MAFF

The protein encoded by this gene is a basic leucine zipper (bZIP) transcription factor that lacks a transactivation domain. It is known to bind the US-2 DNA element in the promoter of the oxytocin receptor (OTR) gene and most likely heterodimerizes with other leucine zipper-containing proteins to enhance expression of the OTR gene during term pregnancy. The encoded protein can also form homodimers, and since it lacks a transactivation domain, the homodimer may act as a repressor of transcription. This gene may also be involved in the cellular stress response. Multiple transcript variants encoding two different isoforms have been found for this gene. RefSeq, Jun 2009
Transcription factor MafF is a protein that in humans is encoded by the MAFF gene. The protein encoded by this gene is a basic leucine zipper (bZIP) transcription factor that lacks a transactivation domain.wikipedia

MAFF


ENCODE experiments
Ensemble search
Entrez 23764
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia MAFF_(gene)

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

HepG2 - Snyder - ENCSR000EEC

loading

K562 - Snyder - ENCSR000EGI

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

HepG2 - Snyder - ENCSR000EEC

1.
500 / 500
8.2e-1300
GCTGAGTCAGCAATT
small heat map img p-value: 0.00
pct_center: 0.69
pct_ratio: 5.05
2.
40 / 500
0.00055
TGCTGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 1.77
3.
42 / 500
0.0011
GTCAGGGCAGGGAGG
small heat map img p-value: 1.00
pct_center: 0.17
pct_ratio: 0.35
4.
19 / 500
0.47
GCTGGGCCTGGGACTCAGCAG
small heat map img p-value: 0.36
pct_center: 0.12
pct_ratio: 0.50
5.
27 / 500
5.7
CAGCAGGAGGCAGG
small heat map img p-value: 0.75
pct_center: 0.11
pct_ratio: 0.46
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Snyder - ENCSR000EGI

1.
478 / 500
9.2e-1404
AATTGCTGAGTCAGC
small heat map img p-value: 0.00
pct_center: 0.62
pct_ratio: 4.79
2.
18 / 500
5.3e-28
TTTTGCTGATGTCAGCATTTT
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 1.08
3.
44 / 500
3.5e-18
GCTGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 2.70
4.
7 / 500
9.0e-7
ACAGTTTGGCAGTTTCTCAAAAGGTTAA
small heat map img p-value: 0.01
pct_center: 0.09
pct_ratio: 0.64
5.
34 / 500
1.1e-7
GGAGGTGGGGGAGGAGAGAAA
small heat map img p-value: 0.62
pct_center: 0.24
pct_ratio: 0.44
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at MAFF peaks

HepG2 - Snyder - ENCSR000EEC

HepG2
Snyder
MAFF
ENCSR000EEC
r=1.00

small heat map img

HepG2
Snyder
H3K4me2
ENCSR000AMC
r=0.14

small heat map img

HepG2
Snyder
H3K27ac
ENCSR000AMO
r=0.14

small heat map img

HepG2
Snyder
H3K4me1
ENCSR000APV
r=0.14

small heat map img

HepG2
Snyder
H3K9ac
ENCSR000AMD
r=0.12

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000AMP
r=0.12

small heat map img

HepG2
Snyder
H2AFZ
ENCSR000AOK
r=0.11

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000DUF
r=0.08

small heat map img

HepG2
Snyder
H3K79me2
ENCSR000AOM
r=0.06

small heat map img

HepG2
Snyder
H4K20me1
ENCSR000AMQ
r=0.05

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000AOL
r=0.05

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000DUD
r=0.03

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000AMB
r=0.03

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000DUE
r=0.02

small heat map img

HepG2
Snyder
H3K9me3
ENCSR000ATD
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 37,637 (download )

K562 - Snyder - ENCSR000EGI

K562
Snyder
MAFF
ENCSR000EGI
r=1.00

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.26

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.26

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.25

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.23

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.22

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.22

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.19

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.16

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.13

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.11

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.10

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.09

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.09

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=0.09

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.09

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=0.03

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=0.03

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=0.01

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 25,074 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at MAFF peaks

