0.41

small heat map img

GM12878
Iyer
PML
ENCSR000BQM
r=0.39

small heat map img

GM12878
Iyer
NRF1
ENCSR000DZO
r=0.38

small heat map img

GM12878
Iyer
E2F4
ENCSR000DYY
r=0.38

small heat map img

GM12878
Iyer
EP300
ENCSR000DZD
r=0.38

small heat map img

GM12878
Iyer
SREBF1
ENCSR000DYU
r=0.38

small heat map img

GM12878
Iyer
TCF12
ENCSR000BGZ
r=0.38

small heat map img

GM12878
Iyer
MAFK
ENCSR000DYV
r=0.38

small heat map img

GM12878
Iyer
BRCA1
ENCSR000DZS
r=0.38

small heat map img

GM12878
Iyer
CHD1
ENCSR000DZE
r=0.37

small heat map img

GM12878
Iyer
RELA
ENCSR000EAG
r=0.37

small heat map img

GM12878
Iyer
RFX5
ENCSR000DZW
r=0.36

small heat map img

GM12878
Iyer
KAT2A
ENCSR000DNO
r=0.36

small heat map img

GM12878
Iyer
EGR1
ENCSR000BRG
r=0.36

small heat map img

GM12878
Iyer
POU2F2
ENCSR000BGP
r=0.35

small heat map img

GM12878
Iyer
SMC3
ENCSR000DZP
r=0.34

small heat map img

GM12878
Iyer
ETS1
ENCSR000BKA
r=0.34

small heat map img

GM12878
Iyer
USF1
ENCSR000BGI
r=0.33

small heat map img

GM12878
Iyer
SREBF2
ENCSR000DYT
r=0.33

small heat map img

GM12878
Iyer
GABPA
ENCSR000BGC
r=0.33

small heat map img

GM12878
Iyer
TBP
ENCSR000DZZ
r=0.32

small heat map img

GM12878
Iyer
TAF1
ENCSR000BGS
r=0.32

small heat map img

GM12878
Iyer
FOXM1
ENCSR000BRU
r=0.30

small heat map img

GM12878
Iyer
CUX1
ENCSR000DYR
r=0.30

small heat map img

GM12878
Iyer
ZNF143
ENCSR000DZL
r=0.29

small heat map img

GM12878
Iyer
WRNIP1
ENCSR000EAA
r=0.29

small heat map img

GM12878
Iyer
BCL3
ENCSR000BNQ
r=0.29

small heat map img

GM12878
Iyer
EGR1
ENCSR000BMQ
r=0.29

small heat map img

GM12878
Iyer
ATF2
ENCSR000BQK
r=0.29

small heat map img

GM12878
Iyer
NFE2
ENCSR000DZY
r=0.29

small heat map img

GM12878
Iyer
IRF3
ENCSR000DZX
r=0.27

small heat map img

GM12878
Iyer
NR2C2
ENCSR000EUL
r=0.27

small heat map img

GM12878
Iyer
CTCF
ENCSR000DZN
r=0.26

small heat map img

GM12878
Iyer
SIX5
ENCSR000BJE
r=0.26

small heat map img

GM12878
Iyer
STAT3
ENCSR000DZV
r=0.25

small heat map img

GM12878
Iyer
SRF
ENCSR000BGE
r=0.25

small heat map img

GM12878
Iyer
SP1
ENCSR000BHK
r=0.25

small heat map img

GM12878
Iyer
NFIC
ENCSR000BRN
r=0.24

small heat map img

GM12878
Iyer
FOS
ENCSR000EYZ
r=0.24

small heat map img

GM12878
Iyer
CTCF
ENCSR000DKV
r=0.24

small heat map img

GM12878
Iyer
SRF
ENCSR000BMI
r=0.24

small heat map img

GM12878
Iyer
STAT5A
ENCSR000BQZ
r=0.23

small heat map img

GM12878
Iyer
RAD21
ENCSR000EAC
r=0.23

small heat map img

GM12878
Iyer
CEBPB
ENCSR000BRX
r=0.23

small heat map img

GM12878
Iyer
CTCF
ENCSR000AKB
r=0.21

small heat map img

GM12878
Iyer
PAX5
ENCSR000BHJ
r=0.21

small heat map img

GM12878
Iyer
REST
ENCSR000BGF
r=0.21

small heat map img

GM12878
Iyer
EBF1
ENCSR000DZQ
r=0.20

small heat map img

GM12878
Iyer
NFYB
ENCSR000DNM
r=0.20

small heat map img

GM12878
Iyer
SUPT20H
ENCSR000DNP
r=0.20

small heat map img

GM12878
Iyer
NFYA
ENCSR000DNN
r=0.20

small heat map img

GM12878
Iyer
ZNF384
ENCSR000DYP
r=0.20

small heat map img

GM12878
Iyer
IRF4
ENCSR000BGY
r=0.20

small heat map img

GM12878
Iyer
CTCF
ENCSR000DRZ
r=0.19

small heat map img

GM12878
Iyer
MEF2A
ENCSR000BKB
r=0.18

small heat map img

GM12878
Iyer
NFATC1
ENCSR000BQL
r=0.18

small heat map img

GM12878
Iyer
ATF3
ENCSR000BJY
r=0.17

small heat map img

GM12878
Iyer
MTA3
ENCSR000BRH
r=0.16

small heat map img

GM12878
Iyer
PBX3
ENCSR000BGR
r=0.16

small heat map img

GM12878
Iyer
EP300
ENCSR000BHB
r=0.15

small heat map img

GM12878
Iyer
ZBTB33
ENCSR000BHC
r=0.15

small heat map img

GM12878
Iyer
RXRA
ENCSR000BJD
r=0.15

small heat map img

GM12878
Iyer
EBF1
ENCSR000BGU
r=0.14

small heat map img

GM12878
Iyer
ZEB1
ENCSR000BND
r=0.13

small heat map img

GM12878
Iyer
POLR3G
ENCSR000EYU
r=0.12

small heat map img

GM12878
Iyer
BCL11A
ENCSR000BHA
r=0.12

small heat map img

GM12878
Iyer
REST
ENCSR000BQS
r=0.12

small heat map img

GM12878
Iyer
MEF2C
ENCSR000BNG
r=0.11

small heat map img

GM12878
Iyer
RAD21
ENCSR000BMY
r=0.10

small heat map img

GM12878
Iyer
SPI1
ENCSR000BGQ
r=0.09

small heat map img

GM12878
Iyer
ZZZ3
ENCSR000DNQ
r=0.07

small heat map img

GM12878
Iyer
BATF
ENCSR000BGT
r=0.05

small heat map img

GM12878
Iyer
YY1
ENCSR000EUM
r=0.04

small heat map img

GM12878
Iyer
IKZF1
ENCSR000EUJ
r=0.03

small heat map img

GM12878
Iyer
EZH2
ENCSR000ARD
r=-0.03

small heat map img

GM12878
Iyer
JUND
ENCSR000EYV
r=-0.03

small heat map img

GM12878
Iyer
ZNF274
ENCSR000EUK
r=-0.22

small heat map img
3,690 peaks (download )

H1-hESC - Iyer - ENCSR000DLI

H1-hESC
Iyer
MYC
ENCSR000DLI
r=1.00

small heat map img

H1-hESC
Iyer
SUZ12
ENCSR000EUQ
r=0.27

small heat map img

H1-hESC
Iyer
SIRT6
ENCSR000AUS
r=0.23

small heat map img

H1-hESC
Iyer
EP300
ENCSR000AUQ
r=0.22

small heat map img

H1-hESC
Iyer
HDAC6
ENCSR000ATQ
r=0.22

small heat map img

H1-hESC
Iyer
CTCF
ENCSR000DLK
r=0.22

small heat map img

H1-hESC
Iyer
CREB1
ENCSR000BSN
r=0.20

small heat map img

H1-hESC
Iyer
SUZ12
ENCSR000ATS
r=0.20

small heat map img

H1-hESC
Iyer
MAX
ENCSR000BSJ
r=0.19

small heat map img

H1-hESC
Iyer
CTBP2
ENCSR000EUO
r=0.19

small heat map img

H1-hESC
Iyer
KDM5B
ENCSR000AUR
r=0.19

small heat map img

H1-hESC
Iyer
CHD7
ENCSR000AVA
r=0.18

small heat map img

H1-hESC
Iyer
USF2
ENCSR000ECD
r=0.18

small heat map img

H1-hESC
Iyer
E2F6
ENCSR000BSI
r=0.17

small heat map img

H1-hESC
Iyer
RBBP5
ENCSR000AQC
r=0.17

small heat map img

H1-hESC
Iyer
MXI1
ENCSR000EBR
r=0.17

small heat map img

H1-hESC
Iyer
KDM5A
ENCSR000AQL
r=0.16

small heat map img

H1-hESC
Iyer
MAX
ENCSR000EUP
r=0.15

small heat map img

H1-hESC
Iyer
HDAC2
ENCSR000AVB
r=0.15

small heat map img

H1-hESC
Iyer
CTCF
ENCSR000AMF
r=0.15

small heat map img

H1-hESC
Iyer
POLR2A
ENCSR000DLJ
r=0.14

small heat map img

H1-hESC
Iyer
SP1
ENCSR000BIR
r=0.14

small heat map img

H1-hESC
Iyer
ZNF143
ENCSR000EBW
r=0.14

small heat map img

H1-hESC
Iyer
ZNF274
ENCSR000EUN
r=0.14

small heat map img

H1-hESC
Iyer
MYC
ENCSR000EBY
r=0.14

small heat map img

H1-hESC
Iyer
SP2
ENCSR000BQG
r=0.13

small heat map img

H1-hESC
Iyer
PHF8
ENCSR000ATK
r=0.12

small heat map img

H1-hESC
Iyer
RFX5
ENCSR000ECF
r=0.12

small heat map img

H1-hESC
Iyer
TEAD4
ENCSR000BRY
r=0.12

small heat map img

H1-hESC
Iyer
SP4
ENCSR000BQV
r=0.12

small heat map img

H1-hESC
Iyer
EZH2
ENCSR000ASY
r=0.11

small heat map img

H1-hESC
Iyer
BACH1
ENCSR000EBQ
r=0.11

small heat map img

H1-hESC
Iyer
BRCA1
ENCSR000EBX
r=0.11

small heat map img

H1-hESC
Iyer
JUND
ENCSR000EBZ
r=0.11

small heat map img

H1-hESC
Iyer
USF1
ENCSR000BIU
r=0.11

small heat map img

H1-hESC
Iyer
SIN3A
ENCSR000EBO
r=0.11

small heat map img

H1-hESC
Iyer
TBP
ENCSR000ECB
r=0.10

small heat map img

H1-hESC
Iyer
NRF1
ENCSR000ECC
r=0.10

small heat map img

H1-hESC
Iyer
KDM4A
ENCSR000AVC
r=0.10

small heat map img

H1-hESC
Iyer
CEBPB
ENCSR000EBV
r=0.10

small heat map img

H1-hESC
Iyer
RAD21
ENCSR000ECE
r=0.10

small heat map img

H1-hESC
Iyer
JUN
ENCSR000ECA
r=0.09

small heat map img

H1-hESC
Iyer
CHD1
ENCSR000AQK
r=0.09

small heat map img

H1-hESC
Iyer
CHD1
ENCSR000EBU
r=0.09

small heat map img

H1-hESC
Iyer
FOSL1
ENCSR000BNS
r=0.09

small heat map img

H1-hESC
Iyer
GABPA
ENCSR000BIW
r=0.08

small heat map img

H1-hESC
Iyer
JUND
ENCSR000BKP
r=0.08

small heat map img

H1-hESC
Iyer
SAP30
ENCSR000ATR
r=0.08

small heat map img

H1-hESC
Iyer
MAFK
ENCSR000EBS
r=0.08

small heat map img

H1-hESC
Iyer
NANOG
ENCSR000BMT
r=0.08

small heat map img

H1-hESC
Iyer
TAF1
ENCSR000BHO
r=0.08

small heat map img

H1-hESC
Iyer
YY1
ENCSR000BKD
r=0.08

small heat map img

H1-hESC
Iyer
ATF3
ENCSR000BKC
r=0.08

small heat map img

H1-hESC
Iyer
TAF7
ENCSR000BLU
r=0.07

small heat map img

H1-hESC
Iyer
ATF2
ENCSR000BQU
r=0.07

small heat map img

H1-hESC
Iyer
RXRA
ENCSR000BJW
r=0.07

small heat map img

H1-hESC
Iyer
TCF12
ENCSR000BIT
r=0.07

small heat map img

H1-hESC
Iyer
HDAC2
ENCSR000BNR
r=0.07

small heat map img

H1-hESC
Iyer
REST
ENCSR000BHM
r=0.06

small heat map img

H1-hESC
Iyer
SIN3A
ENCSR000BIS
r=0.06

small heat map img

H1-hESC
Iyer
SRF
ENCSR000BIV
r=0.06

small heat map img

H1-hESC
Iyer
SIX5
ENCSR000BIQ
r=0.06

small heat map img

H1-hESC
Iyer
POLR2A
ENCSR000BHN
r=0.06

small heat map img

H1-hESC
Iyer
EGR1
ENCSR000BJA
r=0.06

small heat map img

H1-hESC
Iyer
BCL11A
ENCSR000BMJ
r=0.05

small heat map img

H1-hESC
Iyer
EP300
ENCSR000BKK
r=0.05

small heat map img

H1-hESC
Iyer
RAD21
ENCSR000BLD
r=0.05

small heat map img

H1-hESC
Iyer
CTCF
ENCSR000BNH
r=0.05

small heat map img

H1-hESC
Iyer
BCL11A
ENCSR000BIP
r=0.05

small heat map img
1,217 peaks (download )

