JUND

The protein encoded by this intronless gene is a member of the JUN family, and a functional component of the AP1 transcription factor complex. This protein has been proposed to protect cells from p53-dependent senescence and apoptosis. Alternative translation initiation site usage results in the production of different isoforms (PMID:12105216). RefSeq, Nov 2013
Transcription factor JunD is a protein that in humans is encoded by the JUND gene.wikipedia

JUND

PDB image
PDB 3U86

PDB 3U86
ENCODE experiments
Ensemble search
Entrez 3727
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia JUND

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

A549 - Myers - ENCSR000BRF

loading

GM12878 - Snyder - ENCSR000DYS

loading

GM12878 - Weissman - ENCSR000EYV

loading

H1-hESC - Myers - ENCSR000BKP

loading

H1-hESC - Snyder - ENCSR000EBZ

loading

HCT116 - Myers - ENCSR000BSA

loading

HeLa-S3 - Snyder - ENCSR000EDH

loading

HepG2 - Myers - ENCSR000BGK

loading

HepG2 - Snyder - ENCSR000EEI

loading

K562 - Snyder - ENCSR000EGN

loading

MCF-7 - Myers - ENCSR000BSU

loading

SK-N-SH - Myers - ENCSR000BSK

loading

SK-N-SH - Snyder - ENCSR000EIB

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

A549 - Myers - ENCSR000BRF

1.
133 / 500
1.2e-92
ATGAGTCACTG
small heat map img p-value: 0.00
pct_center: 0.49
pct_ratio: 3.38
2.
94 / 500
9.1e-53
GGGGGGGGGGGAGGGAGGCAGAGGGCGGGG
small heat map img p-value: 0.00
pct_center: 0.58
pct_ratio: 0.56
3.
6 / 500
1.2e-11
AAATGTGGGAAACTCGACTGCATAATTTGT
small heat map img p-value: 0.69
pct_center: 0.04
pct_ratio: 0.42
4.
6 / 500
4.1e-12
AGTGGTTTTTCCTTCTTGATGGCTCAAT
small heat map img p-value: 0.79
pct_center: 0.08
pct_ratio: 0.38
5.
6 / 500
1.9e-8
GGGGAAATCGCAGGGGTCAGC
small heat map img p-value: 0.01
pct_center: 0.21
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Snyder - ENCSR000DYS

1.
153 / 500
1.9e-207
TGAGTCATATTGAAAGTGAAATTGGTT
small heat map img p-value: 0.00
pct_center: 0.49
pct_ratio: 4.78
2.
117 / 500
2.2e-146
GGGCCGTACCATCGGGCGGGGGGGGGGGG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.55
3.
43 / 500
2.5e-70
GGTGACGTCATC
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 2.36
4.
116 / 500
1.9e-13
GGGGGGGGGGGCGGCGCGCGG
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.54
5.
44 / 500
5.3e-13
AAAAAAAAAAGAAAT
small heat map img p-value: 0.46
pct_center: 0.27
pct_ratio: 0.45
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Weissman - ENCSR000EYV

1.
489 / 500
3.0e-515
GAGTCATATCGAAA
small heat map img p-value: 0.00
pct_center: 0.54
pct_ratio: 3.86
2.
122 / 500
2.0e-42
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.50
pct_ratio: 3.92
3.
69 / 500
1.1e-18
AAGAACTGAAA
small heat map img p-value: 0.00
pct_center: 0.37
pct_ratio: 0.75
4.
49 / 500
0.0000083
TCTGTGGTTTT
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 1.02
5.
8 / 500
6.3e+3
TTAGGTATATACCTAGGAGTGGAATTGCT
small heat map img p-value: 0.27
pct_center: 0.12
pct_ratio: 0.60
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Myers - ENCSR000BKP

1.
173 / 500
5.0e-246
GATGAGTCACC
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 3.49
2.
192 / 500
2.3e-246
GGCTGCCGGGAAAACCCGGAG
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 0.75
3.
37 / 500
1.1e-60
CATTCCTGAGGGGTGAGGTCATC
small heat map img p-value: 0.00
pct_center: 0.08
pct_ratio: 0.93
4.
117 / 500
2.5e-27
GGCTGGGGGAGGGGA
small heat map img p-value: 0.52
pct_center: 0.58
pct_ratio: 0.57
5.
50 / 500
3.5e-10
CAGGAATG
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.81
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Snyder - ENCSR000EBZ

1.
367 / 500
7.4e-308
AGGTTGAGTCATCCCCCAGGA
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 2.92
2.
12 / 500
3.9e-93
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
small heat map img p-value: 0.02
pct_center: 0.18
pct_ratio: 0.59
3.
111 / 500
2.0e-30
GCGGGAGGGGGGGGG
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 0.63
4.
47 / 500
3.4e-12
AGAGAGAAAAAAAGA
small heat map img p-value: 0.60
pct_center: 0.23
pct_ratio: 0.43
5.
4 / 500
3.1e-7
AAAACCCTTGGAATTTCCTGAGTGATAGGA
small heat map img p-value: 0.04
pct_center: 0.07
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HCT116 - Myers - ENCSR000BSA

1.
238 / 500
2.8e-230
GAAAGAATGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.73
pct_ratio: 2.73
2.
84 / 500
1.9e-15
GAGAAAACAGGGAGGAGAAGG
small heat map img p-value: 0.95
pct_center: 0.34
pct_ratio: 0.50
3.
74 / 500
3.2e-9
ATGAGTCA
small heat map img p-value: 0.00
pct_center: 0.70
pct_ratio: 2.75
4.
8 / 500
2.5e-8
TGTGTGTATGTGTGTGTGTGTGTGT
small heat map img p-value: 0.95
pct_center: 0.12
pct_ratio: 0.49
5.
7 / 500
0.0000042
GGTGGGAGGATTACTTGAGGCCAGGAGTT
small heat map img p-value: 1.00
pct_center: 0.12
pct_ratio: 0.34
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Snyder - ENCSR000EDH

1.
485 / 500
1.4e-1152
GATGAGTCATC
small heat map img p-value: 0.00
pct_center: 0.69
pct_ratio: 6.21
2.
203 / 500
6.6e-167
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.69
pct_ratio: 5.14
3.
27 / 500
5.0e-10
GGATGACATCATCAT
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 1.11
4.
7 / 500
9.3e-9
TGTATACAGCGTGGATACACTGGACAAAGG
small heat map img p-value: 0.31
pct_center: 0.06
pct_ratio: 0.55
5.
10 / 500
21
GAGAGCAAGAGAGAGGGAGAGAGACAGAGA
small heat map img p-value: 0.20
pct_center: 0.15
pct_ratio: 0.49
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Myers - ENCSR000BGK