HepG2 - Snyder - ENCSR000EEC

HepG2
Snyder
MAFF
ENCSR000EEC
r=1.00

small heat map img

HepG2
Snyder
MAFK
ENCSR000EEB
r=0.97

small heat map img

HepG2
Snyder
MAFK
ENCSR000EDZ
r=0.95

small heat map img

HepG2
Snyder
RFX5
ENCSR000EEA
r=0.36

small heat map img

HepG2
Snyder
JUND
ENCSR000EEI
r=0.28

small heat map img

HepG2
Snyder
ARID3A
ENCSR000EDP
r=0.26

small heat map img

HepG2
Snyder
SMC3
ENCSR000EDW
r=0.24

small heat map img

HepG2
Snyder
EP300
ENCSR000EDV
r=0.24

small heat map img

HepG2
Snyder
MXI1
ENCSR000EDU
r=0.24

small heat map img

HepG2
Snyder
BHLHE40
ENCSR000EDT
r=0.23

small heat map img

HepG2
Snyder
JUN
ENCSR000EEK
r=0.23

small heat map img

HepG2
Snyder
RCOR1
ENCSR000EDQ
r=0.22

small heat map img

HepG2
Snyder
RAD21
ENCSR000EEG
r=0.21

small heat map img

HepG2
Snyder
FOSL2
ENCSR000BHP
r=0.21

small heat map img

HepG2
Snyder
CEBPB
ENCSR000EEE
r=0.20

small heat map img

HepG2
Snyder
MAX
ENCSR000EDS
r=0.20

small heat map img

HepG2
Snyder
CREB1
ENCSR000BVL
r=0.19

small heat map img

HepG2
Snyder
FOXA1
ENCSR000BLE
r=0.19

small heat map img

HepG2
Snyder
CEBPB
ENCSR000EEX
r=0.19

small heat map img

HepG2
Snyder
NR2F2
ENCSR000BVM
r=0.19

small heat map img

HepG2
Snyder
BRCA1
ENCSR000EDY
r=0.19

small heat map img

HepG2
Snyder
IRF3
ENCSR000EEJ
r=0.19

small heat map img

HepG2
Snyder
EP300
ENCSR000BLW
r=0.18

small heat map img

HepG2
Snyder
HNF4A
ENCSR000EEU
r=0.18

small heat map img

HepG2
Snyder
FOXA1
ENCSR000BMO
r=0.18

small heat map img

HepG2
Snyder
TBP
ENCSR000EEL
r=0.18

small heat map img

HepG2
Snyder
MAX
ENCSR000BTM
r=0.18

small heat map img

HepG2
Snyder
SP1
ENCSR000BJX
r=0.18

small heat map img

HepG2
Snyder
TEAD4
ENCSR000BRP
r=0.17

small heat map img

HepG2
Snyder
MYC
ENCSR000DLR
r=0.16

small heat map img

HepG2
Snyder
JUND
ENCSR000BGK
r=0.16

small heat map img

HepG2
Snyder
ZEB1
ENCSR000BVN
r=0.16

small heat map img

HepG2
Snyder
HNF4G
ENCSR000BNJ
r=0.16

small heat map img

HepG2
Snyder
HDAC2
ENCSR000BMC
r=0.16

small heat map img

HepG2
Snyder
USF2
ENCSR000EEF
r=0.16

small heat map img

HepG2
Snyder
NFIC
ENCSR000BQX
r=0.15

small heat map img

HepG2
Snyder
MYBL2
ENCSR000BRO
r=0.15

small heat map img

HepG2
Snyder
HNF4A
ENCSR000BLF
r=0.15

small heat map img

HepG2
Snyder
HSF1
ENCSR000EET
r=0.14

small heat map img

HepG2
Snyder
MBD4
ENCSR000BQW
r=0.14

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEM
r=0.13

small heat map img

HepG2
Snyder
RAD21
ENCSR000BLS
r=0.13

small heat map img

HepG2
Snyder
EZH2
ENCSR000ARI
r=0.13

small heat map img

HepG2
Snyder
CTCF
ENCSR000AMA
r=0.13

small heat map img

HepG2
Snyder
TCF7L2
ENCSR000EVQ
r=0.13

small heat map img

HepG2
Snyder
TCF12
ENCSR000BJG
r=0.12

small heat map img

HepG2
Snyder
CTCF
ENCSR000DLS
r=0.11

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEP
r=0.11

small heat map img

HepG2
Snyder
ELF1
ENCSR000BMZ
r=0.11

small heat map img

HepG2
Snyder
NRF1
ENCSR000EEH
r=0.11

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EZQ
r=0.11

small heat map img

HepG2
Snyder
ESRRA
ENCSR000EEW
r=0.11

small heat map img

HepG2
Snyder
CTCF
ENCSR000DUG
r=0.11

small heat map img

HepG2
Snyder
NR2C2
ENCSR000EVS
r=0.10

small heat map img

HepG2
Snyder
CEBPB
ENCSR000BQI
r=0.10

small heat map img

HepG2
Snyder
SIN3A
ENCSR000BGL
r=0.10

small heat map img

HepG2
Snyder
CTCF
ENCSR000BIE
r=0.10

small heat map img

HepG2
Snyder
NR3C1
ENCSR000EEV
r=0.10

small heat map img

HepG2
Snyder
ZNF274
ENCSR000EVR
r=0.09

small heat map img

HepG2
Snyder
SREBF1
ENCSR000EZP
r=0.09

small heat map img

HepG2
Snyder
RXRA
ENCSR000BHU
r=0.09

small heat map img

HepG2
Snyder
POLR2A
ENCSR000DLQ
r=0.09

small heat map img

HepG2
Snyder
SREBF1
ENCSR000EEO
r=0.09

small heat map img

HepG2
Snyder
SREBF2
ENCSR000EZO
r=0.08

small heat map img

HepG2
Snyder
YY1
ENCSR000BNT
r=0.08

small heat map img

HepG2
Snyder
REST
ENCSR000BOT
r=0.08

small heat map img

HepG2
Snyder
USF1
ENCSR000BGM
r=0.08

small heat map img

HepG2
Snyder
FOXA2
ENCSR000BNI
r=0.08

small heat map img

HepG2
Snyder
POLR2A
ENCSR000BJM
r=0.08

small heat map img

HepG2
Snyder
CEBPD
ENCSR000BQJ
r=0.07

small heat map img

HepG2
Snyder
ZBTB7A
ENCSR000BQA
r=0.07

small heat map img

HepG2
Snyder
SRF
ENCSR000BLV
r=0.07

small heat map img

HepG2
Snyder
BHLHE40
ENCSR000BID
r=0.06

small heat map img

HepG2
Snyder
ATF3
ENCSR000BKE
r=0.05

small heat map img

HepG2
Snyder
GABPA
ENCSR000BJK
r=0.05

small heat map img

HepG2
Snyder
TAF1
ENCSR000BJN
r=0.05

small heat map img

HepG2
Snyder
ZBTB33
ENCSR000BHR
r=0.04

small heat map img

HepG2
Snyder
SP2
ENCSR000BOU
r=0.04

small heat map img

HepG2
Snyder
ZBTB33
ENCSR000BNA
r=0.03

small heat map img

HepG2
Snyder
REST
ENCSR000BJL
r=0.03

small heat map img
10,000 randomly-selected peaks from a total of 37,637 (download )