H1-hESC - Snyder - ENCSR000EBY

H1-hESC
Snyder
MYC
ENCSR000EBY
r=1.00

small heat map img

H1-hESC
Snyder
MXI1
ENCSR000EBR
r=0.77

small heat map img

H1-hESC
Snyder
MAX
ENCSR000EUP
r=0.76

small heat map img

H1-hESC
Snyder
MAX
ENCSR000BSJ
r=0.72

small heat map img

H1-hESC
Snyder
SIN3A
ENCSR000EBO
r=0.68

small heat map img

H1-hESC
Snyder
JUND
ENCSR000EBZ
r=0.67

small heat map img

H1-hESC
Snyder
POLR2A
ENCSR000DLJ
r=0.56

small heat map img

H1-hESC
Snyder
JUN
ENCSR000ECA
r=0.56

small heat map img

H1-hESC
Snyder
BRCA1
ENCSR000EBX
r=0.56

small heat map img

H1-hESC
Snyder
USF2
ENCSR000ECD
r=0.55

small heat map img

H1-hESC
Snyder
CHD7
ENCSR000AVA
r=0.54

small heat map img

H1-hESC
Snyder
CTBP2
ENCSR000EUO
r=0.54

small heat map img

H1-hESC
Snyder
HDAC2
ENCSR000AVB
r=0.54

small heat map img

H1-hESC
Snyder
TAF1
ENCSR000BHO
r=0.54

small heat map img

H1-hESC
Snyder
E2F6
ENCSR000BSI
r=0.54

small heat map img

H1-hESC
Snyder
EP300
ENCSR000AUQ
r=0.53

small heat map img

H1-hESC
Snyder
RBBP5
ENCSR000AQC
r=0.52

small heat map img

H1-hESC
Snyder
TBP
ENCSR000ECB
r=0.51

small heat map img

H1-hESC
Snyder
BACH1
ENCSR000EBQ
r=0.51

small heat map img

H1-hESC
Snyder
TEAD4
ENCSR000BRY
r=0.50

small heat map img

H1-hESC
Snyder
CEBPB
ENCSR000EBV
r=0.48

small heat map img

H1-hESC
Snyder
MAFK
ENCSR000EBS
r=0.48

small heat map img

H1-hESC
Snyder
SIRT6
ENCSR000AUS
r=0.46

small heat map img

H1-hESC
Snyder
ZNF143
ENCSR000EBW
r=0.46

small heat map img

H1-hESC
Snyder
YY1
ENCSR000BKD
r=0.45

small heat map img

H1-hESC
Snyder
POLR2A
ENCSR000BHN
r=0.45

small heat map img

H1-hESC
Snyder
PHF8
ENCSR000ATK
r=0.44

small heat map img

H1-hESC
Snyder
RAD21
ENCSR000ECE
r=0.43

small heat map img

H1-hESC
Snyder
CREB1
ENCSR000BSN
r=0.42

small heat map img

H1-hESC
Snyder
NRF1
ENCSR000ECC
r=0.42

small heat map img

H1-hESC
Snyder
USF1
ENCSR000BIU
r=0.42

small heat map img

H1-hESC
Snyder
RFX5
ENCSR000ECF
r=0.40

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000AMF
r=0.40

small heat map img

H1-hESC
Snyder
HDAC6
ENCSR000ATQ
r=0.40

small heat map img

H1-hESC
Snyder
SUZ12
ENCSR000ATS
r=0.39

small heat map img

H1-hESC
Snyder
CHD1
ENCSR000EBU
r=0.39

small heat map img

H1-hESC
Snyder
SP1
ENCSR000BIR
r=0.38

small heat map img

H1-hESC
Snyder
KDM5A
ENCSR000AQL
r=0.38

small heat map img

H1-hESC
Snyder
KDM4A
ENCSR000AVC
r=0.38

small heat map img

H1-hESC
Snyder
GABPA
ENCSR000BIW
r=0.38

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000DLK
r=0.37

small heat map img

H1-hESC
Snyder
ATF2
ENCSR000BQU
r=0.36

small heat map img

H1-hESC
Snyder
SAP30
ENCSR000ATR
r=0.36

small heat map img

H1-hESC
Snyder
RAD21
ENCSR000BLD
r=0.34

small heat map img

H1-hESC
Snyder
SIN3A
ENCSR000BIS
r=0.34

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000BNH
r=0.34

small heat map img

H1-hESC
Snyder
SP4
ENCSR000BQV
r=0.29

small heat map img

H1-hESC
Snyder
TAF7
ENCSR000BLU
r=0.28

small heat map img

H1-hESC
Snyder
ATF3
ENCSR000BKC
r=0.26

small heat map img

H1-hESC
Snyder
MYC
ENCSR000DLI
r=0.26

small heat map img

H1-hESC
Snyder
JUND
ENCSR000BKP
r=0.26

small heat map img

H1-hESC
Snyder
EGR1
ENCSR000BJA
r=0.24

small heat map img

H1-hESC
Snyder
KDM5B
ENCSR000AUR
r=0.23

small heat map img

H1-hESC
Snyder
EZH2
ENCSR000ASY
r=0.23

small heat map img

H1-hESC
Snyder
SIX5
ENCSR000BIQ
r=0.22

small heat map img

H1-hESC
Snyder
SRF
ENCSR000BIV
r=0.22

small heat map img

H1-hESC
Snyder
HDAC2
ENCSR000BNR
r=0.21

small heat map img

H1-hESC
Snyder
EP300
ENCSR000BKK
r=0.21

small heat map img

H1-hESC
Snyder
TCF12
ENCSR000BIT
r=0.20

small heat map img

H1-hESC
Snyder
CHD1
ENCSR000AQK
r=0.19

small heat map img

H1-hESC
Snyder
SP2
ENCSR000BQG
r=0.17

small heat map img

H1-hESC
Snyder
FOSL1
ENCSR000BNS
r=0.16

small heat map img

H1-hESC
Snyder
SUZ12
ENCSR000EUQ
r=0.12

small heat map img

H1-hESC
Snyder
BCL11A
ENCSR000BMJ
r=0.11

small heat map img

H1-hESC
Snyder
NANOG
ENCSR000BMT
r=0.11

small heat map img

H1-hESC
Snyder
REST
ENCSR000BHM
r=0.11

small heat map img

H1-hESC
Snyder
BCL11A
ENCSR000BIP
r=0.10

small heat map img

H1-hESC
Snyder
RXRA
ENCSR000BJW
r=0.09

small heat map img

H1-hESC
Snyder
ZNF274
ENCSR000EUN
r=0.03

small heat map img
4,551 peaks (download )

HeLa-S3 - Iyer - ENCSR000DLN

HeLa-S3
Iyer
MYC
ENCSR000DLN
r=1.00

small heat map img

HeLa-S3
Iyer
MAX
ENCSR000ECN
r=0.83

small heat map img

HeLa-S3
Iyer
MYC
ENCSR000EZD
r=0.81

small heat map img

HeLa-S3
Iyer
MAX
ENCSR000EZF
r=0.79

small heat map img

HeLa-S3
Iyer
MXI1
ENCSR000ECU
r=0.74

small heat map img

HeLa-S3
Iyer
RCOR1
ENCSR000ECM
r=0.64

small heat map img

HeLa-S3
Iyer
ZKSCAN1
ENCSR000ECJ
r=0.59

small heat map img

HeLa-S3
Iyer
SMC3
ENCSR000ECS
r=0.58

small heat map img

HeLa-S3
Iyer
ELK1
ENCSR000ECI
r=0.58

small heat map img

HeLa-S3
Iyer
E2F6
ENCSR000EVK
r=0.57

small heat map img

HeLa-S3
Iyer
MAFK
ENCSR000ECK
r=0.56

small heat map img

HeLa-S3
Iyer
HCFC1
ENCSR000ECH
r=0.53

small heat map img

HeLa-S3
Iyer
USF2
ENCSR000ECW
r=0.52

small heat map img

HeLa-S3
Iyer
STAT1
ENCSR000EZK
r=0.51

small heat map img

HeLa-S3
Iyer
FOS
ENCSR000EZE
r=0.51

small heat map img

HeLa-S3
Iyer
BRCA1
ENCSR000EDB
r=0.50

small heat map img

HeLa-S3
Iyer
JUND
ENCSR000EDH
r=0.49

small heat map img

HeLa-S3
Iyer
POLR2A
ENCSR000DLM
r=0.49

small heat map img

HeLa-S3
Iyer
TCF7L2
ENCSR000EVE
r=0.48

small heat map img

HeLa-S3
Iyer
RFX5
ENCSR000ECX
r=0.48

small heat map img

HeLa-S3
Iyer
JUN
ENCSR000EDG
r=0.46

small heat map img

HeLa-S3
Iyer
STAT3
ENCSR000EDC
r=0.45

small heat map img

HeLa-S3
Iyer
RAD21
ENCSR000EDE
r=0.45

small heat map img

HeLa-S3
Iyer
ELK4
ENCSR000EVI
r=0.45

small heat map img

HeLa-S3
Iyer
SMARCB1
ENCSR000EDK
r=0.45

small heat map img

HeLa-S3
Iyer
SMARCC1
ENCSR000EDM
r=0.44

small heat map img

HeLa-S3
Iyer
CEBPB
ENCSR000EDA
r=0.44

small heat map img

HeLa-S3
Iyer
E2F4
ENCSR000EVL
r=0.43

small heat map img

HeLa-S3
Iyer
ZNF143
ENCSR000ECO
r=0.43

small heat map img

HeLa-S3
Iyer
SMARCC2
ENCSR000EDL
r=0.43

small heat map img

HeLa-S3
Iyer
POLR2A
ENCSR000EZL
r=0.42

small heat map img

HeLa-S3
Iyer
EP300
ENCSR000ECV
r=0.42

small heat map img

HeLa-S3
Iyer
TBP
ENCSR000EDD
r=0.42

small heat map img

HeLa-S3
Iyer
KAT2A
ENCSR000ECR
r=0.39

small heat map img

HeLa-S3
Iyer
E2F1
ENCSR000EVJ
r=0.39

small heat map img

HeLa-S3
Iyer
POLR2A
ENCSR000BGO
r=0.36

small heat map img

HeLa-S3
Iyer
PRDM1
ENCSR000ECY
r=0.36

small heat map img

HeLa-S3
Iyer
NFYA
ENCSR000DNS
r=0.34

small heat map img

HeLa-S3
Iyer
TCF7L2
ENCSR000EVF
r=0.33

small heat map img

HeLa-S3
Iyer
CTCF
ENCSR000DLO
r=0.32

small heat map img

HeLa-S3
Iyer
SMARCA4
ENCSR000EZC
r=0.32

small heat map img

HeLa-S3
Iyer
IRF3
ENCSR000EDF
r=0.31

small heat map img

HeLa-S3
Iyer
SUPT20H
ENCSR000ECQ
r=0.31

small heat map img

HeLa-S3
Iyer
NRF1
ENCSR000EDJ
r=0.30

small heat map img

HeLa-S3
Iyer
NR2C2
ENCSR000EVN
r=0.29

small heat map img

HeLa-S3
Iyer
TAF1
ENCSR000BHT
r=0.28

small heat map img

HeLa-S3
Iyer
CTCF
ENCSR000DUB
r=0.27

small heat map img

HeLa-S3
Iyer
CTCF
ENCSR000AOA
r=0.26

small heat map img

HeLa-S3
Iyer
GABPA
ENCSR000BHS
r=0.24

small heat map img

HeLa-S3
Iyer
NFYB
ENCSR000DNR
r=0.23

small heat map img

HeLa-S3
Iyer
ZNF274
ENCSR000EVG
r=0.18

small heat map img

HeLa-S3
Iyer
EZH2
ENCSR000ATC
r=0.16

small heat map img

HeLa-S3
Iyer
REST
ENCSR000BMN
r=0.11

small heat map img

HeLa-S3
Iyer
GTF3C2
ENCSR000DNY
r=0.10

small heat map img

HeLa-S3
Iyer
BRF2
ENCSR000DNV
r=0.06

small heat map img

HeLa-S3
Iyer
POLR3A
ENCSR000DNU
r=0.04

small heat map img

HeLa-S3
Iyer
ZZZ3
ENCSR000DNT
r=0.04

small heat map img

HeLa-S3
Iyer
BDP1
ENCSR000DNX
r=-0.01

small heat map img

HeLa-S3
Iyer
BRF1
ENCSR000DNW
r=-0.09

small heat map img
2,835 peaks (download )

HeLa-S3 - Weissman - ENCSR000EZD

HeLa-S3
Weissman
MYC
ENCSR000EZD
r=1.00

small heat map img

HeLa-S3
Weissman
MAX
ENCSR000EZF
r=0.89

small heat map img

HeLa-S3
Weissman
MAX
ENCSR000ECN
r=0.87

small heat map img

HeLa-S3
Weissman
MXI1
ENCSR000ECU
r=0.79

small heat map img

HeLa-S3
Weissman
MYC
ENCSR000DLN
r=0.77

small heat map img

HeLa-S3
Weissman
RCOR1
ENCSR000ECM
r=0.73

small heat map img

HeLa-S3
Weissman
ELK1
ENCSR000ECI
r=0.69

small heat map img

HeLa-S3
Weissman
ZKSCAN1
ENCSR000ECJ
r=0.69

small heat map img

HeLa-S3
Weissman
HCFC1
ENCSR000ECH
r=0.65

small heat map img

HeLa-S3
Weissman
MAFK
ENCSR000ECK
r=0.63

small heat map img

HeLa-S3
Weissman
E2F6
ENCSR000EVK
r=0.62

small heat map img

HeLa-S3
Weissman
SMC3
ENCSR000ECS
r=0.59

small heat map img

HeLa-S3
Weissman
RFX5
ENCSR000ECX
r=0.58

small heat map img

HeLa-S3
Weissman
FOS
ENCSR000EZE
r=0.58

small heat map img

HeLa-S3
Weissman
STAT1
ENCSR000EZK
r=0.57

small heat map img

HeLa-S3
Weissman
BRCA1
ENCSR000EDB
r=0.57

small heat map img

HeLa-S3
Weissman
SMARCB1
ENCSR000EDK
r=0.56

small heat map img

HeLa-S3
Weissman
E2F4
ENCSR000EVL
r=0.55

small heat map img

HeLa-S3
Weissman
POLR2A
ENCSR000DLM
r=0.55

small heat map img

HeLa-S3
Weissman
POLR2A
ENCSR000EZL
r=0.53

small heat map img

HeLa-S3
Weissman
ZNF143
ENCSR000ECO
r=0.52

small heat map img

HeLa-S3
Weissman
E2F1
ENCSR000EVJ
r=0.52

small heat map img

HeLa-S3
Weissman
TCF7L2
ENCSR000EVE
r=0.51

small heat map img

HeLa-S3
Weissman
USF2
ENCSR000ECW
r=0.51

small heat map img

HeLa-S3
Weissman
JUND
ENCSR000EDH
r=0.51

small heat map img

HeLa-S3
Weissman
ELK4
ENCSR000EVI
r=0.49

small heat map img

HeLa-S3
Weissman
POLR2A
ENCSR000BGO
r=0.48

small heat map img

HeLa-S3
Weissman
TBP
ENCSR000EDD
r=0.47

small heat map img

HeLa-S3
Weissman
SMARCC1
ENCSR000EDM
r=0.46

small heat map img

HeLa-S3
Weissman
STAT3
ENCSR000EDC
r=0.45

small heat map img

HeLa-S3
Weissman
CEBPB
ENCSR000EDA
r=0.45

small heat map img

HeLa-S3
Weissman
RAD21
ENCSR000EDE
r=0.45

small heat map img

HeLa-S3
Weissman
JUN
ENCSR000EDG
r=0.45

small heat map img

HeLa-S3
Weissman
NFYA
ENCSR000DNS
r=0.44

small heat map img

HeLa-S3
Weissman
SMARCC2
ENCSR000EDL
r=0.44

small heat map img

HeLa-S3
Weissman
KAT2A
ENCSR000ECR
r=0.43

small heat map img

HeLa-S3
Weissman
EP300
ENCSR000ECV
r=0.39

small heat map img

HeLa-S3
Weissman
NRF1
ENCSR000EDJ
r=0.38

small heat map img

HeLa-S3
Weissman
PRDM1
ENCSR000ECY
r=0.36

small heat map img

HeLa-S3
Weissman
SMARCA4
ENCSR000EZC
r=0.35

small heat map img

HeLa-S3
Weissman
CTCF
ENCSR000DLO
r=0.35

small heat map img

HeLa-S3
Weissman
IRF3
ENCSR000EDF
r=0.35

small heat map img

HeLa-S3
Weissman
NR2C2
ENCSR000EVN
r=0.35

small heat map img

HeLa-S3
Weissman
TCF7L2
ENCSR000EVF
r=0.33

small heat map img

HeLa-S3
Weissman
NFYB
ENCSR000DNR
r=0.32

small heat map img

HeLa-S3
Weissman
TAF1
ENCSR000BHT
r=0.32

small heat map img

HeLa-S3
Weissman
CTCF
ENCSR000DUB
r=0.29

small heat map img

HeLa-S3
Weissman
GABPA
ENCSR000BHS
r=0.29

small heat map img

HeLa-S3
Weissman
SUPT20H
ENCSR000ECQ
r=0.28

small heat map img

HeLa-S3
Weissman
CTCF
ENCSR000AOA
r=0.26

small heat map img

HeLa-S3
Weissman
ZNF274
ENCSR000EVG
r=0.19

small heat map img

HeLa-S3
Weissman
EZH2
ENCSR000ATC
r=0.13

small heat map img

HeLa-S3
Weissman
REST
ENCSR000BMN
r=0.09

small heat map img

HeLa-S3
Weissman
GTF3C2
ENCSR000DNY
r=0.08

small heat map img

HeLa-S3
Weissman
BRF2
ENCSR000DNV
r=0.07

small heat map img

HeLa-S3
Weissman
POLR3A
ENCSR000DNU
r=0.06

small heat map img

HeLa-S3
Weissman
BDP1
ENCSR000DNX
r=-0.01

small heat map img

HeLa-S3
Weissman
ZZZ3
ENCSR000DNT
r=-0.03

small heat map img

HeLa-S3
Weissman
BRF1
ENCSR000DNW
r=-0.12

small heat map img
10,000 randomly-selected peaks from a total of 10,226 (download )