1.
452 / 500
5.6e-860
GATGAGTCACT
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 4.49
2.
160 / 500
6.4e-55
TAAGTAAACA
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 1.19
3.
97 / 500
2.7e-36
CTGAGTCA
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 2.78
4.
72 / 500
1.2e-22
CGGGGGGGGAGGGGGCGGGGG
small heat map img p-value: 0.14
pct_center: 0.49
pct_ratio: 0.56
5.
57 / 500
4.2e-12
GCAAAGGTCA
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.97
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Snyder - ENCSR000EEI

1.
494 / 500
3.4e-695
AAGGTTACGTCATCA
small heat map img p-value: 0.00
pct_center: 0.48
pct_ratio: 5.56
2.
20 / 500
9.9e-96
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
small heat map img p-value: 0.69
pct_center: 0.22
pct_ratio: 0.49
3.
75 / 500
1.5e-13
GAGAGAGAGAGAGAG
small heat map img p-value: 1.00
pct_center: 0.27
pct_ratio: 0.47
4.
51 / 500
4.2e-12
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.48
pct_ratio: 5.09
5.
29 / 500
0.000021
GGGGTGGGGCC
small heat map img p-value: 0.05
pct_center: 0.13
pct_ratio: 0.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Snyder - ENCSR000EGN

1.
412 / 500
6.7e-817
AGGATGACTCATCGG
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 4.80
2.
67 / 500
2.4e-84
GGGTGACGTCATC
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 1.15
3.
111 / 500
3.1e-52
GTGACTCA
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 3.87
4.
91 / 500
2.4e-39
GGGGGAGGGGGGGGG
small heat map img p-value: 0.45
pct_center: 0.48
pct_ratio: 0.52
5.
110 / 500
3.6e-22
CAGATAAG
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 1.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF-7 - Myers - ENCSR000BSU

1.
210 / 500
1.5e-212
AAAGATGAGTCATTG
small heat map img p-value: 0.00
pct_center: 0.72
pct_ratio: 4.18
2.
69 / 500
2.2e-35
GGGGGATGGGGAAGGGGCGGGGGACCGGTG
small heat map img p-value: 1.00
pct_center: 0.34
pct_ratio: 0.47
3.
55 / 500
0.000011
GCCCTGGGGCA
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 0.70
4.
34 / 500
0.016
AAATAAAAAAAAAAAAGAAAA
small heat map img p-value: 1.00
pct_center: 0.23
pct_ratio: 0.36
5.
16 / 500
41
CTGGCAGAGGCAGAG
small heat map img p-value: 0.56
pct_center: 0.22
pct_ratio: 0.63
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

SK-N-SH - Myers - ENCSR000BSK

1.
187 / 500
8.2e-128
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 2.81
2.
72 / 500
9.3e-13
AAAAAAAAAAAAGAA
small heat map img p-value: 1.00
pct_center: 0.34
pct_ratio: 0.43
3.
91 / 500
0.0000071
GCTGTGGT
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.64
4.
10 / 500
22
GGGAGGACGGGGCAGGTGGGTCAGTTGAGG
small heat map img p-value: 1.00
pct_center: 0.15
pct_ratio: 0.39
5.
20 / 500
1.3e+2
GTGCTGAGGGGGGGG
small heat map img p-value: 0.87
pct_center: 0.13
pct_ratio: 0.42
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

SK-N-SH - Snyder - ENCSR000EIB

1.
290 / 500
3.1e-572
AGAGGGATGAGTCATCA
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 8.72
2.
49 / 500
3.5e-71
GGGGATGACGTCATC
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 1.50
3.
124 / 500
5.4e-67
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 6.49
4.
74 / 500
8.5e-65
CGCGCGGGGGGGGGGGGGCGGCGCGGGGGG
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.47
5.
47 / 500
3.3e-8
AGCAAAAAGAAGAGAAAGAAA
small heat map img p-value: 0.97
pct_center: 0.31
pct_ratio: 0.44
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

T47D - Myers - ENCSR000BVO

1.
63 / 500
2.9e-28
AGAGGGTGGGGGAGGAGGCTGGGGGAAG
small heat map img p-value: 0.99
pct_center: 0.20
pct_ratio: 0.45
2.
52 / 500
8.9e-32
GGTGACTCAT
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 1.55
3.
161 / 500
6.0e-20
TGTTTGCTTAT
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 1.08
4.
45 / 500
0.000011
TGCCCTGGGGG
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.94
5.
27 / 500
0.12
CTCTGAGAATGAAG
small heat map img p-value: 0.06
pct_center: 0.12
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at JUND peaks

A549 - Myers - ENCSR000BRF

A549
Myers
JUND
ENCSR000BRF
r=1.00

small heat map img

A549
Myers
H3K27ac
ENCSR000AUI
r=0.34

small heat map img

A549
Myers
H3K4me2
ENCSR000AVI
r=0.31

small heat map img

A549
Myers
H3K27ac
ENCSR000AVF
r=0.31

small heat map img

A549
Myers
H3K4me2
ENCSR000ATO
r=0.31

small heat map img

A549
Myers
H2AFZ
ENCSR000AUG
r=0.27

small heat map img

A549
Myers
H2AFZ
ENCSR000AUH
r=0.27

small heat map img

A549
Myers
H3K9ac
ENCSR000ASV
r=0.25

small heat map img

A549
Myers
H3K4me3
ENCSR000ASH
r=0.23

small heat map img

A549
Myers
H3K4me1
ENCSR000AUM
r=0.22

small heat map img

A549
Myers
H3K4me1
ENCSR000AVH
r=0.22

small heat map img

A549
Myers
H3K4me3
ENCSR000AST
r=0.21

small heat map img

A549
Myers
H3K4me3
ENCSR000DPD
r=0.14

small heat map img

A549
Myers
H3K79me2
ENCSR000ATP
r=0.03

small heat map img

A549
Myers
H3K79me2
ENCSR000ASU
r=0.03

small heat map img

A549
Myers
H4K20me1
ENCSR000AUO
r=0.01

small heat map img

A549
Myers
H3K36me3
ENCSR000AUL
r=0.00

small heat map img

A549
Myers
H3K36me3
ENCSR000AVG
r=-0.00

small heat map img

A549
Myers
H3K9me3
ENCSR000AUN
r=-0.02

small heat map img

A549
Myers
H3K27me3
ENCSR000AUK
r=-0.02

small heat map img

A549
Myers
H3K27me3
ENCSR000AUJ
r=-0.05

small heat map img
8,907 peaks (download )

