MYBL2 - Factorbook

The protein encoded by this gene, a member of the MYB family of transcription factor genes, is a nuclear protein involved in cell cycle progression. The encoded protein is phosphorylated by cyclin A/cyclin-dependent kinase 2 during the S-phase of the cell cycle and possesses both activator and repressor activities. It has been shown to activate the cell division cycle 2, cyclin D1, and insulin-like growth factor-binding protein 5 genes. Two transcript variants encoding different isoforms have been found for this gene. RefSeq, Jul 2013

Myb-related protein B is a protein that in humans is encoded by the MYBL2 gene.wikipedia

MYBL2

ENCODE	experiments
Ensemble	search
Entrez	4605
GO	search
Gene Card	search
HGNC	search
RefSeq	search
UCSC	browse
UniProt	search
Wikipedia	MYBL2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

HepG2 - Myers - ENCSR000BRO

Legend

Proximal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Distal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

HepG2 - Myers

HepG2 - Myers - ENCSR000BRO

1. 70 / 500 1.5e-223 GGGATTCGAACCCGGGACCTT		p-value: 0.56 pct_center: 0.08 pct_ratio: 0.38
2. 36 / 500 2.8e-102 CCGATGGCCTAGTGGTTAGCGCGTTGGACT		p-value: 0.00 pct_center: 0.07 pct_ratio: 0.64
3. 14 / 500 2.9e-39 GGGAGGGAGTGTAGCTCAGTGGTAGAGCGC		p-value: 0.00 pct_center: 0.11 pct_ratio: 0.56
4. 174 / 500 1.7e-31 TGTTTGCTTAG		p-value: 0.00 pct_center: 0.25 pct_ratio: 1.16
5. 14 / 500 1.2e-13 GGATTCGAACCCGCG		p-value: 0.00 pct_center: 0.06 pct_ratio: 0.55

MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at MYBL2 peaks

HepG2 - Myers

HepG2 - Myers - ENCSR000BRO

HepG2 Myers MYBL2 ENCSR000BRO r=1.00
HepG2 Myers H3K27ac ENCSR000AMO r=0.35
HepG2 Myers H3K4me2 ENCSR000AMC r=0.34
HepG2 Myers H3K9ac ENCSR000AMD r=0.33
HepG2 Myers H3K4me3 ENCSR000AMP r=0.30
HepG2 Myers H3K4me3 ENCSR000DUF r=0.25
HepG2 Myers H2AFZ ENCSR000AOK r=0.24
HepG2 Myers H3K4me1 ENCSR000APV r=0.20
HepG2 Myers H3K27me3 ENCSR000AOL r=0.20
HepG2 Myers H3K79me2 ENCSR000AOM r=0.12
HepG2 Myers H4K20me1 ENCSR000AMQ r=0.08
HepG2 Myers H3K27me3 ENCSR000DUE r=0.04
HepG2 Myers H3K9me3 ENCSR000ATD r=0.04
HepG2 Myers H3K36me3 ENCSR000DUD r=0.02
HepG2 Myers H3K36me3 ENCSR000AMB r=0.00

10,000 randomly-selected peaks from a total of 17,898 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