HepG2 - Iyer - ENCSR000DLR

HepG2
Iyer
MYC
ENCSR000DLR
r=1.00

small heat map img

HepG2
Iyer
MAX
ENCSR000BTM
r=0.81

small heat map img

HepG2
Iyer
MAX
ENCSR000EDS
r=0.79

small heat map img

HepG2
Iyer
MXI1
ENCSR000EDU
r=0.76

small heat map img

HepG2
Iyer
RCOR1
ENCSR000EDQ
r=0.62

small heat map img

HepG2
Iyer
NR2F2
ENCSR000BVM
r=0.60

small heat map img

HepG2
Iyer
EP300
ENCSR000EDV
r=0.60

small heat map img

HepG2
Iyer
ZEB1
ENCSR000BVN
r=0.59

small heat map img

HepG2
Iyer
POLR2A
ENCSR000DLQ
r=0.57

small heat map img

HepG2
Iyer
HNF4A
ENCSR000EEU
r=0.57

small heat map img

HepG2
Iyer
BHLHE40
ENCSR000EDT
r=0.56

small heat map img

HepG2
Iyer
TAF1
ENCSR000BJN
r=0.54

small heat map img

HepG2
Iyer
SREBF1
ENCSR000EEO
r=0.52

small heat map img

HepG2
Iyer
POLR2A
ENCSR000EEP
r=0.52

small heat map img

HepG2
Iyer
HDAC2
ENCSR000BMC
r=0.51

small heat map img

HepG2
Iyer
HSF1
ENCSR000EET
r=0.51

small heat map img

HepG2
Iyer
ESRRA
ENCSR000EEW
r=0.51

small heat map img

HepG2
Iyer
CREB1
ENCSR000BVL
r=0.49

small heat map img

HepG2
Iyer
POLR2A
ENCSR000BJM
r=0.49

small heat map img

HepG2
Iyer
FOSL2
ENCSR000BHP
r=0.47

small heat map img

HepG2
Iyer
BRCA1
ENCSR000EDY
r=0.47

small heat map img

HepG2
Iyer
ELF1
ENCSR000BMZ
r=0.47

small heat map img

HepG2
Iyer
MYBL2
ENCSR000BRO
r=0.46

small heat map img

HepG2
Iyer
YY1
ENCSR000BNT
r=0.46

small heat map img

HepG2
Iyer
ARID3A
ENCSR000EDP
r=0.45

small heat map img

HepG2
Iyer
HNF4G
ENCSR000BNJ
r=0.44

small heat map img

HepG2
Iyer
POLR2A
ENCSR000EEM
r=0.44

small heat map img

HepG2
Iyer
SP1
ENCSR000BJX
r=0.43

small heat map img

HepG2
Iyer
NFIC
ENCSR000BQX
r=0.43

small heat map img

HepG2
Iyer
JUND
ENCSR000BGK
r=0.43

small heat map img

HepG2
Iyer
TBP
ENCSR000EEL
r=0.42

small heat map img

HepG2
Iyer
CEBPB
ENCSR000EEX
r=0.41

small heat map img

HepG2
Iyer
TCF12
ENCSR000BJG
r=0.41

small heat map img

HepG2
Iyer
USF2
ENCSR000EEF
r=0.41

small heat map img

HepG2
Iyer
SIN3A
ENCSR000BGL
r=0.39

small heat map img

HepG2
Iyer
CEBPD
ENCSR000BQJ
r=0.38

small heat map img

HepG2
Iyer
RAD21
ENCSR000EEG
r=0.38

small heat map img

HepG2
Iyer
NR3C1
ENCSR000EEV
r=0.37

small heat map img

HepG2
Iyer
MAFF
ENCSR000EEC
r=0.37

small heat map img

HepG2
Iyer
USF1
ENCSR000BGM
r=0.37

small heat map img

HepG2
Iyer
MAFK
ENCSR000EDZ
r=0.36

small heat map img

HepG2
Iyer
NR2C2
ENCSR000EVS
r=0.36

small heat map img

HepG2
Iyer
JUND
ENCSR000EEI
r=0.36

small heat map img

HepG2
Iyer
SMC3
ENCSR000EDW
r=0.36

small heat map img

HepG2
Iyer
RAD21
ENCSR000BLS
r=0.36

small heat map img

HepG2
Iyer
EP300
ENCSR000BLW
r=0.35

small heat map img

HepG2
Iyer
MAFK
ENCSR000EEB
r=0.34

small heat map img

HepG2
Iyer
POLR2A
ENCSR000EZQ
r=0.33

small heat map img

HepG2
Iyer
HNF4A
ENCSR000BLF
r=0.33

small heat map img

HepG2
Iyer
CTCF
ENCSR000DLS
r=0.33

small heat map img

HepG2
Iyer
RFX5
ENCSR000EEA
r=0.31

small heat map img

HepG2
Iyer
MBD4
ENCSR000BQW
r=0.31

small heat map img

HepG2
Iyer
CEBPB
ENCSR000EEE
r=0.30

small heat map img

HepG2
Iyer
TEAD4
ENCSR000BRP
r=0.30

small heat map img

HepG2
Iyer
CTCF
ENCSR000DUG
r=0.30

small heat map img

HepG2
Iyer
CTCF
ENCSR000BIE
r=0.28

small heat map img

HepG2
Iyer
ATF3
ENCSR000BKE
r=0.28

small heat map img

HepG2
Iyer
CTCF
ENCSR000AMA
r=0.28

small heat map img

HepG2
Iyer
REST
ENCSR000BJL
r=0.27

small heat map img

HepG2
Iyer
ZBTB7A
ENCSR000BQA
r=0.26

small heat map img

HepG2
Iyer
REST
ENCSR000BOT
r=0.26

small heat map img

HepG2
Iyer
BHLHE40
ENCSR000BID
r=0.25

small heat map img

HepG2
Iyer
FOXA1
ENCSR000BMO
r=0.25

small heat map img

HepG2
Iyer
RXRA
ENCSR000BHU
r=0.24

small heat map img

HepG2
Iyer
FOXA1
ENCSR000BLE
r=0.24

small heat map img

HepG2
Iyer
GABPA
ENCSR000BJK
r=0.23

small heat map img

HepG2
Iyer
SREBF1
ENCSR000EZP
r=0.22

small heat map img

HepG2
Iyer
SREBF2
ENCSR000EZO
r=0.20

small heat map img

HepG2
Iyer
CEBPB
ENCSR000BQI
r=0.19

small heat map img

HepG2
Iyer
SRF
ENCSR000BLV
r=0.19

small heat map img

HepG2
Iyer
JUN
ENCSR000EEK
r=0.18

small heat map img

HepG2
Iyer
ZBTB33
ENCSR000BNA
r=0.17

small heat map img

HepG2
Iyer
ZBTB33
ENCSR000BHR
r=0.17

small heat map img

HepG2
Iyer
NRF1
ENCSR000EEH
r=0.15

small heat map img

HepG2
Iyer
IRF3
ENCSR000EEJ
r=0.13

small heat map img

HepG2
Iyer
SP2
ENCSR000BOU
r=0.11

small heat map img

HepG2
Iyer
EZH2
ENCSR000ARI
r=0.07

small heat map img

HepG2
Iyer
FOXA2
ENCSR000BNI
r=0.07

small heat map img

HepG2
Iyer
TCF7L2
ENCSR000EVQ
r=0.03

small heat map img

HepG2
Iyer
ZNF274
ENCSR000EVR
r=-0.17

small heat map img
4,413 peaks (download )