GM12878 - Snyder - ENCSR000DYS

GM12878
Snyder
JUND
ENCSR000DYS
r=1.00

small heat map img

GM12878
Snyder
JUND
ENCSR000EYV
r=0.60

small heat map img

GM12878
Snyder
H2AFZ
ENCSR000AOV
r=0.46

small heat map img

GM12878
Snyder
H3K27ac
ENCSR000AKC
r=0.43

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000AKA
r=0.42

small heat map img

GM12878
Snyder
H3K4me2
ENCSR000AKG
r=0.41

small heat map img

GM12878
Snyder
H3K9ac
ENCSR000AKH
r=0.41

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000DRY
r=0.32

small heat map img

GM12878
Snyder
H3K4me1
ENCSR000AKF
r=0.24

small heat map img

GM12878
Snyder
H3K79me2
ENCSR000AOW
r=0.15

small heat map img

GM12878
Snyder
H3K9me3
ENCSR000AOX
r=0.00

small heat map img

GM12878
Snyder
H4K20me1
ENCSR000AKI
r=0.00

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000DRW
r=-0.05

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000DRX
r=-0.07

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000AKD
r=-0.08

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000AKE
r=-0.09

small heat map img
2,506 peaks (download )

GM12878 - Weissman - ENCSR000EYV

GM12878
Weissman
JUND
ENCSR000EYV
r=1.00

small heat map img

GM12878
Weissman
JUND
ENCSR000DYS
r=0.83

small heat map img

GM12878
Weissman
H3K4me2
ENCSR000AKG
r=0.40

small heat map img

GM12878
Weissman
H3K4me3
ENCSR000AKA
r=0.36

small heat map img

GM12878
Weissman
H3K27ac
ENCSR000AKC
r=0.33

small heat map img

GM12878
Weissman
H3K4me1
ENCSR000AKF
r=0.32

small heat map img

GM12878
Weissman
H2AFZ
ENCSR000AOV
r=0.30

small heat map img

GM12878
Weissman
H3K9ac
ENCSR000AKH
r=0.24

small heat map img

GM12878
Weissman
H3K4me3
ENCSR000DRY
r=0.10

small heat map img

GM12878
Weissman
H3K79me2
ENCSR000AOW
r=0.03

small heat map img

GM12878
Weissman
H3K9me3
ENCSR000AOX
r=-0.00

small heat map img

GM12878
Weissman
H4K20me1
ENCSR000AKI
r=-0.00

small heat map img

GM12878
Weissman
H3K36me3
ENCSR000AKE
r=-0.06

small heat map img

GM12878
Weissman
H3K36me3
ENCSR000DRW
r=-0.08

small heat map img

GM12878
Weissman
H3K27me3
ENCSR000DRX
r=-0.08

small heat map img

GM12878
Weissman
H3K27me3
ENCSR000AKD
r=-0.08

small heat map img
2,472 peaks (download )

H1-hESC - Myers - ENCSR000BKP

H1-hESC
Myers
JUND
ENCSR000BKP
r=1.00

small heat map img

H1-hESC
Myers
JUND
ENCSR000EBZ
r=0.50

small heat map img

H1-hESC
Myers
H3K27ac
ENCSR000ANP
r=0.22

small heat map img

H1-hESC
Myers
H3K9ac
ENCSR000AND
r=0.19

small heat map img

H1-hESC
Myers
H3K4me2
ENCSR000ANC
r=0.18

small heat map img

H1-hESC
Myers
H3K4me3
ENCSR000AMG
r=0.17

small heat map img

H1-hESC
Myers
H2AFZ
ENCSR000APX
r=0.15

small heat map img

H1-hESC
Myers
H3K4me1
ENCSR000ANA
r=0.12

small heat map img

H1-hESC
Myers
H4K20me1
ENCSR000AMH
r=0.02

small heat map img

H1-hESC
Myers
H3K27me3
ENCSR000ALU
r=-0.00

small heat map img

H1-hESC
Myers
H3K9me3
ENCSR000APZ
r=-0.00

small heat map img

H1-hESC
Myers
H3K79me2
ENCSR000APY
r=-0.01

small heat map img

H1-hESC
Myers
H3K36me3
ENCSR000ANB
r=-0.02

small heat map img
8,447 peaks (download )

H1-hESC - Snyder - ENCSR000EBZ

H1-hESC
Snyder
JUND
ENCSR000EBZ
r=1.00

small heat map img

H1-hESC
Snyder
JUND
ENCSR000BKP
r=0.48

small heat map img

H1-hESC
Snyder
H3K27ac
ENCSR000ANP
r=0.41

small heat map img

H1-hESC
Snyder
H3K4me2
ENCSR000ANC
r=0.40

small heat map img

H1-hESC
Snyder
H3K9ac
ENCSR000AND
r=0.37

small heat map img

H1-hESC
Snyder
H3K4me3
ENCSR000AMG
r=0.35

small heat map img

H1-hESC
Snyder
H3K4me1
ENCSR000ANA
r=0.32

small heat map img

H1-hESC
Snyder
H2AFZ
ENCSR000APX
r=0.31

small heat map img

H1-hESC
Snyder
H4K20me1
ENCSR000AMH
r=0.07

small heat map img

H1-hESC
Snyder
H3K79me2
ENCSR000APY
r=0.06

small heat map img

H1-hESC
Snyder
H3K27me3
ENCSR000ALU
r=0.04

small heat map img

H1-hESC
Snyder
H3K9me3
ENCSR000APZ
r=0.01

small heat map img

H1-hESC
Snyder
H3K36me3
ENCSR000ANB
r=-0.02

small heat map img
9,550 peaks (download )

HCT116 - Myers - ENCSR000BSA

HCT116
Myers
JUND
ENCSR000BSA
r=1.00

small heat map img

HCT116
Myers
H3K4me1
ENCSR000EUS
r=0.44

small heat map img

HCT116
Myers
H3K27ac
ENCSR000EUT
r=0.37

small heat map img

HCT116
Myers
H3K4me3
ENCSR000DTQ
r=0.17

small heat map img
8,479 peaks (download )

HeLa-S3 - Snyder - ENCSR000EDH

HeLa-S3
Snyder
JUND
ENCSR000EDH
r=1.00

small heat map img

HeLa-S3
Snyder
H3K4me1
ENCSR000APW
r=0.40

small heat map img

HeLa-S3
Snyder
H3K4me2
ENCSR000AOE
r=0.37

small heat map img

HeLa-S3
Snyder
H3K27ac
ENCSR000AOC
r=0.29

small heat map img

HeLa-S3
Snyder
H2AFZ
ENCSR000AQN
r=0.28

small heat map img

HeLa-S3
Snyder
H3K4me3
ENCSR000AOF
r=0.23

small heat map img

HeLa-S3
Snyder
H3K9ac
ENCSR000AOH
r=0.18

small heat map img

HeLa-S3
Snyder
H3K4me3
ENCSR000DUA
r=0.08

small heat map img

HeLa-S3
Snyder
H4K20me1
ENCSR000AOI
r=0.05

small heat map img

HeLa-S3
Snyder
H3K79me2
ENCSR000AOG
r=0.03

small heat map img

HeLa-S3
Snyder
H3K27me3
ENCSR000DTY
r=0.02

small heat map img

HeLa-S3
Snyder
H3K36me3
ENCSR000DTZ
r=0.02

small heat map img

HeLa-S3
Snyder
H3K9me3
ENCSR000AQO
r=0.01

small heat map img

HeLa-S3
Snyder
H3K36me3
ENCSR000AOD
r=-0.01

small heat map img

HeLa-S3
Snyder
H3K27me3
ENCSR000APB
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 31,633 (download )