K562 - Snyder - ENCSR000EGI

K562
Snyder
MAFF
ENCSR000EGI
r=1.00

small heat map img

K562
Snyder
MAFK
ENCSR000EGX
r=0.94

small heat map img

K562
Snyder
BACH1
ENCSR000EGD
r=0.60

small heat map img

K562
Snyder
IRF1
ENCSR000EGK
r=0.52

small heat map img

K562
Snyder
NFE2
ENCSR000FAF
r=0.50

small heat map img

K562
Snyder
IRF1
ENCSR000EGL
r=0.45

small heat map img

K562
Snyder
JUND
ENCSR000EGN
r=0.45

small heat map img

K562
Snyder
EP300
ENCSR000EGE
r=0.45

small heat map img

K562
Snyder
RCOR1
ENCSR000EGG
r=0.42

small heat map img

K562
Snyder
JUN
ENCSR000EZT
r=0.41

small heat map img

K562
Snyder
ATF1
ENCSR000DNZ
r=0.41

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGB
r=0.41

small heat map img

K562
Snyder
ARID3A
ENCSR000EFY
r=0.40

small heat map img

K562
Snyder
JUN
ENCSR000EFS
r=0.40

small heat map img

K562
Snyder
JUN
ENCSR000FAH
r=0.40

small heat map img

K562
Snyder
JUN
ENCSR000EZW
r=0.40

small heat map img

K562
Snyder
JUN
ENCSR000EGH
r=0.40

small heat map img

K562
Snyder
MYC
ENCSR000EGS
r=0.38

small heat map img

K562
Snyder
CUX1
ENCSR000EFO
r=0.37

small heat map img

K562
Snyder
FOS
ENCSR000FAI
r=0.37

small heat map img

K562
Snyder
JUN
ENCSR000EZX
r=0.36

small heat map img

K562
Snyder
ZMIZ1
ENCSR000EFQ
r=0.36

small heat map img

K562
Snyder
RCOR1
ENCSR000EGC
r=0.36

small heat map img

K562
Snyder
GATA1
ENCSR000EFT
r=0.35

small heat map img

K562
Snyder
EP300
ENCSR000EGY
r=0.35

small heat map img

K562
Snyder
MYC
ENCSR000EZU
r=0.35

small heat map img

K562
Snyder
MYC
ENCSR000EZV
r=0.34

small heat map img

K562
Snyder
MYC
ENCSR000EGJ
r=0.34

small heat map img

K562
Snyder
BHLHE40
ENCSR000EGV
r=0.34

small heat map img

K562
Snyder
MAX
ENCSR000EFV
r=0.34

small heat map img

K562
Snyder
STAT2
ENCSR000FAT
r=0.33

small heat map img

K562
Snyder
MYC
ENCSR000FAZ
r=0.33

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGA
r=0.33

small heat map img

K562
Snyder
IRF1
ENCSR000EGT
r=0.33

small heat map img

K562
Snyder
STAT2
ENCSR000FBC
r=0.33

small heat map img

K562
Snyder
KDM1A
ENCSR000ATX
r=0.33

small heat map img

K562
Snyder
EP300
ENCSR000AQB
r=0.32

small heat map img

K562
Snyder
SMARCA4
ENCSR000EHO
r=0.31

small heat map img

K562
Snyder
ZNF384
ENCSR000EFP
r=0.31

small heat map img

K562
Snyder
SMARCB1
ENCSR000EHN
r=0.31

small heat map img

K562
Snyder
STAT1
ENCSR000FAU
r=0.31

small heat map img

K562
Snyder
MXI1
ENCSR000EGZ
r=0.31

small heat map img

K562
Snyder
STAT1
ENCSR000FAV
r=0.30

small heat map img

K562
Snyder
MYC
ENCSR000FAG
r=0.30

small heat map img

K562
Snyder
SIRT6
ENCSR000DOH
r=0.30

small heat map img

K562
Snyder
STAT1
ENCSR000EHK
r=0.30

small heat map img

K562
Snyder
STAT1
ENCSR000EHJ
r=0.30

small heat map img

K562
Snyder
TRIM28
ENCSR000BRW
r=0.30

small heat map img

K562
Snyder
IRF1
ENCSR000EGU
r=0.29

small heat map img

K562
Snyder
TEAD4
ENCSR000BRK
r=0.29

small heat map img

K562
Snyder
CCNT2
ENCSR000DOA
r=0.29

small heat map img

K562
Snyder
TAL1
ENCSR000EHB
r=0.29

small heat map img

K562
Snyder
ZNF143
ENCSR000EGP
r=0.29

small heat map img

K562
Snyder
CBX3
ENCSR000BRT
r=0.29

small heat map img

K562
Snyder
POLR2A
ENCSR000EHL
r=0.28