K562 - Iyer - ENCSR000DLZ

K562
Iyer
MYC
ENCSR000DLZ
r=1.00

small heat map img

K562
Iyer
MYC
ENCSR000EGJ
r=0.86

small heat map img

K562
Iyer
MYC
ENCSR000EGS
r=0.86

small heat map img

K562
Iyer
MAX
ENCSR000EFV
r=0.81

small heat map img

K562
Iyer
MYC
ENCSR000EZU
r=0.81

small heat map img

K562
Iyer
MYC
ENCSR000FAG
r=0.81

small heat map img

K562
Iyer
MYC
ENCSR000EZV
r=0.79

small heat map img

K562
Iyer
MYC
ENCSR000FAZ
r=0.78

small heat map img

K562
Iyer
MAX
ENCSR000BLP
r=0.73

small heat map img

K562
Iyer
MAX
ENCSR000FAE
r=0.68

small heat map img

K562
Iyer
MXI1
ENCSR000EGZ
r=0.65

small heat map img

K562
Iyer
POLR2A
ENCSR000DLY
r=0.64

small heat map img

K562
Iyer
E2F6
ENCSR000EWJ
r=0.62

small heat map img

K562
Iyer
JUN
ENCSR000EFS
r=0.61

small heat map img

K562
Iyer
HMGN3
ENCSR000DOB
r=0.60

small heat map img

K562
Iyer
E2F4
ENCSR000EWL
r=0.59

small heat map img

K562
Iyer
CCNT2
ENCSR000DOA
r=0.58

small heat map img

K562
Iyer
BHLHE40
ENCSR000EGV
r=0.56

small heat map img

K562
Iyer
TBL1XR1
ENCSR000EGA
r=0.55

small heat map img

K562
Iyer
RCOR1
ENCSR000EGG
r=0.55

small heat map img

K562
Iyer
IRF1
ENCSR000EGK
r=0.54

small heat map img

K562
Iyer
ZMIZ1
ENCSR000EFQ
r=0.54

small heat map img

K562
Iyer
POLR2A
ENCSR000FAW
r=0.53

small heat map img

K562
Iyer
IRF1
ENCSR000EGL
r=0.53

small heat map img

K562
Iyer
JUND
ENCSR000EGN
r=0.52

small heat map img

K562
Iyer
STAT2
ENCSR000FAT
r=0.52

small heat map img

K562
Iyer
JUN
ENCSR000EGH
r=0.52

small heat map img

K562
Iyer
POLR2A
ENCSR000FAY
r=0.51

small heat map img

K562
Iyer
POLR2A
ENCSR000FAJ
r=0.51

small heat map img

K562
Iyer
JUN
ENCSR000FAH
r=0.51

small heat map img

K562
Iyer
TBL1XR1
ENCSR000EGB
r=0.51

small heat map img

K562
Iyer
RBBP5
ENCSR000AQI
r=0.50

small heat map img

K562
Iyer
STAT1
ENCSR000EHJ
r=0.50

small heat map img

K562
Iyer
POLR2A
ENCSR000EHP
r=0.50

small heat map img

K562
Iyer
HDAC1
ENCSR000AQF
r=0.50

small heat map img

K562
Iyer
POLR2A
ENCSR000FAX
r=0.50

small heat map img

K562
Iyer
CBX3
ENCSR000BRT
r=0.50

small heat map img

K562
Iyer
SETDB1
ENCSR000AUT
r=0.49

small heat map img

K562
Iyer
KDM5B
ENCSR000AQA
r=0.49

small heat map img

K562
Iyer
HCFC1
ENCSR000EFN
r=0.49

small heat map img

K562
Iyer
IRF1
ENCSR000EGT
r=0.48

small heat map img

K562
Iyer
ELK1
ENCSR000EFU
r=0.48

small heat map img

K562
Iyer
POLR2A
ENCSR000BMR
r=0.48

small heat map img

K562
Iyer
PHF8
ENCSR000AQH
r=0.48

small heat map img

K562
Iyer
SAP30
ENCSR000AQJ
r=0.47

small heat map img

K562
Iyer
YY1
ENCSR000BKU
r=0.47

small heat map img

K562
Iyer
TRIM28
ENCSR000BRW
r=0.47

small heat map img

K562
Iyer
TAF1
ENCSR000BKS
r=0.47

small heat map img

K562
Iyer
CREB1
ENCSR000BSO
r=0.46

small heat map img

K562
Iyer
SETDB1
ENCSR000EWI
r=0.46

small heat map img

K562
Iyer
RCOR1
ENCSR000EGC
r=0.46

small heat map img

K562
Iyer
ELF1
ENCSR000BMD
r=0.45

small heat map img

K562
Iyer
ATF1
ENCSR000DNZ
r=0.45

small heat map img

K562
Iyer
SMC3
ENCSR000EGW
r=0.43

small heat map img

K562
Iyer
EP300
ENCSR000EGE
r=0.43

small heat map img

K562
Iyer
STAT1
ENCSR000EHK
r=0.43

small heat map img

K562
Iyer
GTF2B
ENCSR000DOE
r=0.43

small heat map img

K562
Iyer
HDAC2
ENCSR000AQG
r=0.42

small heat map img

K562
Iyer
TBP
ENCSR000EHA
r=0.42

small heat map img

K562
Iyer
E2F6
ENCSR000BLI
r=0.41

small heat map img

K562
Iyer
CEBPD
ENCSR000BVY
r=0.41

small heat map img

K562
Iyer
KAT2B
ENCSR000ATZ
r=0.41

small heat map img

K562
Iyer
STAT1
ENCSR000FAU
r=0.41

small heat map img

K562
Iyer
USF1
ENCSR000BKT
r=0.41

small heat map img

K562
Iyer
STAT1
ENCSR000FAV
r=0.41

small heat map img

K562
Iyer
CHD7
ENCSR000AVD
r=0.40

small heat map img

K562
Iyer
GATA1
ENCSR000EFT
r=0.40

small heat map img

K562
Iyer
ATF3
ENCSR000BNU
r=0.40

small heat map img

K562
Iyer
ETS1
ENCSR000BKQ
r=0.40

small heat map img

K562
Iyer
EGR1
ENCSR000BNE
r=0.40

small heat map img

K562
Iyer
STAT5A
ENCSR000BRR
r=0.39

small heat map img

K562
Iyer
STAT2
ENCSR000FBC
r=0.37

small heat map img

K562
Iyer
POLR2A
ENCSR000EHL
r=0.37

small heat map img

K562
Iyer
ARID3A
ENCSR000EFY
r=0.36

small heat map img

K562
Iyer
HDAC6
ENCSR000ATJ
r=0.36

small heat map img

K562
Iyer
YY1
ENCSR000EWF
r=0.36

small heat map img

K562
Iyer
NR2F2
ENCSR000BRS
r=0.35

small heat map img

K562
Iyer
PML
ENCSR000BQY
r=0.35

small heat map img

K562
Iyer
TEAD4
ENCSR000BRK
r=0.35

small heat map img

K562
Iyer
ZNF143
ENCSR000EGP
r=0.35

small heat map img

K562
Iyer
JUN
ENCSR000EZX
r=0.34

small heat map img

K562
Iyer
CTCF
ENCSR000EGM
r=0.34

small heat map img

K562
Iyer
ATF3
ENCSR000DOG
r=0.34

small heat map img

K562
Iyer
MAFK
ENCSR000EGX
r=0.34

small heat map img

K562
Iyer
GABPA
ENCSR000BLO
r=0.33

small heat map img

K562
Iyer
ZNF384
ENCSR000EFP
r=0.33

small heat map img

K562
Iyer
CTCF
ENCSR000DMA
r=0.32

small heat map img

K562
Iyer
REST
ENCSR000BMW
r=0.32

small heat map img

K562
Iyer
JUN
ENCSR000EZT
r=0.32

small heat map img

K562
Iyer
RNF2
ENCSR000AUA
r=0.32

small heat map img

K562
Iyer
EP300
ENCSR000EGY
r=0.31

small heat map img

K562
Iyer
HDAC2
ENCSR000BMG
r=0.31

small heat map img

K562
Iyer
ZNF263
ENCSR000EWN
r=0.31

small heat map img

K562
Iyer
NFE2
ENCSR000FAF
r=0.31

small heat map img

K562
Iyer
NCOR1
ENCSR000ATY
r=0.30

small heat map img

K562
Iyer
CTCF
ENCSR000BPJ
r=0.29

small heat map img

K562
Iyer
CTCF
ENCSR000DWE
r=0.29

small heat map img

K562
Iyer
CUX1
ENCSR000EFO
r=0.29

small heat map img

K562
Iyer
CEBPB
ENCSR000BRQ
r=0.29

small heat map img

K562
Iyer
CTCF
ENCSR000AKO
r=0.29

small heat map img

K562
Iyer
CTCFL
ENCSR000BNK
r=0.29

small heat map img

K562
Iyer
GATA1
ENCSR000EWM
r=0.28

small heat map img

K562
Iyer
SIN3A
ENCSR000BLR
r=0.28

small heat map img

K562
Iyer
NRF1
ENCSR000EHH
r=0.28

small heat map img

K562
Iyer
BACH1
ENCSR000EGD
r=0.28

small heat map img

K562
Iyer
IRF1
ENCSR000EGU
r=0.27

small heat map img

K562
Iyer
SIRT6
ENCSR000AUB
r=0.27

small heat map img

K562
Iyer
SRF
ENCSR000BLK
r=0.27

small heat map img

K562
Iyer
FOS
ENCSR000FAI
r=0.27

small heat map img

K562
Iyer
NFYA
ENCSR000EGR
r=0.27

small heat map img

K562
Iyer
GATA2
ENCSR000EWG
r=0.27

small heat map img

K562
Iyer
TAL1
ENCSR000EHB
r=0.27

small heat map img

K562
Iyer
RFX5
ENCSR000EGO
r=0.27

small heat map img

K562
Iyer
USF2
ENCSR000EHG
r=0.26

small heat map img

K562
Iyer
SIRT6
ENCSR000DOH
r=0.26

small heat map img

K562
Iyer
JUN
ENCSR000EZW
r=0.26

small heat map img

K562
Iyer
SMARCA4
ENCSR000EHO
r=0.26

small heat map img

K562
Iyer
CBX3
ENCSR000ATV
r=0.25

small heat map img

K562
Iyer
GTF3C2
ENCSR000DOD
r=0.25

small heat map img

K562
Iyer
ZBTB7A
ENCSR000BME
r=0.25

small heat map img

K562
Iyer
EP300
ENCSR000AQB
r=0.25

small heat map img

K562
Iyer
KDM1A
ENCSR000ATX
r=0.24

small heat map img

K562
Iyer
RAD21
ENCSR000FAD
r=0.24

small heat map img

K562
Iyer
WHSC1
ENCSR000AVE
r=0.24

small heat map img

K562
Iyer
YY1
ENCSR000BMH
r=0.23

small heat map img

K562
Iyer
SMARCB1
ENCSR000EHN
r=0.23

small heat map img

K562
Iyer
CEBPB
ENCSR000EHE
r=0.22

small heat map img

K562
Iyer
TAF7
ENCSR000BNM
r=0.22

small heat map img

K562
Iyer
THAP1
ENCSR000BNN
r=0.22

small heat map img

K562
Iyer
RAD21
ENCSR000BKV
r=0.22

small heat map img

K562
Iyer
SUZ12
ENCSR000AUC
r=0.21

small heat map img

K562
Iyer
GATA2
ENCSR000BKM
r=0.20

small heat map img

K562
Iyer
SP2
ENCSR000BNL
r=0.20

small heat map img

K562
Iyer
NFYB
ENCSR000EGQ
r=0.20

small heat map img

K562
Iyer
ZNF274
ENCSR000EVX
r=0.20

small heat map img

K562
Iyer
SPI1
ENCSR000BGW
r=0.19

small heat map img

K562
Iyer
SIX5
ENCSR000BGX
r=0.19

small heat map img

K562
Iyer
MAFF
ENCSR000EGI
r=0.18

small heat map img

K562
Iyer
UBTF
ENCSR000EFZ
r=0.18

small heat map img

K562
Iyer
SP1
ENCSR000BKO
r=0.18

small heat map img

K562
Iyer
TRIM28
ENCSR000EVY
r=0.18

small heat map img

K562
Iyer
CHD4
ENCSR000ATL
r=0.17

small heat map img

K562
Iyer
MEF2A
ENCSR000BNV
r=0.17

small heat map img

K562
Iyer
FOSL1
ENCSR000BMV
r=0.17

small heat map img

K562
Iyer
CHD1
ENCSR000AQD
r=0.17

small heat map img

K562
Iyer
CREBBP
ENCSR000ATT
r=0.16

small heat map img

K562
Iyer
SETDB1
ENCSR000EWD
r=0.14

small heat map img

K562
Iyer
UBTF
ENCSR000EFW
r=0.14

small heat map img

K562
Iyer
ZBTB33
ENCSR000BKF
r=0.14

small heat map img

K562
Iyer
BRF2
ENCSR000DOC
r=0.14

small heat map img

K562
Iyer
REST
ENCSR000ATM
r=0.13

small heat map img

K562
Iyer
XRCC4
ENCSR000FAC
r=0.13

small heat map img

K562
Iyer
SIX5
ENCSR000BNW
r=0.11

small heat map img

K562
Iyer
EZH2
ENCSR000AQE
r=0.11

small heat map img

K562
Iyer
POLR3A
ENCSR000DOI
r=0.06

small heat map img

K562
Iyer
NR2C2
ENCSR000EWH
r=0.06

small heat map img

K562
Iyer
CBX2
ENCSR000ATU
r=0.03

small heat map img

K562
Iyer
BRF1
ENCSR000DOJ
r=0.02

small heat map img

K562
Iyer
POLR3G
ENCSR000EHQ
r=0.01

small heat map img

K562
Iyer
CBX8
ENCSR000ATW
r=0.01

small heat map img

K562
Iyer
BDP1
ENCSR000DOK
r=0.01

small heat map img

K562
Iyer
ZNF274
ENCSR000EWE
r=-0.21

small heat map img
10,000 randomly-selected peaks from a total of 11,738 (download )