HepG2 - Myers - ENCSR000BGK

HepG2
Myers
JUND
ENCSR000BGK
r=1.00

small heat map img

HepG2
Myers
JUND
ENCSR000EEI
r=0.56

small heat map img

HepG2
Myers
H3K27ac
ENCSR000AMO
r=0.28

small heat map img

HepG2
Myers
H3K4me2
ENCSR000AMC
r=0.26

small heat map img

HepG2
Myers
H3K9ac
ENCSR000AMD
r=0.25

small heat map img

HepG2
Myers
H3K4me3
ENCSR000AMP
r=0.23

small heat map img

HepG2
Myers
H2AFZ
ENCSR000AOK
r=0.18

small heat map img

HepG2
Myers
H3K4me3
ENCSR000DUF
r=0.18

small heat map img

HepG2
Myers
H3K4me1
ENCSR000APV
r=0.16

small heat map img

HepG2
Myers
H3K27me3
ENCSR000AOL
r=0.11

small heat map img

HepG2
Myers
H4K20me1
ENCSR000AMQ
r=0.06

small heat map img

HepG2
Myers
H3K79me2
ENCSR000AOM
r=0.05

small heat map img

HepG2
Myers
H3K27me3
ENCSR000DUE
r=0.03

small heat map img

HepG2
Myers
H3K9me3
ENCSR000ATD
r=0.02

small heat map img

HepG2
Myers
H3K36me3
ENCSR000DUD
r=0.01

small heat map img

HepG2
Myers
H3K36me3
ENCSR000AMB
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 21,614 (download )

HepG2 - Snyder - ENCSR000EEI

HepG2
Snyder
JUND
ENCSR000EEI
r=1.00

small heat map img

HepG2
Snyder
JUND
ENCSR000BGK
r=0.47

small heat map img

HepG2
Snyder
H3K27ac
ENCSR000AMO
r=0.28

small heat map img

HepG2
Snyder
H3K4me2
ENCSR000AMC
r=0.26

small heat map img

HepG2
Snyder
H3K4me1
ENCSR000APV
r=0.25

small heat map img

HepG2
Snyder
H3K9ac
ENCSR000AMD
r=0.24

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000AMP
r=0.21

small heat map img

HepG2
Snyder
H2AFZ
ENCSR000AOK
r=0.18

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000DUF
r=0.15

small heat map img

HepG2
Snyder
H3K79me2
ENCSR000AOM
r=0.08

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000AOL
r=0.07

small heat map img

HepG2
Snyder
H4K20me1
ENCSR000AMQ
r=0.06

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000DUD
r=0.03

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000AMB
r=0.03

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000DUE
r=0.03

small heat map img

HepG2
Snyder
H3K9me3
ENCSR000ATD
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 32,275 (download )

K562 - Snyder - ENCSR000EGN

K562
Snyder
JUND
ENCSR000EGN
r=1.00

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.37

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.36

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.34

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.34

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.34

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.33

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.29

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.25

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.25

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.23

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.16

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.15

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.13

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.11

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=0.08

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=0.02

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=0.01

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=-0.01

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.06

small heat map img
10,000 randomly-selected peaks from a total of 40,052 (download )

MCF-7 - Myers - ENCSR000BSU

MCF-7
Myers
JUND
ENCSR000BSU
r=1.00

small heat map img

MCF-7
Myers
H3K27ac
ENCSR000EWR
r=0.32

small heat map img

MCF-7
Myers
H3K4me3
ENCSR000DWJ
r=0.20

small heat map img

MCF-7
Myers
H3K36me3
ENCSR000EWO
r=0.02

small heat map img

MCF-7
Myers
H3K9me3
ENCSR000EWQ
r=0.01

small heat map img

MCF-7
Myers
H3K27me3
ENCSR000EWP
r=-0.06

small heat map img
2,389 peaks (download )

SK-N-SH - Myers - ENCSR000BSK

SK-N-SH
Myers
JUND
ENCSR000BSK
r=1.00

small heat map img

SK-N-SH
Myers
JUND
ENCSR000EIB
r=0.85

small heat map img

SK-N-SH
Myers
H3K4me3
ENCSR000DXR
r=0.04

small heat map img

SK-N-SH
Myers
H3K36me3
ENCSR000DXO
r=0.02

small heat map img

SK-N-SH
Myers
H3K27me3
ENCSR000DXP
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 0 (download )

SK-N-SH - Snyder - ENCSR000EIB

SK-N-SH
Snyder
JUND
ENCSR000EIB
r=1.00

small heat map img

SK-N-SH
Snyder
JUND
ENCSR000BSK
r=0.81

small heat map img

SK-N-SH
Snyder
H3K4me3
ENCSR000DXR
r=0.17

small heat map img

SK-N-SH
Snyder
H3K36me3
ENCSR000DXO
r=0.02

small heat map img

SK-N-SH
Snyder
H3K27me3
ENCSR000DXP
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 15,632 (download )

T47D - Myers - ENCSR000BVO

T47D
Myers
JUND
ENCSR000BVO
r=1.00

small heat map img
1,909 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at JUND peaks