small heat map img

K562
Snyder
MYC
ENCSR000DLZ
r=0.28

small heat map img

K562
Snyder
ELK1
ENCSR000EFU
r=0.28

small heat map img

K562
Snyder
HCFC1
ENCSR000EFN
r=0.28

small heat map img

K562
Snyder
CEBPB
ENCSR000BRQ
r=0.28

small heat map img

K562
Snyder
NR2F2
ENCSR000BRS
r=0.28

small heat map img

K562
Snyder
SMC3
ENCSR000EGW
r=0.28

small heat map img

K562
Snyder
GATA2
ENCSR000EWG
r=0.27

small heat map img

K562
Snyder
CEBPB
ENCSR000EHE
r=0.27

small heat map img

K562
Snyder
CEBPD
ENCSR000BVY
r=0.27

small heat map img

K562
Snyder
STAT5A
ENCSR000BRR
r=0.27

small heat map img

K562
Snyder
RFX5
ENCSR000EGO
r=0.26

small heat map img

K562
Snyder
GATA2
ENCSR000BKM
r=0.26

small heat map img

K562
Snyder
EZH2
ENCSR000AQE
r=0.26

small heat map img

K562
Snyder
NFYA
ENCSR000EGR
r=0.26

small heat map img

K562
Snyder
MAX
ENCSR000FAE
r=0.26

small heat map img

K562
Snyder
SETDB1
ENCSR000AUT
r=0.26

small heat map img

K562
Snyder
HDAC1
ENCSR000AQF
r=0.24

small heat map img

K562
Snyder
HMGN3
ENCSR000DOB
r=0.24

small heat map img

K562
Snyder
CTCF
ENCSR000EGM
r=0.24

small heat map img

K562
Snyder
CHD7
ENCSR000AVD
r=0.24

small heat map img

K562
Snyder
CREB1
ENCSR000BSO
r=0.24

small heat map img

K562
Snyder
RAD21
ENCSR000FAD
r=0.24

small heat map img

K562
Snyder
RBBP5
ENCSR000AQI
r=0.23

small heat map img

K562
Snyder
KAT2B
ENCSR000ATZ
r=0.22

small heat map img

K562
Snyder
POLR2A
ENCSR000FAX
r=0.22

small heat map img

K562
Snyder
HDAC2
ENCSR000AQG
r=0.22

small heat map img

K562
Snyder
TRIM28
ENCSR000EVY
r=0.22

small heat map img

K562
Snyder
E2F6
ENCSR000EWJ
r=0.22

small heat map img

K562
Snyder
POLR2A
ENCSR000FAJ
r=0.22

small heat map img

K562
Snyder
POLR2A
ENCSR000FAY
r=0.22

small heat map img

K562
Snyder
REST
ENCSR000BMW
r=0.22

small heat map img

K562
Snyder
ZNF274
ENCSR000EVX
r=0.22

small heat map img

K562
Snyder
GTF2B
ENCSR000DOE
r=0.22

small heat map img

K562
Snyder
MAX
ENCSR000BLP
r=0.21

small heat map img

K562
Snyder
FOSL1
ENCSR000BMV
r=0.21

small heat map img

K562
Snyder
TBP
ENCSR000EHA
r=0.21

small heat map img

K562
Snyder
E2F4
ENCSR000EWL
r=0.21

small heat map img

K562
Snyder
PML
ENCSR000BQY
r=0.20

small heat map img

K562
Snyder
POLR2A
ENCSR000EHP
r=0.20

small heat map img

K562
Snyder
NRF1
ENCSR000EHH
r=0.20

small heat map img

K562
Snyder
USF2
ENCSR000EHG
r=0.20

small heat map img

K562
Snyder
GATA1
ENCSR000EWM
r=0.19

small heat map img

K562
Snyder
POLR2A
ENCSR000DLY
r=0.19

small heat map img

K562
Snyder
KDM5B
ENCSR000AQA
r=0.19

small heat map img

K562
Snyder
WHSC1
ENCSR000AVE
r=0.19

small heat map img

K562
Snyder
SAP30
ENCSR000AQJ
r=0.19

small heat map img

K562
Snyder
POLR2A
ENCSR000FAW
r=0.18

small heat map img

K562
Snyder
BRF2
ENCSR000DOC
r=0.18

small heat map img

K562
Snyder
NCOR1
ENCSR000ATY
r=0.18

small heat map img

K562
Snyder
HDAC6
ENCSR000ATJ
r=0.18

small heat map img

K562
Snyder
SRF
ENCSR000BLK
r=0.17

small heat map img

K562
Snyder
BDP1
ENCSR000DOK
r=0.17

small heat map img

K562
Snyder
EGR1
ENCSR000BNE
r=0.17

small heat map img

K562
Snyder
USF1
ENCSR000BKT
r=0.17

small heat map img

K562
Snyder
POLR2A
ENCSR000BMR
r=0.17

small heat map img