K562 - Snyder - ENCSR000EGJ

K562
Snyder
MYC
ENCSR000EGJ
r=1.00

small heat map img

K562
Snyder
MYC
ENCSR000EGS
r=0.93

small heat map img

K562
Snyder
MAX
ENCSR000EFV
r=0.91

small heat map img

K562
Snyder
MYC
ENCSR000EZU
r=0.87

small heat map img

K562
Snyder
MYC
ENCSR000FAG
r=0.87

small heat map img

K562
Snyder
MYC
ENCSR000DLZ
r=0.85

small heat map img

K562
Snyder
MYC
ENCSR000EZV
r=0.85

small heat map img

K562
Snyder
MYC
ENCSR000FAZ
r=0.83

small heat map img

K562
Snyder
MAX
ENCSR000BLP
r=0.75

small heat map img

K562
Snyder
MXI1
ENCSR000EGZ
r=0.75

small heat map img

K562
Snyder
MAX
ENCSR000FAE
r=0.72

small heat map img

K562
Snyder
JUN
ENCSR000EFS
r=0.71

small heat map img

K562
Snyder
E2F6
ENCSR000EWJ
r=0.70

small heat map img

K562
Snyder
IRF1
ENCSR000EGK
r=0.69

small heat map img

K562
Snyder
E2F4
ENCSR000EWL
r=0.68

small heat map img

K562
Snyder
POLR2A
ENCSR000DLY
r=0.67

small heat map img

K562
Snyder
HMGN3
ENCSR000DOB
r=0.67

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGA
r=0.67

small heat map img

K562
Snyder
IRF1
ENCSR000EGL
r=0.66

small heat map img

K562
Snyder
BHLHE40
ENCSR000EGV
r=0.66

small heat map img

K562
Snyder
CCNT2
ENCSR000DOA
r=0.66

small heat map img

K562
Snyder
ZMIZ1
ENCSR000EFQ
r=0.66

small heat map img

K562
Snyder
JUND
ENCSR000EGN
r=0.64

small heat map img

K562
Snyder
RCOR1
ENCSR000EGG
r=0.64

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGB
r=0.63

small heat map img

K562
Snyder
POLR2A
ENCSR000FAY
r=0.63

small heat map img

K562
Snyder
KDM5B
ENCSR000AQA
r=0.62

small heat map img

K562
Snyder
JUN
ENCSR000EGH
r=0.62

small heat map img

K562
Snyder
POLR2A
ENCSR000FAW
r=0.62

small heat map img

K562
Snyder
POLR2A
ENCSR000FAX
r=0.61

small heat map img

K562
Snyder
RBBP5
ENCSR000AQI
r=0.61

small heat map img

K562
Snyder
ELK1
ENCSR000EFU
r=0.61

small heat map img

K562
Snyder
STAT2
ENCSR000FAT
r=0.61

small heat map img

K562
Snyder
POLR2A
ENCSR000FAJ
r=0.60

small heat map img

K562
Snyder
HDAC1
ENCSR000AQF
r=0.60

small heat map img

K562
Snyder
STAT1
ENCSR000EHJ
r=0.60

small heat map img

K562
Snyder
SETDB1
ENCSR000AUT
r=0.60

small heat map img

K562
Snyder
JUN
ENCSR000FAH
r=0.59

small heat map img

K562
Snyder
POLR2A
ENCSR000EHP
r=0.58

small heat map img

K562
Snyder
RCOR1
ENCSR000EGC
r=0.58

small heat map img

K562
Snyder
HCFC1
ENCSR000EFN
r=0.58

small heat map img

K562
Snyder
PHF8
ENCSR000AQH
r=0.57

small heat map img

K562
Snyder
ATF1
ENCSR000DNZ
r=0.57

small heat map img

K562
Snyder
SAP30
ENCSR000AQJ
r=0.57

small heat map img

K562
Snyder
IRF1
ENCSR000EGT
r=0.57

small heat map img

K562
Snyder
CBX3
ENCSR000BRT
r=0.56

small heat map img

K562
Snyder
CREB1
ENCSR000BSO
r=0.56

small heat map img

K562
Snyder
POLR2A
ENCSR000BMR
r=0.56

small heat map img

K562
Snyder
TRIM28
ENCSR000BRW
r=0.55

small heat map img

K562
Snyder
TAF1
ENCSR000BKS
r=0.55

small heat map img

K562
Snyder
TBP
ENCSR000EHA
r=0.54

small heat map img

K562
Snyder
YY1
ENCSR000BKU
r=0.54

small heat map img

K562
Snyder
GTF2B
ENCSR000DOE
r=0.53

small heat map img

K562
Snyder
EP300
ENCSR000EGE
r=0.52

small heat map img

K562
Snyder
STAT1
ENCSR000EHK
r=0.51

small heat map img

K562
Snyder
SETDB1
ENCSR000EWI
r=0.51

small heat map img

K562
Snyder
CHD7
ENCSR000AVD
r=0.51

small heat map img

K562
Snyder
HDAC2
ENCSR000AQG
r=0.50

small heat map img

K562
Snyder
STAT1
ENCSR000FAU
r=0.50

small heat map img

K562
Snyder
KAT2B
ENCSR000ATZ
r=0.50

small heat map img

K562
Snyder
GATA1
ENCSR000EFT
r=0.49

small heat map img

K562
Snyder
POLR2A
ENCSR000EHL
r=0.49

small heat map img

K562
Snyder
ELF1
ENCSR000BMD
r=0.49

small heat map img

K562
Snyder
STAT1
ENCSR000FAV
r=0.49

small heat map img

K562
Snyder
ARID3A
ENCSR000EFY
r=0.48

small heat map img

K562
Snyder
CEBPD
ENCSR000BVY
r=0.48

small heat map img

K562
Snyder
STAT2
ENCSR000FBC
r=0.47

small heat map img

K562
Snyder
SMC3
ENCSR000EGW
r=0.47

small heat map img

K562
Snyder
HDAC6
ENCSR000ATJ
r=0.47

small heat map img

K562
Snyder
MAFK
ENCSR000EGX
r=0.46

small heat map img

K562
Snyder
ATF3
ENCSR000BNU
r=0.45

small heat map img

K562
Snyder
ZNF384
ENCSR000EFP
r=0.44

small heat map img

K562
Snyder
JUN
ENCSR000EZX
r=0.43

small heat map img

K562
Snyder
STAT5A
ENCSR000BRR
r=0.43

small heat map img

K562
Snyder
CUX1
ENCSR000EFO
r=0.43

small heat map img

K562
Snyder
ETS1
ENCSR000BKQ
r=0.43

small heat map img

K562
Snyder
USF1
ENCSR000BKT
r=0.43

small heat map img

K562
Snyder
EP300
ENCSR000EGY
r=0.43

small heat map img

K562
Snyder
EGR1
ENCSR000BNE
r=0.42

small heat map img

K562
Snyder
E2F6
ENCSR000BLI
r=0.42

small heat map img

K562
Snyder
ZNF143
ENCSR000EGP
r=0.42

small heat map img

K562
Snyder
NR2F2
ENCSR000BRS
r=0.42

small heat map img

K562
Snyder
YY1
ENCSR000EWF
r=0.42

small heat map img

K562
Snyder
JUN
ENCSR000EZT
r=0.41

small heat map img

K562
Snyder
PML
ENCSR000BQY
r=0.41

small heat map img

K562
Snyder
TEAD4
ENCSR000BRK
r=0.40

small heat map img

K562
Snyder
ATF3
ENCSR000DOG
r=0.39

small heat map img

K562
Snyder
REST
ENCSR000BMW
r=0.39

small heat map img

K562
Snyder
BACH1
ENCSR000EGD
r=0.39

small heat map img

K562
Snyder
ZNF263
ENCSR000EWN
r=0.39

small heat map img

K562
Snyder
EP300
ENCSR000AQB
r=0.38

small heat map img

K562
Snyder
NFYA
ENCSR000EGR
r=0.38

small heat map img

K562
Snyder
CEBPB
ENCSR000BRQ
r=0.37

small heat map img

K562
Snyder
SIRT6
ENCSR000AUB
r=0.37

small heat map img

K562
Snyder
FOS
ENCSR000FAI
r=0.37

small heat map img

K562
Snyder
NRF1
ENCSR000EHH
r=0.37

small heat map img

K562
Snyder
UBTF
ENCSR000EFZ
r=0.37

small heat map img

K562
Snyder
NFE2
ENCSR000FAF
r=0.37

small heat map img

K562
Snyder
SMARCA4
ENCSR000EHO
r=0.36

small heat map img

K562
Snyder
GABPA
ENCSR000BLO
r=0.36

small heat map img

K562
Snyder
WHSC1
ENCSR000AVE
r=0.36

small heat map img

K562
Snyder
JUN
ENCSR000EZW
r=0.36

small heat map img

K562
Snyder
IRF1
ENCSR000EGU
r=0.36

small heat map img

K562
Snyder
SIRT6
ENCSR000DOH
r=0.36

small heat map img

K562
Snyder
RNF2
ENCSR000AUA
r=0.36

small heat map img

K562
Snyder
NCOR1
ENCSR000ATY
r=0.36

small heat map img

K562
Snyder
CTCF
ENCSR000EGM
r=0.35

small heat map img

K562
Snyder
USF2
ENCSR000EHG
r=0.34

small heat map img

K562
Snyder
KDM1A
ENCSR000ATX
r=0.34

small heat map img

K562
Snyder
GATA1
ENCSR000EWM
r=0.34

small heat map img

K562
Snyder
SMARCB1
ENCSR000EHN
r=0.34

small heat map img

K562
Snyder
GTF3C2
ENCSR000DOD
r=0.33

small heat map img

K562
Snyder
RFX5
ENCSR000EGO
r=0.33

small heat map img

K562
Snyder
GATA2
ENCSR000EWG
r=0.33

small heat map img

K562
Snyder
CHD1
ENCSR000AQD
r=0.33

small heat map img

K562
Snyder
CBX3
ENCSR000ATV
r=0.32

small heat map img

K562
Snyder
HDAC2
ENCSR000BMG
r=0.32

small heat map img

K562
Snyder
CEBPB
ENCSR000EHE
r=0.32

small heat map img

K562
Snyder
UBTF
ENCSR000EFW
r=0.32

small heat map img

K562
Snyder
SRF
ENCSR000BLK
r=0.31

small heat map img

K562
Snyder
SIN3A
ENCSR000BLR
r=0.30

small heat map img

K562
Snyder
TAL1
ENCSR000EHB
r=0.30

small heat map img

K562
Snyder
TRIM28
ENCSR000EVY
r=0.29

small heat map img

K562
Snyder
MAFF
ENCSR000EGI
r=0.29

small heat map img

K562
Snyder
CTCF
ENCSR000AKO
r=0.29

small heat map img

K562
Snyder
CTCF
ENCSR000BPJ
r=0.28

small heat map img

K562
Snyder
RAD21
ENCSR000FAD
r=0.28

small heat map img

K562
Snyder
NFYB
ENCSR000EGQ
r=0.28

small heat map img

K562
Snyder
ZNF274
ENCSR000EVX
r=0.27

small heat map img

K562
Snyder
CTCF
ENCSR000DWE
r=0.27

small heat map img

K562
Snyder
ZBTB7A
ENCSR000BME
r=0.27

small heat map img

K562
Snyder
CTCFL
ENCSR000BNK
r=0.27

small heat map img

K562
Snyder
CTCF
ENCSR000DMA
r=0.27

small heat map img

K562
Snyder
THAP1
ENCSR000BNN
r=0.27

small heat map img

K562
Snyder
CHD4
ENCSR000ATL
r=0.25

small heat map img

K562
Snyder
SUZ12
ENCSR000AUC
r=0.25

small heat map img

K562
Snyder
YY1
ENCSR000BMH
r=0.25

small heat map img

K562
Snyder
TAF7
ENCSR000BNM
r=0.24

small heat map img

K562
Snyder
BRF2
ENCSR000DOC
r=0.24

small heat map img

K562
Snyder
SPI1
ENCSR000BGW
r=0.23

small heat map img

K562
Snyder
CREBBP
ENCSR000ATT
r=0.23

small heat map img

K562
Snyder
REST
ENCSR000ATM
r=0.23

small heat map img

K562
Snyder
SP1
ENCSR000BKO
r=0.23

small heat map img

K562
Snyder
GATA2
ENCSR000BKM
r=0.23

small heat map img

K562
Snyder
SP2
ENCSR000BNL
r=0.22

small heat map img

K562
Snyder
EZH2
ENCSR000AQE
r=0.21

small heat map img

K562
Snyder
FOSL1
ENCSR000BMV
r=0.21

small heat map img

K562
Snyder
MEF2A
ENCSR000BNV
r=0.20

small heat map img

K562
Snyder
XRCC4
ENCSR000FAC
r=0.20

small heat map img

K562
Snyder
RAD21
ENCSR000BKV
r=0.20

small heat map img

K562
Snyder
SETDB1
ENCSR000EWD
r=0.20

small heat map img

K562
Snyder
SIX5
ENCSR000BGX
r=0.19

small heat map img

K562
Snyder
ZBTB33
ENCSR000BKF
r=0.18

small heat map img

K562
Snyder
SIX5
ENCSR000BNW
r=0.15

small heat map img

K562
Snyder
NR2C2
ENCSR000EWH
r=0.11

small heat map img

K562
Snyder
BDP1
ENCSR000DOK
r=0.11

small heat map img

K562
Snyder
POLR3A
ENCSR000DOI
r=0.10

small heat map img

K562
Snyder
BRF1
ENCSR000DOJ
r=0.09

small heat map img

K562
Snyder
POLR3G
ENCSR000EHQ
r=0.07

small heat map img

K562
Snyder
CBX2
ENCSR000ATU
r=0.06

small heat map img

K562
Snyder
CBX8
ENCSR000ATW
r=0.03

small heat map img

K562
Snyder
ZNF274
ENCSR000EWE
r=-0.14

small heat map img
10,000 randomly-selected peaks from a total of 24,153 (download )

K562 - Snyder - ENCSR000EGS

K562
Snyder
MYC
ENCSR000EGS
r=1.00

small heat map img

K562
Snyder
MYC
ENCSR000EGJ
r=0.94

small heat map img

K562
Snyder
MYC
ENCSR000EZU
r=0.91

small heat map img

K562
Snyder
MAX
ENCSR000EFV
r=0.89

small heat map img

K562
Snyder
MYC
ENCSR000EZV
r=0.89

small heat map img

K562
Snyder
MYC
ENCSR000FAZ
r=0.87

small heat map img

K562
Snyder
MYC
ENCSR000FAG
r=0.86

small heat map img

K562
Snyder
MYC
ENCSR000DLZ
r=0.85

small heat map img

K562
Snyder
MXI1
ENCSR000EGZ
r=0.78

small heat map img

K562
Snyder
MAX
ENCSR000BLP
r=0.75

small heat map img

K562
Snyder
MAX
ENCSR000FAE
r=0.74

small heat map img

K562
Snyder
IRF1
ENCSR000EGK
r=0.73

small heat map img

K562
Snyder
JUN
ENCSR000EFS
r=0.72

small heat map img

K562
Snyder
IRF1
ENCSR000EGL
r=0.71

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGA
r=0.71

small heat map img

K562
Snyder
ZMIZ1
ENCSR000EFQ
r=0.70

small heat map img

K562
Snyder
BHLHE40
ENCSR000EGV
r=0.70

small heat map img

K562
Snyder
RCOR1
ENCSR000EGG
r=0.69

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGB
r=0.68

small heat map img

K562
Snyder
CCNT2
ENCSR000DOA
r=0.68

small heat map img

K562
Snyder
JUND
ENCSR000EGN
r=0.68

small heat map img

K562
Snyder
E2F4
ENCSR000EWL
r=0.68

small heat map img

K562
Snyder
E2F6
ENCSR000EWJ
r=0.68

small heat map img

K562
Snyder
JUN
ENCSR000EGH
r=0.67

small heat map img

K562
Snyder
HMGN3
ENCSR000DOB
r=0.67

small heat map img

K562
Snyder
STAT2
ENCSR000FAT
r=0.67

small heat map img

K562
Snyder
POLR2A
ENCSR000DLY
r=0.66

small heat map img

K562
Snyder
STAT1
ENCSR000EHJ
r=0.64

small heat map img

K562
Snyder
ATF1
ENCSR000DNZ
r=0.64

small heat map img

K562
Snyder
POLR2A
ENCSR000FAY
r=0.64

small heat map img

K562
Snyder
RCOR1
ENCSR000EGC
r=0.63

small heat map img

K562
Snyder
JUN
ENCSR000FAH
r=0.63

small heat map img

K562
Snyder
POLR2A
ENCSR000FAW
r=0.63

small heat map img

K562
Snyder
ELK1
ENCSR000EFU
r=0.63

small heat map img

K562
Snyder
POLR2A
ENCSR000FAX
r=0.63

small heat map img

K562
Snyder
IRF1
ENCSR000EGT
r=0.63

small heat map img

K562
Snyder
UBTF
ENCSR000EFZ
r=0.63

small heat map img

K562
Snyder
POLR2A
ENCSR000FAJ
r=0.61

small heat map img

K562
Snyder
KDM5B
ENCSR000AQA
r=0.61

small heat map img

K562
Snyder
POLR2A
ENCSR000EHP
r=0.60

small heat map img

K562
Snyder
SETDB1
ENCSR000AUT
r=0.60

small heat map img

K562
Snyder
CBX3
ENCSR000BRT
r=0.60

small heat map img

K562
Snyder
TRIM28
ENCSR000BRW
r=0.59

small heat map img

K562
Snyder
HCFC1
ENCSR000EFN
r=0.59

small heat map img

K562
Snyder
HDAC1
ENCSR000AQF
r=0.59

small heat map img

K562
Snyder
CREB1
ENCSR000BSO
r=0.59

small heat map img

K562
Snyder
EP300
ENCSR000EGE
r=0.58

small heat map img

K562
Snyder
RBBP5
ENCSR000AQI
r=0.58

small heat map img

K562
Snyder
UBTF
ENCSR000EFW
r=0.58

small heat map img

K562
Snyder
POLR2A
ENCSR000BMR
r=0.57

small heat map img

K562
Snyder
STAT1
ENCSR000FAU
r=0.57

small heat map img

K562
Snyder
STAT1
ENCSR000EHK
r=0.57

small heat map img

K562
Snyder
STAT1
ENCSR000FAV
r=0.56

small heat map img

K562
Snyder
TBP
ENCSR000EHA
r=0.55

small heat map img

K562
Snyder
SAP30
ENCSR000AQJ
r=0.55

small heat map img

K562
Snyder
GATA1
ENCSR000EFT
r=0.55

small heat map img

K562
Snyder
STAT2
ENCSR000FBC
r=0.53

small heat map img

K562
Snyder
ARID3A
ENCSR000EFY
r=0.53

small heat map img

K562
Snyder
GTF2B
ENCSR000DOE
r=0.53

small heat map img

K562
Snyder
POLR2A
ENCSR000EHL
r=0.53

small heat map img

K562
Snyder
CHD7
ENCSR000AVD
r=0.53

small heat map img

K562
Snyder
CEBPD
ENCSR000BVY
r=0.53

small heat map img

K562
Snyder
TAF1
ENCSR000BKS
r=0.52

small heat map img

K562
Snyder
YY1
ENCSR000BKU
r=0.52

small heat map img

K562
Snyder
PHF8
ENCSR000AQH
r=0.52

small heat map img

K562
Snyder
KAT2B
ENCSR000ATZ
r=0.50

small heat map img

K562
Snyder
HDAC2
ENCSR000AQG
r=0.50

small heat map img

K562
Snyder
SETDB1
ENCSR000EWI
r=0.50

small heat map img

K562
Snyder
ELF1
ENCSR000BMD
r=0.50

small heat map img

K562
Snyder
JUN
ENCSR000EZX
r=0.50

small heat map img

K562
Snyder
STAT5A
ENCSR000BRR
r=0.49

small heat map img

K562
Snyder
CUX1
ENCSR000EFO
r=0.48

small heat map img

K562
Snyder
JUN
ENCSR000EZT
r=0.48

small heat map img

K562
Snyder
EP300
ENCSR000EGY
r=0.48

small heat map img

K562
Snyder
SMC3
ENCSR000EGW
r=0.48

small heat map img

K562
Snyder
MAFK
ENCSR000EGX
r=0.48

small heat map img

K562
Snyder
TEAD4
ENCSR000BRK
r=0.47

small heat map img

K562
Snyder
NR2F2
ENCSR000BRS
r=0.47

small heat map img

K562
Snyder
ZNF384
ENCSR000EFP
r=0.46

small heat map img

K562
Snyder
HDAC6
ENCSR000ATJ
r=0.46

small heat map img

K562
Snyder
PML
ENCSR000BQY
r=0.46

small heat map img

K562
Snyder
ZNF143
ENCSR000EGP
r=0.45

small heat map img

K562
Snyder
USF1
ENCSR000BKT
r=0.45

small heat map img

K562
Snyder
EGR1
ENCSR000BNE
r=0.45

small heat map img

K562
Snyder
ATF3
ENCSR000BNU
r=0.44

small heat map img

K562
Snyder
EP300
ENCSR000AQB
r=0.44

small heat map img

K562
Snyder
FOS
ENCSR000FAI
r=0.43

small heat map img

K562
Snyder
ETS1
ENCSR000BKQ
r=0.43

small heat map img

K562
Snyder
IRF1
ENCSR000EGU
r=0.42

small heat map img

K562
Snyder
NFYA
ENCSR000EGR
r=0.42

small heat map img

K562
Snyder
JUN
ENCSR000EZW
r=0.42

small heat map img

K562
Snyder
BACH1
ENCSR000EGD
r=0.42

small heat map img

K562
Snyder
YY1
ENCSR000EWF
r=0.41

small heat map img

K562
Snyder
SMARCA4
ENCSR000EHO
r=0.41

small heat map img

K562
Snyder
SIRT6
ENCSR000DOH
r=0.41

small heat map img

K562
Snyder
CEBPB
ENCSR000BRQ
r=0.41

small heat map img

K562
Snyder
GATA2
ENCSR000EWG
r=0.41

small heat map img

K562
Snyder
NRF1
ENCSR000EHH
r=0.41

small heat map img

K562
Snyder
GABPA
ENCSR000BLO
r=0.40

small heat map img

K562
Snyder
E2F6
ENCSR000BLI
r=0.40

small heat map img

K562
Snyder
NFE2
ENCSR000FAF
r=0.40

small heat map img

K562
Snyder
ATF3
ENCSR000DOG
r=0.40

small heat map img

K562
Snyder
KDM1A
ENCSR000ATX
r=0.40

small heat map img

K562
Snyder
REST
ENCSR000BMW
r=0.39

small heat map img

K562
Snyder
GATA1
ENCSR000EWM
r=0.39

small heat map img

K562
Snyder
TAL1
ENCSR000EHB
r=0.39

small heat map img

K562
Snyder
SMARCB1
ENCSR000EHN
r=0.38

small heat map img

K562
Snyder
WHSC1
ENCSR000AVE
r=0.38

small heat map img

K562
Snyder
NCOR1
ENCSR000ATY
r=0.37

small heat map img

K562
Snyder
ZNF263
ENCSR000EWN
r=0.37

small heat map img

K562
Snyder
SIRT6
ENCSR000AUB
r=0.37

small heat map img

K562
Snyder
USF2
ENCSR000EHG
r=0.36

small heat map img

K562
Snyder
CTCF
ENCSR000EGM
r=0.36

small heat map img

K562
Snyder
RNF2
ENCSR000AUA
r=0.35

small heat map img

K562
Snyder
RFX5
ENCSR000EGO
r=0.35

small heat map img

K562
Snyder
HDAC2
ENCSR000BMG
r=0.34

small heat map img

K562
Snyder
MAFF
ENCSR000EGI
r=0.34

small heat map img

K562
Snyder
GTF3C2
ENCSR000DOD
r=0.34

small heat map img

K562
Snyder
CBX3
ENCSR000ATV
r=0.33

small heat map img

K562
Snyder
CHD1
ENCSR000AQD
r=0.33

small heat map img

K562
Snyder
TRIM28
ENCSR000EVY
r=0.32

small heat map img

K562
Snyder
CEBPB
ENCSR000EHE
r=0.32

small heat map img

K562
Snyder
RAD21
ENCSR000FAD
r=0.32

small heat map img

K562
Snyder
ZNF274
ENCSR000EVX
r=0.32

small heat map img

K562
Snyder
GATA2
ENCSR000BKM
r=0.31

small heat map img

K562
Snyder
SRF
ENCSR000BLK
r=0.31

small heat map img

K562
Snyder
NFYB
ENCSR000EGQ
r=0.30

small heat map img

K562
Snyder
CTCF
ENCSR000AKO
r=0.30

small heat map img

K562
Snyder
SIN3A
ENCSR000BLR
r=0.29

small heat map img

K562
Snyder
CTCF
ENCSR000BPJ
r=0.29

small heat map img

K562
Snyder
CTCF
ENCSR000DMA
r=0.28

small heat map img

K562
Snyder
CTCF
ENCSR000DWE
r=0.28

small heat map img

K562
Snyder
ZBTB7A
ENCSR000BME
r=0.27

small heat map img

K562
Snyder
CTCFL
ENCSR000BNK
r=0.26

small heat map img

K562
Snyder
EZH2
ENCSR000AQE
r=0.26

small heat map img

K562
Snyder
BRF2
ENCSR000DOC
r=0.26

small heat map img

K562
Snyder
CHD4
ENCSR000ATL
r=0.26

small heat map img

K562
Snyder
CREBBP
ENCSR000ATT
r=0.26

small heat map img

K562
Snyder
THAP1
ENCSR000BNN
r=0.26

small heat map img

K562
Snyder
SPI1
ENCSR000BGW
r=0.24

small heat map img

K562
Snyder
YY1
ENCSR000BMH
r=0.24

small heat map img

K562
Snyder
SP1
ENCSR000BKO
r=0.24

small heat map img

K562
Snyder
TAF7
ENCSR000BNM
r=0.24

small heat map img

K562
Snyder
SUZ12
ENCSR000AUC
r=0.24

small heat map img

K562
Snyder
FOSL1
ENCSR000BMV
r=0.23

small heat map img

K562
Snyder
MEF2A
ENCSR000BNV
r=0.23

small heat map img

K562
Snyder
RAD21
ENCSR000BKV
r=0.23

small heat map img

K562
Snyder
SP2
ENCSR000BNL
r=0.23

small heat map img

K562
Snyder
XRCC4
ENCSR000FAC
r=0.22

small heat map img

K562
Snyder
SETDB1
ENCSR000EWD
r=0.21

small heat map img

K562
Snyder
SIX5
ENCSR000BGX
r=0.20

small heat map img

K562
Snyder
REST
ENCSR000ATM
r=0.20

small heat map img

K562
Snyder
ZBTB33
ENCSR000BKF
r=0.18

small heat map img

K562
Snyder
SIX5
ENCSR000BNW
r=0.16

small heat map img

K562
Snyder
BDP1
ENCSR000DOK
r=0.14

small heat map img

K562
Snyder
NR2C2
ENCSR000EWH
r=0.11

small heat map img

K562
Snyder
POLR3A
ENCSR000DOI
r=0.11

small heat map img

K562
Snyder
BRF1
ENCSR000DOJ
r=0.11

small heat map img

K562
Snyder
POLR3G
ENCSR000EHQ
r=0.10

small heat map img

K562
Snyder
CBX2
ENCSR000ATU
r=0.06

small heat map img

K562
Snyder
CBX8
ENCSR000ATW
r=0.03

small heat map img

K562
Snyder
ZNF274
ENCSR000EWE
r=-0.12

small heat map img
10,000 randomly-selected peaks from a total of 31,092 (download )