A549 - Myers - ENCSR000BRF

A549
Myers
JUND
ENCSR000BRF
r=1.00

small heat map img

A549
Myers
FOSL2
ENCSR000BQO
r=0.62

small heat map img

A549
Myers
SP1
ENCSR000BPE
r=0.59

small heat map img

A549
Myers
GATA3
ENCSR000BTI
r=0.55

small heat map img

A549
Myers
TEAD4
ENCSR000BUD
r=0.54

small heat map img

A549
Myers
CEBPB
ENCSR000BUB
r=0.52

small heat map img

A549
Myers
EP300
ENCSR000BPW
r=0.51

small heat map img

A549
Myers
TCF12
ENCSR000BQQ
r=0.47

small heat map img

A549
Myers
MAX
ENCSR000BTJ
r=0.46

small heat map img

A549
Myers
PBX3
ENCSR000BTN
r=0.46

small heat map img

A549
Myers
ZBTB33
ENCSR000BPZ
r=0.45

small heat map img

A549
Myers
FOXA2
ENCSR000BRE
r=0.45

small heat map img

A549
Myers
RAD21
ENCSR000BUC
r=0.43

small heat map img

A549
Myers
ATF3
ENCSR000BPS
r=0.43

small heat map img

A549
Myers
FOXA1
ENCSR000BPX
r=0.43

small heat map img

A549
Myers
CEBPB
ENCSR000DYI
r=0.42

small heat map img

A549
Myers
BCL3
ENCSR000BQH
r=0.41

small heat map img

A549
Myers
NR3C1
ENCSR000BHF
r=0.41

small heat map img

A549
Myers
RAD21
ENCSR000DYE
r=0.38

small heat map img

A549
Myers
MAX
ENCSR000DYG
r=0.38

small heat map img

A549
Myers
BHLHE40
ENCSR000DYJ
r=0.36

small heat map img

A549
Myers
MYC
ENCSR000DYC
r=0.35

small heat map img

A549
Myers
NR3C1
ENCSR000BHG
r=0.34

small heat map img

A549
Myers
ETS1
ENCSR000BPU
r=0.33

small heat map img

A549
Myers
SIN3A
ENCSR000BRM
r=0.32

small heat map img

A549
Myers
CREB1
ENCSR000BRB
r=0.32

small heat map img

A549
Myers
USF1
ENCSR000BHX
r=0.32

small heat map img

A549
Myers
REST
ENCSR000BQP
r=0.31

small heat map img

A549
Myers
NR3C1
ENCSR000BJR
r=0.30

small heat map img

A549
Myers
E2F6
ENCSR000BTC
r=0.30

small heat map img

A549
Myers
GABPA
ENCSR000BPY
r=0.28

small heat map img

A549
Myers
SIX5
ENCSR000BRL
r=0.27

small heat map img

A549
Myers
YY1
ENCSR000BPM
r=0.26

small heat map img

A549
Myers
NR3C1
ENCSR000BHE
r=0.24

small heat map img

A549
Myers
CTCF
ENCSR000DYD
r=0.22

small heat map img

A549
Myers
ELF1
ENCSR000BPT
r=0.20

small heat map img

A549
Myers
USF1
ENCSR000BJB
r=0.20

small heat map img

A549
Myers
TAF1
ENCSR000BPF
r=0.19

small heat map img

A549
Myers
USF1
ENCSR000BPV
r=0.17

small heat map img

A549
Myers
POLR2A
ENCSR000BHH
r=0.13

small heat map img

A549
Myers
POLR2A
ENCSR000BHI
r=0.12

small heat map img

A549
Myers
CTCF
ENCSR000AUF
r=0.12

small heat map img

A549
Myers
POLR2A
ENCSR000DMZ
r=0.11

small heat map img

A549
Myers
CTCF
ENCSR000DNA
r=0.11

small heat map img

A549
Myers
CTCF
ENCSR000BHV
r=0.09

small heat map img

A549
Myers
CTCF
ENCSR000AUE
r=0.09

small heat map img

A549
Myers
CTCF
ENCSR000BHW
r=0.08

small heat map img

A549
Myers
CTCF
ENCSR000DPF
r=0.07

small heat map img
8,907 peaks (download )