K562
Snyder
GTF3C2
ENCSR000DOD
r=0.17

small heat map img

K562
Snyder
MEF2A
ENCSR000BNV
r=0.16

small heat map img

K562
Snyder
CTCF
ENCSR000AKO
r=0.16

small heat map img

K562
Snyder
CHD4
ENCSR000ATL
r=0.16

small heat map img

K562
Snyder
CBX3
ENCSR000ATV
r=0.16

small heat map img

K562
Snyder
SPI1
ENCSR000BGW
r=0.15

small heat map img

K562
Snyder
HDAC2
ENCSR000BMG
r=0.15

small heat map img

K562
Snyder
XRCC4
ENCSR000FAC
r=0.15

small heat map img

K562
Snyder
ATF3
ENCSR000BNU
r=0.15

small heat map img

K562
Snyder
SETDB1
ENCSR000EWI
r=0.15

small heat map img

K562
Snyder
SIRT6
ENCSR000AUB
r=0.15

small heat map img

K562
Snyder
GABPA
ENCSR000BLO
r=0.14

small heat map img

K562
Snyder
CTCF
ENCSR000DMA
r=0.14

small heat map img

K562
Snyder
REST
ENCSR000ATM
r=0.14

small heat map img

K562
Snyder
CREBBP
ENCSR000ATT
r=0.14

small heat map img

K562
Snyder
TAF1
ENCSR000BKS
r=0.14

small heat map img

K562
Snyder
RNF2
ENCSR000AUA
r=0.14

small heat map img

K562
Snyder
YY1
ENCSR000EWF
r=0.13

small heat map img

K562
Snyder
CHD1
ENCSR000AQD
r=0.13

small heat map img

K562
Snyder
YY1
ENCSR000BKU
r=0.13

small heat map img

K562
Snyder
NFYB
ENCSR000EGQ
r=0.13

small heat map img

K562
Snyder
ATF3
ENCSR000DOG
r=0.13

small heat map img

K562
Snyder
SETDB1
ENCSR000EWD
r=0.13

small heat map img

K562
Snyder
CTCF
ENCSR000DWE
r=0.12

small heat map img

K562
Snyder
SP1
ENCSR000BKO
r=0.12

small heat map img

K562
Snyder
BRF1
ENCSR000DOJ
r=0.12

small heat map img

K562
Snyder
PHF8
ENCSR000AQH
r=0.12

small heat map img

K562
Snyder
ETS1
ENCSR000BKQ
r=0.11

small heat map img

K562
Snyder
POLR3G
ENCSR000EHQ
r=0.11

small heat map img

K562
Snyder
ZBTB33
ENCSR000BKF
r=0.10

small heat map img

K562
Snyder
UBTF
ENCSR000EFZ
r=0.10

small heat map img

K562
Snyder
CTCF
ENCSR000BPJ
r=0.10

small heat map img

K562
Snyder
SIN3A
ENCSR000BLR
r=0.10

small heat map img

K562
Snyder
RAD21
ENCSR000BKV
r=0.10

small heat map img

K562
Snyder
E2F6
ENCSR000BLI
r=0.10

small heat map img

K562
Snyder
UBTF
ENCSR000EFW
r=0.09

small heat map img

K562
Snyder
SUZ12
ENCSR000AUC
r=0.09

small heat map img

K562
Snyder
ELF1
ENCSR000BMD
r=0.09

small heat map img

K562
Snyder
TAF7
ENCSR000BNM
r=0.09

small heat map img

K562
Snyder
POLR3A
ENCSR000DOI
r=0.09

small heat map img

K562
Snyder
ZBTB7A
ENCSR000BME
r=0.08

small heat map img

K562
Snyder
NR2C2
ENCSR000EWH
r=0.08

small heat map img

K562
Snyder
YY1
ENCSR000BMH
r=0.07

small heat map img

K562
Snyder
SIX5
ENCSR000BNW
r=0.07

small heat map img

K562
Snyder
ZNF263
ENCSR000EWN
r=0.06

small heat map img

K562
Snyder
SIX5
ENCSR000BGX
r=0.06

small heat map img

K562
Snyder
CTCFL
ENCSR000BNK
r=0.06

small heat map img

K562
Snyder
ZNF274
ENCSR000EWE
r=0.05

small heat map img

K562
Snyder
CBX2
ENCSR000ATU
r=0.05

small heat map img

K562
Snyder
CBX8
ENCSR000ATW
r=0.05

small heat map img

K562
Snyder
THAP1
ENCSR000BNN
r=0.04

small heat map img

K562
Snyder
SP2
ENCSR000BNL
r=0.04

small heat map img
10,000 randomly-selected peaks from a total of 25,074 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

K562 - Snyder - ENCSR000EGI

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help