K562 - Weissman - ENCSR000EZU

K562
Weissman
MYC
ENCSR000EZU
r=1.00

small heat map img

K562
Weissman
MYC
ENCSR000EZV
r=0.91

small heat map img

K562
Weissman
MYC
ENCSR000EGS
r=0.91

small heat map img

K562
Weissman
MYC
ENCSR000FAZ
r=0.89

small heat map img

K562
Weissman
MYC
ENCSR000EGJ
r=0.87

small heat map img

K562
Weissman
MYC
ENCSR000FAG
r=0.86

small heat map img

K562
Weissman
MAX
ENCSR000EFV
r=0.83

small heat map img

K562
Weissman
MYC
ENCSR000DLZ
r=0.80

small heat map img

K562
Weissman
MAX
ENCSR000FAE
r=0.75

small heat map img

K562
Weissman
MXI1
ENCSR000EGZ
r=0.75

small heat map img

K562
Weissman
MAX
ENCSR000BLP
r=0.74

small heat map img

K562
Weissman
JUN
ENCSR000EFS
r=0.71

small heat map img

K562
Weissman
IRF1
ENCSR000EGK
r=0.70

small heat map img

K562
Weissman
STAT2
ENCSR000FAT
r=0.68

small heat map img

K562
Weissman
IRF1
ENCSR000EGL
r=0.68

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGA
r=0.67

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGB
r=0.66

small heat map img

K562
Weissman
STAT1
ENCSR000EHJ
r=0.66

small heat map img

K562
Weissman
RCOR1
ENCSR000EGG
r=0.65

small heat map img

K562
Weissman
JUN
ENCSR000EGH
r=0.65

small heat map img

K562
Weissman
BHLHE40
ENCSR000EGV
r=0.65

small heat map img

K562
Weissman
IRF1
ENCSR000EGT
r=0.64

small heat map img

K562
Weissman
ZMIZ1
ENCSR000EFQ
r=0.64

small heat map img

K562
Weissman
JUND
ENCSR000EGN
r=0.64

small heat map img

K562
Weissman
ATF1
ENCSR000DNZ
r=0.62

small heat map img

K562
Weissman
JUN
ENCSR000FAH
r=0.62

small heat map img

K562
Weissman
E2F6
ENCSR000EWJ
r=0.62

small heat map img

K562
Weissman
E2F4
ENCSR000EWL
r=0.61

small heat map img

K562
Weissman
RCOR1
ENCSR000EGC
r=0.60

small heat map img

K562
Weissman
CBX3
ENCSR000BRT
r=0.60

small heat map img

K562
Weissman
TRIM28
ENCSR000BRW
r=0.60

small heat map img

K562
Weissman
STAT1
ENCSR000FAU
r=0.59

small heat map img

K562
Weissman
STAT1
ENCSR000FAV
r=0.59

small heat map img

K562
Weissman
POLR2A
ENCSR000DLY
r=0.59

small heat map img

K562
Weissman
POLR2A
ENCSR000FAY
r=0.59

small heat map img

K562
Weissman
POLR2A
ENCSR000FAX
r=0.59

small heat map img

K562
Weissman
STAT1
ENCSR000EHK
r=0.58

small heat map img

K562
Weissman
CCNT2
ENCSR000DOA
r=0.58

small heat map img

K562
Weissman
ELK1
ENCSR000EFU
r=0.58

small heat map img

K562
Weissman
SETDB1
ENCSR000AUT
r=0.58

small heat map img

K562
Weissman
POLR2A
ENCSR000FAW
r=0.57

small heat map img

K562
Weissman
HMGN3
ENCSR000DOB
r=0.57

small heat map img

K562
Weissman
EP300
ENCSR000EGE
r=0.56

small heat map img

K562
Weissman
STAT2
ENCSR000FBC
r=0.55

small heat map img

K562
Weissman
HDAC1
ENCSR000AQF
r=0.55

small heat map img

K562
Weissman
GATA1
ENCSR000EFT
r=0.55

small heat map img

K562
Weissman
CREB1
ENCSR000BSO
r=0.54

small heat map img

K562
Weissman
POLR2A
ENCSR000EHP
r=0.54

small heat map img

K562
Weissman
KDM5B
ENCSR000AQA
r=0.54

small heat map img

K562
Weissman
HCFC1
ENCSR000EFN
r=0.53

small heat map img

K562
Weissman
ARID3A
ENCSR000EFY
r=0.53

small heat map img

K562
Weissman
JUN
ENCSR000EZX
r=0.53

small heat map img

K562
Weissman
POLR2A
ENCSR000FAJ
r=0.52

small heat map img

K562
Weissman
POLR2A
ENCSR000EHL
r=0.52

small heat map img

K562
Weissman
JUN
ENCSR000EZT
r=0.52

small heat map img

K562
Weissman
CEBPD
ENCSR000BVY
r=0.52

small heat map img

K562
Weissman
RBBP5
ENCSR000AQI
r=0.51

small heat map img

K562
Weissman
GTF2B
ENCSR000DOE
r=0.51

small heat map img

K562
Weissman
SAP30
ENCSR000AQJ
r=0.51

small heat map img

K562
Weissman
STAT5A
ENCSR000BRR
r=0.51

small heat map img

K562
Weissman
CHD7
ENCSR000AVD
r=0.51

small heat map img

K562
Weissman
POLR2A
ENCSR000BMR
r=0.50

small heat map img

K562
Weissman
MAFK
ENCSR000EGX
r=0.49

small heat map img

K562
Weissman
NR2F2
ENCSR000BRS
r=0.49

small heat map img

K562
Weissman
EP300
ENCSR000EGY
r=0.49

small heat map img

K562
Weissman
TBP
ENCSR000EHA
r=0.49

small heat map img

K562
Weissman
KAT2B
ENCSR000ATZ
r=0.48

small heat map img

K562
Weissman
TEAD4
ENCSR000BRK
r=0.48

small heat map img

K562
Weissman
TAF1
ENCSR000BKS
r=0.48

small heat map img

K562
Weissman
CUX1
ENCSR000EFO
r=0.48

small heat map img

K562
Weissman
SMC3
ENCSR000EGW
r=0.48

small heat map img

K562
Weissman
SETDB1
ENCSR000EWI
r=0.48

small heat map img

K562
Weissman
UBTF
ENCSR000EFZ
r=0.48

small heat map img

K562
Weissman
HDAC2
ENCSR000AQG
r=0.47

small heat map img

K562
Weissman
IRF1
ENCSR000EGU
r=0.47

small heat map img

K562
Weissman
JUN
ENCSR000EZW
r=0.46

small heat map img

K562
Weissman
SIRT6
ENCSR000DOH
r=0.46

small heat map img

K562
Weissman
USF1
ENCSR000BKT
r=0.46

small heat map img

K562
Weissman
EP300
ENCSR000AQB
r=0.46

small heat map img

K562
Weissman
YY1
ENCSR000BKU
r=0.46

small heat map img

K562
Weissman
PML
ENCSR000BQY
r=0.45

small heat map img

K562
Weissman
HDAC6
ENCSR000ATJ
r=0.45

small heat map img

K562
Weissman
ZNF384
ENCSR000EFP
r=0.45

small heat map img

K562
Weissman
UBTF
ENCSR000EFW
r=0.44

small heat map img

K562
Weissman
PHF8
ENCSR000AQH
r=0.44

small heat map img

K562
Weissman
GATA2
ENCSR000EWG
r=0.44

small heat map img

K562
Weissman
REST
ENCSR000BMW
r=0.44

small heat map img

K562
Weissman
ATF3
ENCSR000BNU
r=0.43

small heat map img

K562
Weissman
CEBPB
ENCSR000BRQ
r=0.43

small heat map img

K562
Weissman
ELF1
ENCSR000BMD
r=0.42

small heat map img

K562
Weissman
GATA1
ENCSR000EWM
r=0.42

small heat map img

K562
Weissman
BACH1
ENCSR000EGD
r=0.42

small heat map img

K562
Weissman
ETS1
ENCSR000BKQ
r=0.41

small heat map img

K562
Weissman
ATF3
ENCSR000DOG
r=0.41

small heat map img

K562
Weissman
FOS
ENCSR000FAI
r=0.41

small heat map img

K562
Weissman
NFE2
ENCSR000FAF
r=0.41

small heat map img

K562
Weissman
ZNF143
ENCSR000EGP
r=0.41

small heat map img

K562
Weissman
USF2
ENCSR000EHG
r=0.40

small heat map img

K562
Weissman
SMARCA4
ENCSR000EHO
r=0.40

small heat map img

K562
Weissman
GABPA
ENCSR000BLO
r=0.39

small heat map img

K562
Weissman
EGR1
ENCSR000BNE
r=0.39

small heat map img

K562
Weissman
NRF1
ENCSR000EHH
r=0.39

small heat map img

K562
Weissman
KDM1A
ENCSR000ATX
r=0.38

small heat map img

K562
Weissman
YY1
ENCSR000EWF
r=0.38

small heat map img

K562
Weissman
NFYA
ENCSR000EGR
r=0.38

small heat map img

K562
Weissman
TAL1
ENCSR000EHB
r=0.38

small heat map img

K562
Weissman
E2F6
ENCSR000BLI
r=0.38

small heat map img

K562
Weissman
MAFF
ENCSR000EGI
r=0.37

small heat map img

K562
Weissman
SMARCB1
ENCSR000EHN
r=0.37

small heat map img

K562
Weissman
RFX5
ENCSR000EGO
r=0.36

small heat map img

K562
Weissman
RAD21
ENCSR000FAD
r=0.36

small heat map img

K562
Weissman
WHSC1
ENCSR000AVE
r=0.35

small heat map img

K562
Weissman
NCOR1
ENCSR000ATY
r=0.35

small heat map img

K562
Weissman
SIRT6
ENCSR000AUB
r=0.35

small heat map img

K562
Weissman
CTCF
ENCSR000EGM
r=0.35

small heat map img

K562
Weissman
GATA2
ENCSR000BKM
r=0.34

small heat map img

K562
Weissman
ZNF263
ENCSR000EWN
r=0.34

small heat map img

K562
Weissman
HDAC2
ENCSR000BMG
r=0.34

small heat map img

K562
Weissman
SRF
ENCSR000BLK
r=0.33

small heat map img

K562
Weissman
RNF2
ENCSR000AUA
r=0.33

small heat map img

K562
Weissman
GTF3C2
ENCSR000DOD
r=0.33

small heat map img

K562
Weissman
CBX3
ENCSR000ATV
r=0.32

small heat map img

K562
Weissman
TRIM28
ENCSR000EVY
r=0.32

small heat map img

K562
Weissman
CEBPB
ENCSR000EHE
r=0.31

small heat map img

K562
Weissman
ZNF274
ENCSR000EVX
r=0.31

small heat map img

K562
Weissman
SIN3A
ENCSR000BLR
r=0.31

small heat map img

K562
Weissman
EZH2
ENCSR000AQE
r=0.30

small heat map img

K562
Weissman
BRF2
ENCSR000DOC
r=0.30

small heat map img

K562
Weissman
CTCF
ENCSR000AKO
r=0.29

small heat map img

K562
Weissman
CHD1
ENCSR000AQD
r=0.28

small heat map img

K562
Weissman
CTCF
ENCSR000DMA
r=0.28

small heat map img

K562
Weissman
CTCF
ENCSR000BPJ
r=0.28

small heat map img

K562
Weissman
CREBBP
ENCSR000ATT
r=0.27

small heat map img

K562
Weissman
NFYB
ENCSR000EGQ
r=0.27

small heat map img

K562
Weissman
CTCF
ENCSR000DWE
r=0.27

small heat map img

K562
Weissman
XRCC4
ENCSR000FAC
r=0.26

small heat map img

K562
Weissman
SPI1
ENCSR000BGW
r=0.25

small heat map img

K562
Weissman
FOSL1
ENCSR000BMV
r=0.25

small heat map img

K562
Weissman
YY1
ENCSR000BMH
r=0.25

small heat map img

K562
Weissman
MEF2A
ENCSR000BNV
r=0.25

small heat map img

K562
Weissman
SP1
ENCSR000BKO
r=0.25

small heat map img

K562
Weissman
SETDB1
ENCSR000EWD
r=0.24

small heat map img

K562
Weissman
CTCFL
ENCSR000BNK
r=0.24

small heat map img

K562
Weissman
CHD4
ENCSR000ATL
r=0.24

small heat map img

K562
Weissman
RAD21
ENCSR000BKV
r=0.24

small heat map img

K562
Weissman
SUZ12
ENCSR000AUC
r=0.23

small heat map img

K562
Weissman
THAP1
ENCSR000BNN
r=0.23

small heat map img

K562
Weissman
TAF7
ENCSR000BNM
r=0.23

small heat map img

K562
Weissman
ZBTB7A
ENCSR000BME
r=0.22

small heat map img

K562
Weissman
REST
ENCSR000ATM
r=0.22

small heat map img

K562
Weissman
SP2
ENCSR000BNL
r=0.22

small heat map img

K562
Weissman
SIX5
ENCSR000BGX
r=0.21

small heat map img

K562
Weissman
ZBTB33
ENCSR000BKF
r=0.20

small heat map img

K562
Weissman
BDP1
ENCSR000DOK
r=0.19

small heat map img

K562
Weissman
SIX5
ENCSR000BNW
r=0.17

small heat map img

K562
Weissman
NR2C2
ENCSR000EWH
r=0.15

small heat map img

K562
Weissman
POLR3G
ENCSR000EHQ
r=0.14

small heat map img

K562
Weissman
BRF1
ENCSR000DOJ
r=0.13

small heat map img

K562
Weissman
POLR3A
ENCSR000DOI
r=0.13

small heat map img

K562
Weissman
CBX2
ENCSR000ATU
r=0.07

small heat map img

K562
Weissman
CBX8
ENCSR000ATW
r=0.04

small heat map img

K562
Weissman
ZNF274
ENCSR000EWE
r=-0.07

small heat map img
10,000 randomly-selected peaks from a total of 19,290 (download )