GM12878 - Snyder - ENCSR000DYS

GM12878
Snyder
JUND
ENCSR000DYS
r=1.00

small heat map img

GM12878
Snyder
SREBF1
ENCSR000DYU
r=0.74

small heat map img

GM12878
Snyder
BHLHE40
ENCSR000DZJ
r=0.73

small heat map img

GM12878
Snyder
TBL1XR1
ENCSR000DYZ
r=0.68

small heat map img

GM12878
Snyder
EP300
ENCSR000DZG
r=0.65

small heat map img

GM12878
Snyder
RCOR1
ENCSR000DZC
r=0.65

small heat map img

GM12878
Snyder
EP300
ENCSR000DZD
r=0.63

small heat map img

GM12878
Snyder
RELA
ENCSR000EAG
r=0.62

small heat map img

GM12878
Snyder
RUNX3
ENCSR000BRI
r=0.62

small heat map img

GM12878
Snyder
BATF
ENCSR000BGT
r=0.62

small heat map img

GM12878
Snyder
STAT1
ENCSR000DZM
r=0.61

small heat map img

GM12878
Snyder
CHD1
ENCSR000DZE
r=0.61

small heat map img

GM12878
Snyder
MXI1
ENCSR000DZI
r=0.61

small heat map img

GM12878
Snyder
JUND
ENCSR000EYV
r=0.60

small heat map img

GM12878
Snyder
SP1
ENCSR000BHK
r=0.60

small heat map img

GM12878
Snyder
EP300
ENCSR000BHB
r=0.59

small heat map img

GM12878
Snyder
ELK1
ENCSR000DZB
r=0.59

small heat map img

GM12878
Snyder
STAT3
ENCSR000DZV
r=0.59

small heat map img

GM12878
Snyder
ATF2
ENCSR000BQK
r=0.58

small heat map img

GM12878
Snyder
ESRRA
ENCSR000DYQ
r=0.57

small heat map img

GM12878
Snyder
FOXM1
ENCSR000BRU
r=0.56

small heat map img

GM12878
Snyder
MAX
ENCSR000DZF
r=0.56

small heat map img

GM12878
Snyder
CUX1
ENCSR000DYR
r=0.55

small heat map img

GM12878
Snyder
NFIC
ENCSR000BRN
r=0.53

small heat map img

GM12878
Snyder
TBP
ENCSR000DZZ
r=0.53

small heat map img

GM12878
Snyder
BRCA1
ENCSR000DZS
r=0.52

small heat map img

GM12878
Snyder
CREB1
ENCSR000BUF
r=0.52

small heat map img

GM12878
Snyder
IRF4
ENCSR000BGY
r=0.52

small heat map img

GM12878
Snyder
SMC3
ENCSR000DZP
r=0.52

small heat map img

GM12878
Snyder
MAFK
ENCSR000DYV
r=0.50

small heat map img

GM12878
Snyder
E2F4
ENCSR000DYY
r=0.49

small heat map img

GM12878
Snyder
SREBF2
ENCSR000DYT
r=0.49

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHD
r=0.49

small heat map img

GM12878
Snyder
BCL11A
ENCSR000BHA
r=0.49

small heat map img

GM12878
Snyder
RAD21
ENCSR000EAC
r=0.48

small heat map img

GM12878
Snyder
PML
ENCSR000BQM
r=0.48

small heat map img

GM12878
Snyder
BCL3
ENCSR000BNQ
r=0.47

small heat map img

GM12878
Snyder
IRF3
ENCSR000DZX
r=0.47

small heat map img

GM12878
Snyder
RFX5
ENCSR000DZW
r=0.47

small heat map img

GM12878
Snyder
FOS
ENCSR000EYZ
r=0.47

small heat map img

GM12878
Snyder
SIN3A
ENCSR000DYX
r=0.47

small heat map img

GM12878
Snyder
CEBPB
ENCSR000BRX
r=0.46

small heat map img

GM12878
Snyder
NFATC1
ENCSR000BQL
r=0.45

small heat map img

GM12878
Snyder
TCF12
ENCSR000BGZ
r=0.44

small heat map img

GM12878
Snyder
MEF2A
ENCSR000BKB
r=0.44

small heat map img

GM12878
Snyder
WRNIP1
ENCSR000EAA
r=0.43

small heat map img

GM12878
Snyder
ELF1
ENCSR000BMB
r=0.43

small heat map img

GM12878
Snyder
STAT5A
ENCSR000BQZ
r=0.42

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHJ
r=0.42

small heat map img

GM12878
Snyder
NRF1
ENCSR000DZO
r=0.41

small heat map img

GM12878
Snyder
IKZF1
ENCSR000EUJ
r=0.41

small heat map img

GM12878
Snyder
NFE2
ENCSR000DZY
r=0.41

small heat map img

GM12878
Snyder
ZNF384
ENCSR000DYP
r=0.41

small heat map img

GM12878
Snyder
SIX5
ENCSR000BJE
r=0.40

small heat map img

GM12878
Snyder
TCF3
ENCSR000BQT
r=0.40

small heat map img

GM12878
Snyder
POU2F2
ENCSR000BGP
r=0.40

small heat map img

GM12878
Snyder
EBF1
ENCSR000DZQ
r=0.40

small heat map img

GM12878
Snyder
USF2
ENCSR000DZU
r=0.39

small heat map img

GM12878
Snyder
SRF
ENCSR000BMI
r=0.38

small heat map img

GM12878
Snyder
MTA3
ENCSR000BRH
r=0.37

small heat map img

GM12878
Snyder
ZNF143
ENCSR000DZL
r=0.37

small heat map img

GM12878
Snyder
POLR2A
ENCSR000DKT
r=0.37

small heat map img

GM12878
Snyder
YY1
ENCSR000BNP
r=0.37

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EAD
r=0.36

small heat map img

GM12878
Snyder
ETS1
ENCSR000BKA
r=0.35

small heat map img

GM12878
Snyder
EBF1
ENCSR000BGU
r=0.33

small heat map img

GM12878
Snyder
MYC
ENCSR000DKU
r=0.33

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EYW
r=0.33

small heat map img

GM12878
Snyder
EGR1
ENCSR000BMQ
r=0.31

small heat map img

GM12878
Snyder
NFYB
ENCSR000DNM
r=0.29

small heat map img

GM12878
Snyder
EZH2
ENCSR000ARD
r=0.28

small heat map img

GM12878
Snyder
NFYA
ENCSR000DNN
r=0.28

small heat map img

GM12878
Snyder
SPI1
ENCSR000BGQ
r=0.26

small heat map img

GM12878
Snyder
CTCF
ENCSR000DZN
r=0.26

small heat map img

GM12878
Snyder
KAT2A
ENCSR000DNO
r=0.25

small heat map img

GM12878
Snyder
POLR2A
ENCSR000BGD
r=0.25

small heat map img

GM12878
Snyder
RXRA
ENCSR000BJD
r=0.23

small heat map img

GM12878
Snyder
TAF1
ENCSR000BGS
r=0.22

small heat map img

GM12878
Snyder
YY1
ENCSR000EUM
r=0.22

small heat map img

GM12878
Snyder
SUPT20H
ENCSR000DNP
r=0.22

small heat map img

GM12878
Snyder
PBX3
ENCSR000BGR
r=0.21

small heat map img

GM12878
Snyder
MEF2C
ENCSR000BNG
r=0.20

small heat map img

GM12878
Snyder
EGR1
ENCSR000BRG
r=0.18

small heat map img

GM12878
Snyder
GABPA
ENCSR000BGC
r=0.18

small heat map img

GM12878
Snyder
CTCF
ENCSR000DKV
r=0.18

small heat map img

GM12878
Snyder
RAD21
ENCSR000BMY
r=0.17

small heat map img

GM12878
Snyder
USF1
ENCSR000BGI
r=0.17

small heat map img

GM12878
Snyder
POLR3G
ENCSR000EYU
r=0.16

small heat map img

GM12878
Snyder
CTCF
ENCSR000AKB
r=0.15

small heat map img

GM12878
Snyder
ATF3
ENCSR000BJY
r=0.14

small heat map img

GM12878
Snyder
ZBTB33
ENCSR000BHC
r=0.14

small heat map img

GM12878
Snyder
SRF
ENCSR000BGE
r=0.12

small heat map img

GM12878
Snyder
CTCF
ENCSR000DRZ
r=0.12

small heat map img

GM12878
Snyder
ZEB1
ENCSR000BND
r=0.11

small heat map img

GM12878
Snyder
NR2C2
ENCSR000EUL
r=0.10

small heat map img

GM12878
Snyder
REST
ENCSR000BQS
r=0.07

small heat map img

GM12878
Snyder
REST
ENCSR000BGF
r=0.07

small heat map img

GM12878
Snyder
ZZZ3
ENCSR000DNQ
r=-0.03

small heat map img

GM12878
Snyder
ZNF274
ENCSR000EUK
r=-0.04

small heat map img
2,506 peaks (download )