Binding of other TFs at MYBL2 peaks

HepG2 - Myers

HepG2 - Myers - ENCSR000BRO

HepG2 Myers MYBL2 ENCSR000BRO r=1.00
HepG2 Myers NR2F2 ENCSR000BVM r=0.62
HepG2 Myers EP300 ENCSR000EDV r=0.61
HepG2 Myers RCOR1 ENCSR000EDQ r=0.60
HepG2 Myers ZEB1 ENCSR000BVN r=0.57
HepG2 Myers MAX ENCSR000BTM r=0.55
HepG2 Myers HNF4A ENCSR000EEU r=0.55
HepG2 Myers MXI1 ENCSR000EDU r=0.54
HepG2 Myers NFIC ENCSR000BQX r=0.52
HepG2 Myers SP1 ENCSR000BJX r=0.52
HepG2 Myers MAX ENCSR000EDS r=0.51
HepG2 Myers ARID3A ENCSR000EDP r=0.51
HepG2 Myers HDAC2 ENCSR000BMC r=0.51
HepG2 Myers MYC ENCSR000DLR r=0.51
HepG2 Myers SMC3 ENCSR000EDW r=0.50
HepG2 Myers HSF1 ENCSR000EET r=0.48
HepG2 Myers BRCA1 ENCSR000EDY r=0.48
HepG2 Myers HNF4G ENCSR000BNJ r=0.48
HepG2 Myers FOSL2 ENCSR000BHP r=0.48
HepG2 Myers TEAD4 ENCSR000BRP r=0.46
HepG2 Myers BHLHE40 ENCSR000EDT r=0.46
HepG2 Myers CEBPB ENCSR000EEX r=0.44
HepG2 Myers POLR2A ENCSR000EEM r=0.44
HepG2 Myers RAD21 ENCSR000EEG r=0.43
HepG2 Myers TCF12 ENCSR000BJG r=0.43
HepG2 Myers EP300 ENCSR000BLW r=0.43
HepG2 Myers JUND ENCSR000BGK r=0.43
HepG2 Myers TBP ENCSR000EEL r=0.42
HepG2 Myers ESRRA ENCSR000EEW r=0.42
HepG2 Myers CREB1 ENCSR000BVL r=0.42
HepG2 Myers MAFK ENCSR000EDZ r=0.41
HepG2 Myers MAFF ENCSR000EEC r=0.41
HepG2 Myers MBD4 ENCSR000BQW r=0.41
HepG2 Myers JUND ENCSR000EEI r=0.40
HepG2 Myers HNF4A ENCSR000BLF r=0.40
HepG2 Myers SREBF1 ENCSR000EEO r=0.40
HepG2 Myers RFX5 ENCSR000EEA r=0.39
HepG2 Myers POLR2A ENCSR000EZQ r=0.39
HepG2 Myers POLR2A ENCSR000EEP r=0.38
HepG2 Myers FOXA1 ENCSR000BMO r=0.37
HepG2 Myers ELF1 ENCSR000BMZ r=0.37
HepG2 Myers MAFK ENCSR000EEB r=0.37
HepG2 Myers POLR2A ENCSR000BJM r=0.37
HepG2 Myers CEBPB ENCSR000EEE r=0.36
HepG2 Myers FOXA1 ENCSR000BLE r=0.36
HepG2 Myers POLR2A ENCSR000DLQ r=0.36
HepG2 Myers JUN ENCSR000EEK r=0.35
HepG2 Myers NR3C1 ENCSR000EEV r=0.34
HepG2 Myers SIN3A ENCSR000BGL r=0.34
HepG2 Myers NR2C2 ENCSR000EVS r=0.33
HepG2 Myers USF2 ENCSR000EEF r=0.32
HepG2 Myers RAD21 ENCSR000BLS r=0.32
HepG2 Myers YY1 ENCSR000BNT r=0.32
HepG2 Myers TAF1 ENCSR000BJN r=0.32
HepG2 Myers CEBPD ENCSR000BQJ r=0.30
HepG2 Myers REST ENCSR000BOT r=0.30
HepG2 Myers SREBF1 ENCSR000EZP r=0.29
HepG2 Myers CEBPB ENCSR000BQI r=0.27
HepG2 Myers SREBF2 ENCSR000EZO r=0.27
HepG2 Myers RXRA ENCSR000BHU r=0.27
HepG2 Myers IRF3 ENCSR000EEJ r=0.27
HepG2 Myers TCF7L2 ENCSR000EVQ r=0.26
HepG2 Myers NRF1 ENCSR000EEH r=0.24
HepG2 Myers EZH2 ENCSR000ARI r=0.23
HepG2 Myers ZBTB7A ENCSR000BQA r=0.23
HepG2 Myers CTCF ENCSR000DLS r=0.22
HepG2 Myers CTCF ENCSR000AMA r=0.22
HepG2 Myers CTCF ENCSR000DUG r=0.22
HepG2 Myers SRF ENCSR000BLV r=0.21
HepG2 Myers BHLHE40 ENCSR000BID r=0.21
HepG2 Myers USF1 ENCSR000BGM r=0.21
HepG2 Myers CTCF ENCSR000BIE r=0.19
HepG2 Myers ATF3 ENCSR000BKE r=0.17
HepG2 Myers REST ENCSR000BJL r=0.16
HepG2 Myers FOXA2 ENCSR000BNI r=0.16
HepG2 Myers GABPA ENCSR000BJK r=0.16
HepG2 Myers ZBTB33 ENCSR000BHR r=0.15
HepG2 Myers ZBTB33 ENCSR000BNA r=0.15
HepG2 Myers SP2 ENCSR000BOU r=0.14
HepG2 Myers ZNF274 ENCSR000EVR r=0.04

10,000 randomly-selected peaks from a total of 17,898 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.