K562 - Weissman - ENCSR000EZV

K562
Weissman
MYC
ENCSR000EZV
r=1.00

small heat map img

K562
Weissman
MYC
ENCSR000EZU
r=0.93

small heat map img

K562
Weissman
MYC
ENCSR000FAZ
r=0.91

small heat map img

K562
Weissman
MYC
ENCSR000EGS
r=0.91

small heat map img

K562
Weissman
MYC
ENCSR000FAG
r=0.88

small heat map img

K562
Weissman
MYC
ENCSR000EGJ
r=0.87

small heat map img

K562
Weissman
MAX
ENCSR000EFV
r=0.83

small heat map img

K562
Weissman
MYC
ENCSR000DLZ
r=0.80

small heat map img

K562
Weissman
MAX
ENCSR000FAE
r=0.77

small heat map img

K562
Weissman
MAX
ENCSR000BLP
r=0.76

small heat map img

K562
Weissman
MXI1
ENCSR000EGZ
r=0.75

small heat map img

K562
Weissman
JUN
ENCSR000EFS
r=0.74

small heat map img

K562
Weissman
IRF1
ENCSR000EGK
r=0.70

small heat map img

K562
Weissman
IRF1
ENCSR000EGL
r=0.69

small heat map img

K562
Weissman
STAT2
ENCSR000FAT
r=0.69

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGB
r=0.68

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGA
r=0.67

small heat map img

K562
Weissman
RCOR1
ENCSR000EGG
r=0.67

small heat map img

K562
Weissman
JUN
ENCSR000EGH
r=0.66

small heat map img

K562
Weissman
STAT1
ENCSR000EHJ
r=0.66

small heat map img

K562
Weissman
ZMIZ1
ENCSR000EFQ
r=0.65

small heat map img

K562
Weissman
JUND
ENCSR000EGN
r=0.65

small heat map img

K562
Weissman
JUN
ENCSR000FAH
r=0.63

small heat map img

K562
Weissman
BHLHE40
ENCSR000EGV
r=0.63

small heat map img

K562
Weissman
ATF1
ENCSR000DNZ
r=0.63

small heat map img

K562
Weissman
E2F6
ENCSR000EWJ
r=0.62

small heat map img

K562
Weissman
CBX3
ENCSR000BRT
r=0.62

small heat map img

K562
Weissman
RCOR1
ENCSR000EGC
r=0.62

small heat map img

K562
Weissman
TRIM28
ENCSR000BRW
r=0.61

small heat map img

K562
Weissman
STAT1
ENCSR000FAV
r=0.61

small heat map img

K562
Weissman
E2F4
ENCSR000EWL
r=0.61

small heat map img

K562
Weissman
STAT1
ENCSR000FAU
r=0.60

small heat map img

K562
Weissman
SETDB1
ENCSR000AUT
r=0.60

small heat map img

K562
Weissman
STAT1
ENCSR000EHK
r=0.59

small heat map img

K562
Weissman
ELK1
ENCSR000EFU
r=0.59

small heat map img

K562
Weissman
IRF1
ENCSR000EGT
r=0.59

small heat map img

K562
Weissman
CCNT2
ENCSR000DOA
r=0.58

small heat map img

K562
Weissman
POLR2A
ENCSR000FAY
r=0.58

small heat map img

K562
Weissman
POLR2A
ENCSR000FAX
r=0.58

small heat map img

K562
Weissman
EP300
ENCSR000EGE
r=0.57

small heat map img

K562
Weissman
POLR2A
ENCSR000DLY
r=0.57

small heat map img

K562
Weissman
HMGN3
ENCSR000DOB
r=0.57

small heat map img

K562
Weissman
GATA1
ENCSR000EFT
r=0.56

small heat map img

K562
Weissman
POLR2A
ENCSR000FAW
r=0.56

small heat map img

K562
Weissman
JUN
ENCSR000EZX
r=0.55

small heat map img

K562
Weissman
ARID3A
ENCSR000EFY
r=0.55

small heat map img

K562
Weissman
STAT2
ENCSR000FBC
r=0.55

small heat map img

K562
Weissman
POLR2A
ENCSR000EHP
r=0.54

small heat map img

K562
Weissman
HDAC1
ENCSR000AQF
r=0.54

small heat map img

K562
Weissman
JUN
ENCSR000EZT
r=0.54

small heat map img

K562
Weissman
CEBPD
ENCSR000BVY
r=0.53

small heat map img

K562
Weissman
CREB1
ENCSR000BSO
r=0.53

small heat map img

K562
Weissman
STAT5A
ENCSR000BRR
r=0.53

small heat map img

K562
Weissman
POLR2A
ENCSR000FAJ
r=0.52

small heat map img

K562
Weissman
KDM5B
ENCSR000AQA
r=0.52

small heat map img

K562
Weissman
HCFC1
ENCSR000EFN
r=0.52

small heat map img

K562
Weissman
GTF2B
ENCSR000DOE
r=0.52

small heat map img

K562
Weissman
EP300
ENCSR000EGY
r=0.52

small heat map img

K562
Weissman
POLR2A
ENCSR000EHL
r=0.51

small heat map img

K562
Weissman
CHD7
ENCSR000AVD
r=0.51

small heat map img

K562
Weissman
SMC3
ENCSR000EGW
r=0.51

small heat map img

K562
Weissman
NR2F2
ENCSR000BRS
r=0.51

small heat map img

K562
Weissman
CUX1
ENCSR000EFO
r=0.50

small heat map img

K562
Weissman
KAT2B
ENCSR000ATZ
r=0.50

small heat map img

K562
Weissman
POLR2A
ENCSR000BMR
r=0.50

small heat map img

K562
Weissman
TEAD4
ENCSR000BRK
r=0.50

small heat map img

K562
Weissman
SETDB1
ENCSR000EWI
r=0.49

small heat map img

K562
Weissman
SAP30
ENCSR000AQJ
r=0.49

small heat map img

K562
Weissman
IRF1
ENCSR000EGU
r=0.49

small heat map img

K562
Weissman
TBP
ENCSR000EHA
r=0.49

small heat map img

K562
Weissman
RBBP5
ENCSR000AQI
r=0.48

small heat map img

K562
Weissman
SIRT6
ENCSR000DOH
r=0.48

small heat map img

K562
Weissman
JUN
ENCSR000EZW
r=0.48

small heat map img

K562
Weissman
EP300
ENCSR000AQB
r=0.48

small heat map img

K562
Weissman
HDAC2
ENCSR000AQG
r=0.48

small heat map img

K562
Weissman
USF1
ENCSR000BKT
r=0.48

small heat map img

K562
Weissman
TAF1
ENCSR000BKS
r=0.47

small heat map img

K562
Weissman
PML
ENCSR000BQY
r=0.47

small heat map img

K562
Weissman
MAFK
ENCSR000EGX
r=0.47

small heat map img

K562
Weissman
UBTF
ENCSR000EFZ
r=0.46

small heat map img

K562
Weissman
HDAC6
ENCSR000ATJ
r=0.46

small heat map img

K562
Weissman
ATF3
ENCSR000BNU
r=0.45

small heat map img

K562
Weissman
GATA2
ENCSR000EWG
r=0.45

small heat map img

K562
Weissman
YY1
ENCSR000BKU
r=0.44

small heat map img

K562
Weissman
ZNF384
ENCSR000EFP
r=0.44

small heat map img

K562
Weissman
CEBPB
ENCSR000BRQ
r=0.44

small heat map img

K562
Weissman
GATA1
ENCSR000EWM
r=0.44

small heat map img

K562
Weissman
REST
ENCSR000BMW
r=0.44

small heat map img

K562
Weissman
ATF3
ENCSR000DOG
r=0.43

small heat map img

K562
Weissman
UBTF
ENCSR000EFW
r=0.43

small heat map img

K562
Weissman
NFE2
ENCSR000FAF
r=0.43

small heat map img

K562
Weissman
ELF1
ENCSR000BMD
r=0.42

small heat map img

K562
Weissman
USF2
ENCSR000EHG
r=0.42

small heat map img

K562
Weissman
ETS1
ENCSR000BKQ
r=0.42

small heat map img

K562
Weissman
BACH1
ENCSR000EGD
r=0.41

small heat map img

K562
Weissman
PHF8
ENCSR000AQH
r=0.41

small heat map img

K562
Weissman
GABPA
ENCSR000BLO
r=0.40

small heat map img

K562
Weissman
SMARCA4
ENCSR000EHO
r=0.40

small heat map img

K562
Weissman
FOS
ENCSR000FAI
r=0.40

small heat map img

K562
Weissman
ZNF143
ENCSR000EGP
r=0.40

small heat map img

K562
Weissman
KDM1A
ENCSR000ATX
r=0.40

small heat map img

K562
Weissman
E2F6
ENCSR000BLI
r=0.39

small heat map img

K562
Weissman
NRF1
ENCSR000EHH
r=0.39

small heat map img

K562
Weissman
TAL1
ENCSR000EHB
r=0.38

small heat map img

K562
Weissman
EGR1
ENCSR000BNE
r=0.38

small heat map img

K562
Weissman
NFYA
ENCSR000EGR
r=0.38

small heat map img

K562
Weissman
RAD21
ENCSR000FAD
r=0.38

small heat map img

K562
Weissman
CTCF
ENCSR000EGM
r=0.37

small heat map img

K562
Weissman
MAFF
ENCSR000EGI
r=0.37

small heat map img

K562
Weissman
WHSC1
ENCSR000AVE
r=0.37

small heat map img

K562
Weissman
YY1
ENCSR000EWF
r=0.37

small heat map img

K562
Weissman
SMARCB1
ENCSR000EHN
r=0.36

small heat map img

K562
Weissman
NCOR1
ENCSR000ATY
r=0.36

small heat map img

K562
Weissman
GATA2
ENCSR000BKM
r=0.36

small heat map img

K562
Weissman
RFX5
ENCSR000EGO
r=0.36

small heat map img

K562
Weissman
HDAC2
ENCSR000BMG
r=0.35

small heat map img

K562
Weissman
CBX3
ENCSR000ATV
r=0.35

small heat map img

K562
Weissman
SRF
ENCSR000BLK
r=0.35

small heat map img

K562
Weissman
ZNF263
ENCSR000EWN
r=0.34

small heat map img

K562
Weissman
RNF2
ENCSR000AUA
r=0.34

small heat map img

K562
Weissman
TRIM28
ENCSR000EVY
r=0.33

small heat map img

K562
Weissman
SIRT6
ENCSR000AUB
r=0.33

small heat map img

K562
Weissman
EZH2
ENCSR000AQE
r=0.33

small heat map img

K562
Weissman
ZNF274
ENCSR000EVX
r=0.33

small heat map img

K562
Weissman
CEBPB
ENCSR000EHE
r=0.32

small heat map img

K562
Weissman
SIN3A
ENCSR000BLR
r=0.32

small heat map img

K562
Weissman
GTF3C2
ENCSR000DOD
r=0.31

small heat map img

K562
Weissman
CTCF
ENCSR000AKO
r=0.31

small heat map img

K562
Weissman
BRF2
ENCSR000DOC
r=0.31

small heat map img

K562
Weissman
CTCF
ENCSR000DMA
r=0.30

small heat map img

K562
Weissman
CREBBP
ENCSR000ATT
r=0.29

small heat map img

K562
Weissman
CTCF
ENCSR000DWE
r=0.28

small heat map img

K562
Weissman
CTCF
ENCSR000BPJ
r=0.28

small heat map img

K562
Weissman
SETDB1
ENCSR000EWD
r=0.27

small heat map img

K562
Weissman
XRCC4
ENCSR000FAC
r=0.27

small heat map img

K562
Weissman
NFYB
ENCSR000EGQ
r=0.27

small heat map img

K562
Weissman
SPI1
ENCSR000BGW
r=0.27

small heat map img

K562
Weissman
FOSL1
ENCSR000BMV
r=0.26

small heat map img

K562
Weissman
MEF2A
ENCSR000BNV
r=0.26

small heat map img

K562
Weissman
YY1
ENCSR000BMH
r=0.26

small heat map img

K562
Weissman
SP1
ENCSR000BKO
r=0.25

small heat map img

K562
Weissman
CTCFL
ENCSR000BNK
r=0.25

small heat map img

K562
Weissman
RAD21
ENCSR000BKV
r=0.25

small heat map img

K562
Weissman
SUZ12
ENCSR000AUC
r=0.24

small heat map img

K562
Weissman
TAF7
ENCSR000BNM
r=0.24

small heat map img

K562
Weissman
THAP1
ENCSR000BNN
r=0.23

small heat map img

K562
Weissman
CHD4
ENCSR000ATL
r=0.23

small heat map img

K562
Weissman
SP2
ENCSR000BNL
r=0.23

small heat map img

K562
Weissman
ZBTB7A
ENCSR000BME
r=0.22

small heat map img

K562
Weissman
CHD1
ENCSR000AQD
r=0.22

small heat map img

K562
Weissman
SIX5
ENCSR000BGX
r=0.22

small heat map img

K562
Weissman
REST
ENCSR000ATM
r=0.22

small heat map img

K562
Weissman
ZBTB33
ENCSR000BKF
r=0.20

small heat map img

K562
Weissman
BDP1
ENCSR000DOK
r=0.19

small heat map img

K562
Weissman
SIX5
ENCSR000BNW
r=0.17

small heat map img

K562
Weissman
NR2C2
ENCSR000EWH
r=0.16

small heat map img

K562
Weissman
POLR3G
ENCSR000EHQ
r=0.14

small heat map img

K562
Weissman
BRF1
ENCSR000DOJ
r=0.13

small heat map img

K562
Weissman
POLR3A
ENCSR000DOI
r=0.12

small heat map img

K562
Weissman
CBX2
ENCSR000ATU
r=0.09

small heat map img

K562
Weissman
CBX8
ENCSR000ATW
r=0.07

small heat map img

K562
Weissman
ZNF274
ENCSR000EWE
r=-0.07

small heat map img
10,000 randomly-selected peaks from a total of 10,583 (download )