GM12878 - Weissman - ENCSR000EYV

GM12878
Weissman
JUND
ENCSR000EYV
r=1.00

small heat map img

GM12878
Weissman
BATF
ENCSR000BGT
r=0.85

small heat map img

GM12878
Weissman
JUND
ENCSR000DYS
r=0.83

small heat map img

GM12878
Weissman
EP300
ENCSR000DZG
r=0.75

small heat map img

GM12878
Weissman
RELA
ENCSR000EAG
r=0.72

small heat map img

GM12878
Weissman
RUNX3
ENCSR000BRI
r=0.71

small heat map img

GM12878
Weissman
ATF2
ENCSR000BQK
r=0.71

small heat map img

GM12878
Weissman
EP300
ENCSR000DZD
r=0.70

small heat map img

GM12878
Weissman
TBL1XR1
ENCSR000DYZ
r=0.70

small heat map img

GM12878
Weissman
NFIC
ENCSR000BRN
r=0.69

small heat map img

GM12878
Weissman
STAT3
ENCSR000DZV
r=0.68

small heat map img

GM12878
Weissman
FOXM1
ENCSR000BRU
r=0.68

small heat map img

GM12878
Weissman
RCOR1
ENCSR000DZC
r=0.66

small heat map img

GM12878
Weissman
IRF4
ENCSR000BGY
r=0.64

small heat map img

GM12878
Weissman
BHLHE40
ENCSR000DZJ
r=0.63

small heat map img

GM12878
Weissman
CUX1
ENCSR000DYR
r=0.61

small heat map img

GM12878
Weissman
SREBF1
ENCSR000DYU
r=0.61

small heat map img

GM12878
Weissman
MXI1
ENCSR000DZI
r=0.60

small heat map img

GM12878
Weissman
CREB1
ENCSR000BUF
r=0.60

small heat map img

GM12878
Weissman
NFATC1
ENCSR000BQL
r=0.59

small heat map img

GM12878
Weissman
MEF2A
ENCSR000BKB
r=0.59

small heat map img

GM12878
Weissman
SP1
ENCSR000BHK
r=0.59

small heat map img

GM12878
Weissman
CEBPB
ENCSR000BRX
r=0.58

small heat map img

GM12878
Weissman
BCL3
ENCSR000BNQ
r=0.58

small heat map img

GM12878
Weissman
BCL11A
ENCSR000BHA
r=0.57

small heat map img

GM12878
Weissman
IKZF1
ENCSR000EUJ
r=0.56

small heat map img

GM12878
Weissman
RAD21
ENCSR000EAC
r=0.53

small heat map img

GM12878
Weissman
STAT5A
ENCSR000BQZ
r=0.53

small heat map img

GM12878
Weissman
SMC3
ENCSR000DZP
r=0.52

small heat map img

GM12878
Weissman
STAT1
ENCSR000DZM
r=0.51

small heat map img

GM12878
Weissman
ESRRA
ENCSR000DYQ
r=0.50

small heat map img

GM12878
Weissman
FOS
ENCSR000EYZ
r=0.49

small heat map img

GM12878
Weissman
MTA3
ENCSR000BRH
r=0.48

small heat map img

GM12878
Weissman
PML
ENCSR000BQM
r=0.48

small heat map img

GM12878
Weissman
ELK1
ENCSR000DZB
r=0.48

small heat map img

GM12878
Weissman
TBP
ENCSR000DZZ
r=0.47

small heat map img

GM12878
Weissman
RFX5
ENCSR000DZW
r=0.46

small heat map img

GM12878
Weissman
EBF1
ENCSR000DZQ
r=0.45

small heat map img

GM12878
Weissman
MAFK
ENCSR000DYV
r=0.44

small heat map img

GM12878
Weissman
EZH2
ENCSR000ARD
r=0.44

small heat map img

GM12878
Weissman
MAX
ENCSR000DZF
r=0.43

small heat map img

GM12878
Weissman
ZNF384
ENCSR000DYP
r=0.43

small heat map img

GM12878
Weissman
POU2F2
ENCSR000BGP
r=0.43

small heat map img

GM12878
Weissman
EP300
ENCSR000BHB
r=0.43

small heat map img

GM12878
Weissman
PAX5
ENCSR000BHJ
r=0.42

small heat map img

GM12878
Weissman
SREBF2
ENCSR000DYT
r=0.41

small heat map img

GM12878
Weissman
IRF3
ENCSR000DZX
r=0.40

small heat map img

GM12878
Weissman
ZNF143
ENCSR000DZL
r=0.40

small heat map img

GM12878
Weissman
PAX5
ENCSR000BHD
r=0.39

small heat map img

GM12878
Weissman
NFE2
ENCSR000DZY
r=0.38

small heat map img

GM12878
Weissman
TCF3
ENCSR000BQT
r=0.38

small heat map img

GM12878
Weissman
EBF1
ENCSR000BGU
r=0.36

small heat map img

GM12878
Weissman
TCF12
ENCSR000BGZ
r=0.36

small heat map img

GM12878
Weissman
CHD1
ENCSR000DZE
r=0.36

small heat map img

GM12878
Weissman
USF2
ENCSR000DZU
r=0.35

small heat map img

GM12878
Weissman
E2F4
ENCSR000DYY
r=0.35

small heat map img

GM12878
Weissman
SPI1
ENCSR000BGQ
r=0.34

small heat map img

GM12878
Weissman
SIN3A
ENCSR000DYX
r=0.34

small heat map img

GM12878
Weissman
SRF
ENCSR000BMI
r=0.33

small heat map img

GM12878
Weissman
NFYB
ENCSR000DNM
r=0.33

small heat map img

GM12878
Weissman
YY1
ENCSR000EUM
r=0.33

small heat map img

GM12878
Weissman
NRF1
ENCSR000DZO
r=0.32

small heat map img

GM12878
Weissman
ETS1
ENCSR000BKA
r=0.32

small heat map img

GM12878
Weissman
BRCA1
ENCSR000DZS
r=0.30

small heat map img

GM12878
Weissman
WRNIP1
ENCSR000EAA
r=0.26

small heat map img

GM12878
Weissman
ELF1
ENCSR000BMB
r=0.25

small heat map img

GM12878
Weissman
RXRA
ENCSR000BJD
r=0.24

small heat map img

GM12878
Weissman
NFYA
ENCSR000DNN
r=0.24

small heat map img

GM12878
Weissman
POLR2A
ENCSR000EAD
r=0.23

small heat map img

GM12878
Weissman
MEF2C
ENCSR000BNG
r=0.23

small heat map img

GM12878
Weissman
CTCF
ENCSR000DZN
r=0.23

small heat map img

GM12878
Weissman
PBX3
ENCSR000BGR
r=0.21

small heat map img

GM12878
Weissman
SIX5
ENCSR000BJE
r=0.20

small heat map img

GM12878
Weissman
POLR2A
ENCSR000EYW
r=0.20

small heat map img

GM12878
Weissman
YY1
ENCSR000BNP
r=0.18

small heat map img

GM12878
Weissman
POLR2A
ENCSR000DKT
r=0.18

small heat map img

GM12878
Weissman
RAD21
ENCSR000BMY
r=0.17

small heat map img

GM12878
Weissman
SUPT20H
ENCSR000DNP
r=0.17

small heat map img

GM12878
Weissman
KAT2A
ENCSR000DNO
r=0.17

small heat map img

GM12878
Weissman
MYC
ENCSR000DKU
r=0.15

small heat map img

GM12878
Weissman
POLR3G
ENCSR000EYU
r=0.15

small heat map img

GM12878
Weissman
EGR1
ENCSR000BMQ
r=0.12

small heat map img

GM12878
Weissman
CTCF
ENCSR000DKV
r=0.12

small heat map img

GM12878
Weissman
TAF1
ENCSR000BGS
r=0.08

small heat map img

GM12878
Weissman
ZBTB33
ENCSR000BHC
r=0.08

small heat map img

GM12878
Weissman
CTCF
ENCSR000AKB
r=0.08

small heat map img

GM12878
Weissman
ATF3
ENCSR000BJY
r=0.07

small heat map img

GM12878
Weissman
ZNF274
ENCSR000EUK
r=0.07

small heat map img

GM12878
Weissman
POLR2A
ENCSR000BGD
r=0.05

small heat map img

GM12878
Weissman
ZEB1
ENCSR000BND
r=0.04

small heat map img

GM12878
Weissman
REST
ENCSR000BQS
r=0.04

small heat map img

GM12878
Weissman
CTCF
ENCSR000DRZ
r=0.03

small heat map img

GM12878
Weissman
SRF
ENCSR000BGE
r=0.01

small heat map img

GM12878
Weissman
GABPA
ENCSR000BGC
r=0.00

small heat map img

GM12878
Weissman
REST
ENCSR000BGF
r=0.00

small heat map img

GM12878
Weissman
USF1
ENCSR000BGI
r=0.00

small heat map img

GM12878
Weissman
ZZZ3
ENCSR000DNQ
r=-0.00

small heat map img

GM12878
Weissman
EGR1
ENCSR000BRG
r=-0.01

small heat map img

GM12878
Weissman
NR2C2
ENCSR000EUL
r=-0.05

small heat map img
2,472 peaks (download )