K562 - Weissman - ENCSR000FAG

K562
Weissman
MYC
ENCSR000FAG
r=1.00

small heat map img

K562
Weissman
MYC
ENCSR000EGJ
r=0.90

small heat map img

K562
Weissman
MYC
ENCSR000EZU
r=0.90

small heat map img

K562
Weissman
MYC
ENCSR000EZV
r=0.90

small heat map img

K562
Weissman
MYC
ENCSR000EGS
r=0.90

small heat map img

K562
Weissman
MYC
ENCSR000FAZ
r=0.89

small heat map img

K562
Weissman
MAX
ENCSR000EFV
r=0.86

small heat map img

K562
Weissman
MYC
ENCSR000DLZ
r=0.83

small heat map img

K562
Weissman
MAX
ENCSR000BLP
r=0.82

small heat map img

K562
Weissman
MAX
ENCSR000FAE
r=0.79

small heat map img

K562
Weissman
JUN
ENCSR000EFS
r=0.75

small heat map img

K562
Weissman
MXI1
ENCSR000EGZ
r=0.73

small heat map img

K562
Weissman
E2F6
ENCSR000EWJ
r=0.66

small heat map img

K562
Weissman
E2F4
ENCSR000EWL
r=0.66

small heat map img

K562
Weissman
STAT2
ENCSR000FAT
r=0.65

small heat map img

K562
Weissman
IRF1
ENCSR000EGK
r=0.65

small heat map img

K562
Weissman
JUN
ENCSR000FAH
r=0.65

small heat map img

K562
Weissman
IRF1
ENCSR000EGL
r=0.64

small heat map img

K562
Weissman
RCOR1
ENCSR000EGG
r=0.63

small heat map img

K562
Weissman
JUND
ENCSR000EGN
r=0.63

small heat map img

K562
Weissman
STAT1
ENCSR000EHJ
r=0.63

small heat map img

K562
Weissman
JUN
ENCSR000EGH
r=0.63

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGA
r=0.62

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGB
r=0.62

small heat map img

K562
Weissman
CBX3
ENCSR000BRT
r=0.62

small heat map img

K562
Weissman
ZMIZ1
ENCSR000EFQ
r=0.61

small heat map img

K562
Weissman
CCNT2
ENCSR000DOA
r=0.61

small heat map img

K562
Weissman
HMGN3
ENCSR000DOB
r=0.61

small heat map img

K562
Weissman
BHLHE40
ENCSR000EGV
r=0.61

small heat map img

K562
Weissman
SETDB1
ENCSR000AUT
r=0.60

small heat map img

K562
Weissman
POLR2A
ENCSR000DLY
r=0.59

small heat map img

K562
Weissman
ATF1
ENCSR000DNZ
r=0.58

small heat map img

K562
Weissman
TRIM28
ENCSR000BRW
r=0.58

small heat map img

K562
Weissman
ELK1
ENCSR000EFU
r=0.57

small heat map img

K562
Weissman
POLR2A
ENCSR000FAY
r=0.57

small heat map img

K562
Weissman
POLR2A
ENCSR000FAW
r=0.56

small heat map img

K562
Weissman
IRF1
ENCSR000EGT
r=0.56

small heat map img

K562
Weissman
STAT1
ENCSR000EHK
r=0.56

small heat map img

K562
Weissman
POLR2A
ENCSR000FAX
r=0.56

small heat map img

K562
Weissman
STAT1
ENCSR000FAU
r=0.56

small heat map img

K562
Weissman
STAT1
ENCSR000FAV
r=0.55

small heat map img

K562
Weissman
POLR2A
ENCSR000FAJ
r=0.55

small heat map img

K562
Weissman
RCOR1
ENCSR000EGC
r=0.55

small heat map img

K562
Weissman
CREB1
ENCSR000BSO
r=0.55

small heat map img

K562
Weissman
POLR2A
ENCSR000EHP
r=0.55

small heat map img

K562
Weissman
HCFC1
ENCSR000EFN
r=0.54

small heat map img

K562
Weissman
GTF2B
ENCSR000DOE
r=0.53

small heat map img

K562
Weissman
UBTF
ENCSR000EFZ
r=0.53

small heat map img

K562
Weissman
SETDB1
ENCSR000EWI
r=0.52

small heat map img

K562
Weissman
KDM5B
ENCSR000AQA
r=0.52

small heat map img

K562
Weissman
EP300
ENCSR000EGE
r=0.52

small heat map img

K562
Weissman
STAT2
ENCSR000FBC
r=0.52

small heat map img

K562
Weissman
HDAC1
ENCSR000AQF
r=0.52

small heat map img

K562
Weissman
POLR2A
ENCSR000BMR
r=0.51

small heat map img

K562
Weissman
GATA1
ENCSR000EFT
r=0.51

small heat map img

K562
Weissman
TAF1
ENCSR000BKS
r=0.51

small heat map img

K562
Weissman
ATF3
ENCSR000BNU
r=0.51

small heat map img

K562
Weissman
USF1
ENCSR000BKT
r=0.51

small heat map img

K562
Weissman
CEBPD
ENCSR000BVY
r=0.50

small heat map img

K562
Weissman
YY1
ENCSR000BKU
r=0.50

small heat map img

K562
Weissman
STAT5A
ENCSR000BRR
r=0.50

small heat map img

K562
Weissman
TBP
ENCSR000EHA
r=0.50

small heat map img

K562
Weissman
KAT2B
ENCSR000ATZ
r=0.50

small heat map img

K562
Weissman
SMC3
ENCSR000EGW
r=0.50

small heat map img

K562
Weissman
JUN
ENCSR000EZX
r=0.49

small heat map img

K562
Weissman
CHD7
ENCSR000AVD
r=0.49

small heat map img

K562
Weissman
ARID3A
ENCSR000EFY
r=0.48

small heat map img

K562
Weissman
RBBP5
ENCSR000AQI
r=0.48

small heat map img

K562
Weissman
ELF1
ENCSR000BMD
r=0.48

small heat map img

K562
Weissman
SAP30
ENCSR000AQJ
r=0.48

small heat map img

K562
Weissman
UBTF
ENCSR000EFW
r=0.47

small heat map img

K562
Weissman
JUN
ENCSR000EZT
r=0.47

small heat map img

K562
Weissman
NR2F2
ENCSR000BRS
r=0.46

small heat map img

K562
Weissman
MAFK
ENCSR000EGX
r=0.46

small heat map img

K562
Weissman
ETS1
ENCSR000BKQ
r=0.46

small heat map img

K562
Weissman
HDAC2
ENCSR000AQG
r=0.46

small heat map img

K562
Weissman
ATF3
ENCSR000DOG
r=0.46

small heat map img

K562
Weissman
HDAC6
ENCSR000ATJ
r=0.45

small heat map img

K562
Weissman
TEAD4
ENCSR000BRK
r=0.45

small heat map img

K562
Weissman
PML
ENCSR000BQY
r=0.45

small heat map img

K562
Weissman
EP300
ENCSR000EGY
r=0.44

small heat map img

K562
Weissman
E2F6
ENCSR000BLI
r=0.44

small heat map img

K562
Weissman
REST
ENCSR000BMW
r=0.44

small heat map img

K562
Weissman
POLR2A
ENCSR000EHL
r=0.44

small heat map img

K562
Weissman
NFE2
ENCSR000FAF
r=0.42

small heat map img

K562
Weissman
CUX1
ENCSR000EFO
r=0.42

small heat map img

K562
Weissman
CEBPB
ENCSR000BRQ
r=0.42

small heat map img

K562
Weissman
PHF8
ENCSR000AQH
r=0.42

small heat map img

K562
Weissman
SIRT6
ENCSR000DOH
r=0.41

small heat map img

K562
Weissman
JUN
ENCSR000EZW
r=0.41

small heat map img

K562
Weissman
IRF1
ENCSR000EGU
r=0.41

small heat map img

K562
Weissman
EGR1
ENCSR000BNE
r=0.41

small heat map img

K562
Weissman
EP300
ENCSR000AQB
r=0.41

small heat map img

K562
Weissman
GABPA
ENCSR000BLO
r=0.40

small heat map img

K562
Weissman
ZNF384
ENCSR000EFP
r=0.40

small heat map img

K562
Weissman
USF2
ENCSR000EHG
r=0.40

small heat map img

K562
Weissman
YY1
ENCSR000EWF
r=0.40

small heat map img

K562
Weissman
FOS
ENCSR000FAI
r=0.40

small heat map img

K562
Weissman
GATA1
ENCSR000EWM
r=0.40

small heat map img

K562
Weissman
ZNF143
ENCSR000EGP
r=0.39

small heat map img

K562
Weissman
NRF1
ENCSR000EHH
r=0.38

small heat map img

K562
Weissman
CTCF
ENCSR000EGM
r=0.38

small heat map img

K562
Weissman
GATA2
ENCSR000EWG
r=0.37

small heat map img

K562
Weissman
SRF
ENCSR000BLK
r=0.37

small heat map img

K562
Weissman
ZNF263
ENCSR000EWN
r=0.37

small heat map img

K562
Weissman
NFYA
ENCSR000EGR
r=0.36

small heat map img

K562
Weissman
RFX5
ENCSR000EGO
r=0.36

small heat map img

K562
Weissman
HDAC2
ENCSR000BMG
r=0.36

small heat map img

K562
Weissman
BACH1
ENCSR000EGD
r=0.35

small heat map img

K562
Weissman
WHSC1
ENCSR000AVE
r=0.35

small heat map img

K562
Weissman
CBX3
ENCSR000ATV
r=0.35

small heat map img

K562
Weissman
SIN3A
ENCSR000BLR
r=0.34

small heat map img

K562
Weissman
RNF2
ENCSR000AUA
r=0.34

small heat map img

K562
Weissman
RAD21
ENCSR000FAD
r=0.34

small heat map img

K562
Weissman
NCOR1
ENCSR000ATY
r=0.34

small heat map img

K562
Weissman
CTCF
ENCSR000DMA
r=0.32

small heat map img

K562
Weissman
CTCF
ENCSR000BPJ
r=0.32

small heat map img

K562
Weissman
SMARCA4
ENCSR000EHO
r=0.32

small heat map img

K562
Weissman
KDM1A
ENCSR000ATX
r=0.32

small heat map img

K562
Weissman
CEBPB
ENCSR000EHE
r=0.31

small heat map img

K562
Weissman
TAL1
ENCSR000EHB
r=0.31

small heat map img

K562
Weissman
CTCF
ENCSR000AKO
r=0.31

small heat map img

K562
Weissman
GTF3C2
ENCSR000DOD
r=0.31

small heat map img

K562
Weissman
MAFF
ENCSR000EGI
r=0.30

small heat map img

K562
Weissman
CTCF
ENCSR000DWE
r=0.30

small heat map img

K562
Weissman
SIRT6
ENCSR000AUB
r=0.29

small heat map img

K562
Weissman
YY1
ENCSR000BMH
r=0.29

small heat map img

K562
Weissman
CTCFL
ENCSR000BNK
r=0.29

small heat map img

K562
Weissman
SMARCB1
ENCSR000EHN
r=0.29

small heat map img

K562
Weissman
GATA2
ENCSR000BKM
r=0.29

small heat map img

K562
Weissman
TRIM28
ENCSR000EVY
r=0.28

small heat map img

K562
Weissman
TAF7
ENCSR000BNM
r=0.27

small heat map img

K562
Weissman
SETDB1
ENCSR000EWD
r=0.26

small heat map img

K562
Weissman
NFYB
ENCSR000EGQ
r=0.26

small heat map img

K562
Weissman
ZNF274
ENCSR000EVX
r=0.26

small heat map img

K562
Weissman
RAD21
ENCSR000BKV
r=0.26

small heat map img

K562
Weissman
SPI1
ENCSR000BGW
r=0.26

small heat map img

K562
Weissman
BRF2
ENCSR000DOC
r=0.26

small heat map img

K562
Weissman
CREBBP
ENCSR000ATT
r=0.26

small heat map img

K562
Weissman
THAP1
ENCSR000BNN
r=0.25

small heat map img

K562
Weissman
FOSL1
ENCSR000BMV
r=0.25

small heat map img

K562
Weissman
SP2
ENCSR000BNL
r=0.24

small heat map img

K562
Weissman
SUZ12
ENCSR000AUC
r=0.24

small heat map img

K562
Weissman
SP1
ENCSR000BKO
r=0.24

small heat map img

K562
Weissman
MEF2A
ENCSR000BNV
r=0.24

small heat map img

K562
Weissman
ZBTB7A
ENCSR000BME
r=0.24

small heat map img

K562
Weissman
SIX5
ENCSR000BGX
r=0.23

small heat map img

K562
Weissman
EZH2
ENCSR000AQE
r=0.23

small heat map img

K562
Weissman
XRCC4
ENCSR000FAC
r=0.22

small heat map img

K562
Weissman
REST
ENCSR000ATM
r=0.20

small heat map img

K562
Weissman
ZBTB33
ENCSR000BKF
r=0.20

small heat map img

K562
Weissman
CHD4
ENCSR000ATL
r=0.19

small heat map img

K562
Weissman
SIX5
ENCSR000BNW
r=0.16

small heat map img

K562
Weissman
CHD1
ENCSR000AQD
r=0.16

small heat map img

K562
Weissman
NR2C2
ENCSR000EWH
r=0.14

small heat map img

K562
Weissman
BDP1
ENCSR000DOK
r=0.10

small heat map img

K562
Weissman
POLR3A
ENCSR000DOI
r=0.10

small heat map img

K562
Weissman
POLR3G
ENCSR000EHQ
r=0.09

small heat map img

K562
Weissman
BRF1
ENCSR000DOJ
r=0.09

small heat map img

K562
Weissman
CBX2
ENCSR000ATU
r=0.08

small heat map img

K562
Weissman
CBX8
ENCSR000ATW
r=0.06

small heat map img

K562
Weissman
ZNF274
ENCSR000EWE
r=-0.13

small heat map img
5,023 peaks (download )

K562 - Weissman - ENCSR000FAZ

K562
Weissman
MYC
ENCSR000FAZ
r=1.00

small heat map img

K562
Weissman
MYC
ENCSR000EZU
r=0.93

small heat map img

K562
Weissman
MYC
ENCSR000EZV
r=0.92

small heat map img

K562
Weissman
MYC
ENCSR000EGS
r=0.91

small heat map img

K562
Weissman
MYC
ENCSR000FAG
r=0.88

small heat map img

K562
Weissman
MYC
ENCSR000EGJ
r=0.87

small heat map img

K562
Weissman
MAX
ENCSR000EFV
r=0.83

small heat map img

K562
Weissman
MYC
ENCSR000DLZ
r=0.81

small heat map img

K562
Weissman
MAX
ENCSR000FAE
r=0.77

small heat map img

K562
Weissman
MAX
ENCSR000BLP
r=0.77

small heat map img

K562
Weissman
MXI1
ENCSR000EGZ
r=0.75

small heat map img

K562
Weissman
JUN
ENCSR000EFS
r=0.74

small heat map img

K562
Weissman
IRF1
ENCSR000EGK
r=0.68

small heat map img

K562
Weissman
IRF1
ENCSR000EGL
r=0.68

small heat map img

K562
Weissman
STAT2
ENCSR000FAT
r=0.68

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGA
r=0.67

small heat map img

K562
Weissman
TBL1XR1
ENCSR000EGB
r=0.67

small heat map img

K562
Weissman
JUN
ENCSR000EGH
r=0.66

small heat map img

K562
Weissman
RCOR1
ENCSR000EGG
r=0.66

small heat map img

K562
Weissman
STAT1
ENCSR000EHJ
r=0.65

small heat map img

K562
Weissman
JUND
ENCSR000EGN
r=0.65

small heat map img

K562
Weissman
ZMIZ1
ENCSR000EFQ
r=0.64

small heat map img

K562
Weissman
JUN
ENCSR000FAH
r=0.63

small heat map img

K562
Weissman
BHLHE40
ENCSR000EGV
r=0.62

small heat map img

K562
Weissman
CBX3
ENCSR000BRT
r=0.62

small heat map img

K562
Weissman
E2F6
ENCSR000EWJ
r=0.61

small heat map img

K562
Weissman
ATF1
ENCSR000DNZ
r=0.61

small heat map img

K562
Weissman
RCOR1
ENCSR000EGC
r=0.61

small heat map img

K562
Weissman
STAT1
ENCSR000FAV
r=0.61

small heat map img

K562
Weissman
TRIM28
ENCSR000BRW
r=0.61

small heat map img

K562
Weissman
SETDB1
ENCSR000AUT
r=0.60

small heat map img

K562
Weissman
STAT1
ENCSR000FAU
r=0.60

small heat map img

K562
Weissman
E2F4
ENCSR000EWL
r=0.60

small heat map img

K562
Weissman
ELK1
ENCSR000EFU
r=0.59

small heat map img

K562
Weissman
STAT1
ENCSR000EHK
r=0.59

small heat map img

K562
Weissman
IRF1
ENCSR000EGT
r=0.57

small heat map img

K562
Weissman
CCNT2
ENCSR000DOA
r=0.57

small heat map img

K562
Weissman
POLR2A
ENCSR000DLY
r=0.57

small heat map img

K562
Weissman
POLR2A
ENCSR000FAY
r=0.56

small heat map img

K562
Weissman
HMGN3
ENCSR000DOB
r=0.56

small heat map img

K562
Weissman
EP300
ENCSR000EGE
r=0.56

small heat map img

K562
Weissman
POLR2A
ENCSR000FAX
r=0.56

small heat map img

K562
Weissman
GATA1
ENCSR000EFT
r=0.56

small heat map img

K562
Weissman
STAT2
ENCSR000FBC
r=0.55

small heat map img

K562
Weissman
JUN
ENCSR000EZX
r=0.55

small heat map img

K562
Weissman
HDAC1
ENCSR000AQF
r=0.54

small heat map img

K562
Weissman
POLR2A
ENCSR000FAW
r=0.54

small heat map img

K562
Weissman
ARID3A
ENCSR000EFY
r=0.54

small heat map img

K562
Weissman
JUN
ENCSR000EZT
r=0.53

small heat map img

K562
Weissman
STAT5A
ENCSR000BRR
r=0.53

small heat map img

K562
Weissman
CEBPD
ENCSR000BVY
r=0.53

small heat map img

K562
Weissman
SMC3
ENCSR000EGW
r=0.52

small heat map img

K562
Weissman
UBTF
ENCSR000EFZ
r=0.52

small heat map img

K562
Weissman
POLR2A
ENCSR000EHP
r=0.52

small heat map img

K562
Weissman
HCFC1
ENCSR000EFN
r=0.52

small heat map img

K562
Weissman
CREB1
ENCSR000BSO
r=0.51

small heat map img

K562
Weissman
EP300
ENCSR000EGY
r=0.51

small heat map img

K562
Weissman
GTF2B
ENCSR000DOE
r=0.51

small heat map img

K562
Weissman
CHD7
ENCSR000AVD
r=0.51