H1-hESC - Myers - ENCSR000BKP

H1-hESC
Myers
JUND
ENCSR000BKP
r=1.00

small heat map img

H1-hESC
Myers
JUND
ENCSR000EBZ
r=0.50

small heat map img

H1-hESC
Myers
JUN
ENCSR000ECA
r=0.46

small heat map img

H1-hESC
Myers
TEAD4
ENCSR000BRY
r=0.34

small heat map img

H1-hESC
Myers
SP1
ENCSR000BIR
r=0.34

small heat map img

H1-hESC
Myers
CEBPB
ENCSR000EBV
r=0.33

small heat map img

H1-hESC
Myers
MAFK
ENCSR000EBS
r=0.32

small heat map img

H1-hESC
Myers
BRCA1
ENCSR000EBX
r=0.32

small heat map img

H1-hESC
Myers
RFX5
ENCSR000ECF
r=0.31

small heat map img

H1-hESC
Myers
MXI1
ENCSR000EBR
r=0.29

small heat map img

H1-hESC
Myers
ATF2
ENCSR000BQU
r=0.29

small heat map img

H1-hESC
Myers
MYC
ENCSR000EBY
r=0.29

small heat map img

H1-hESC
Myers
CHD7
ENCSR000AVA
r=0.28

small heat map img

H1-hESC
Myers
EP300
ENCSR000AUQ
r=0.28

small heat map img

H1-hESC
Myers
MAX
ENCSR000EUP
r=0.26

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000EBO
r=0.26

small heat map img

H1-hESC
Myers
BACH1
ENCSR000EBQ
r=0.26

small heat map img

H1-hESC
Myers
CTBP2
ENCSR000EUO
r=0.25

small heat map img

H1-hESC
Myers
CREB1
ENCSR000BSN
r=0.24

small heat map img

H1-hESC
Myers
MAX
ENCSR000BSJ
r=0.24

small heat map img

H1-hESC
Myers
EP300
ENCSR000BKK
r=0.24

small heat map img

H1-hESC
Myers
ZNF143
ENCSR000EBW
r=0.22

small heat map img

H1-hESC
Myers
TBP
ENCSR000ECB
r=0.22

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BMJ
r=0.22

small heat map img

H1-hESC
Myers
YY1
ENCSR000BKD
r=0.22

small heat map img

H1-hESC
Myers
NRF1
ENCSR000ECC
r=0.22

small heat map img

H1-hESC
Myers
USF2
ENCSR000ECD
r=0.21

small heat map img

H1-hESC
Myers
EGR1
ENCSR000BJA
r=0.21

small heat map img

H1-hESC
Myers
TCF12
ENCSR000BIT
r=0.21

small heat map img

H1-hESC
Myers
RAD21
ENCSR000ECE
r=0.21

small heat map img

H1-hESC
Myers
SIRT6
ENCSR000AUS
r=0.20

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000DLJ
r=0.20

small heat map img

H1-hESC
Myers
HDAC6
ENCSR000ATQ
r=0.20

small heat map img

H1-hESC
Myers
CHD1
ENCSR000EBU
r=0.20

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BIP
r=0.19

small heat map img

H1-hESC
Myers
TAF1
ENCSR000BHO
r=0.19

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000BIS
r=0.18

small heat map img

H1-hESC
Myers
GABPA
ENCSR000BIW
r=0.18

small heat map img

H1-hESC
Myers
NANOG
ENCSR000BMT
r=0.18

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000BHN
r=0.18

small heat map img

H1-hESC
Myers
E2F6
ENCSR000BSI
r=0.17

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000AVB
r=0.17

small heat map img

H1-hESC
Myers
SP4
ENCSR000BQV
r=0.17

small heat map img

H1-hESC
Myers
ATF3
ENCSR000BKC
r=0.17

small heat map img

H1-hESC
Myers
RBBP5
ENCSR000AQC
r=0.16

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000BNR
r=0.16

small heat map img

H1-hESC
Myers
TAF7
ENCSR000BLU
r=0.14

small heat map img

H1-hESC
Myers
RAD21
ENCSR000BLD
r=0.14

small heat map img

H1-hESC
Myers
SRF
ENCSR000BIV
r=0.14

small heat map img

H1-hESC
Myers
FOSL1
ENCSR000BNS
r=0.14

small heat map img

H1-hESC
Myers
SIX5
ENCSR000BIQ
r=0.12

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000ATS
r=0.12

small heat map img

H1-hESC
Myers
RXRA
ENCSR000BJW
r=0.12

small heat map img

H1-hESC
Myers
USF1
ENCSR000BIU
r=0.12

small heat map img

H1-hESC
Myers
CTCF
ENCSR000AMF
r=0.12

small heat map img

H1-hESC
Myers
CTCF
ENCSR000DLK
r=0.11

small heat map img

H1-hESC
Myers
KDM5A
ENCSR000AQL
r=0.11

small heat map img

H1-hESC
Myers
CTCF
ENCSR000BNH
r=0.11

small heat map img

H1-hESC
Myers
PHF8
ENCSR000ATK
r=0.10

small heat map img

H1-hESC
Myers
SAP30
ENCSR000ATR
r=0.09

small heat map img

H1-hESC
Myers
KDM5B
ENCSR000AUR
r=0.09

small heat map img

H1-hESC
Myers
KDM4A
ENCSR000AVC
r=0.08

small heat map img

H1-hESC
Myers
SP2
ENCSR000BQG
r=0.07

small heat map img

H1-hESC
Myers
EZH2
ENCSR000ASY
r=0.07

small heat map img

H1-hESC
Myers
CHD1
ENCSR000AQK
r=0.06

small heat map img

H1-hESC
Myers
ZNF274
ENCSR000EUN
r=0.06

small heat map img

H1-hESC
Myers
REST
ENCSR000BHM
r=0.05

small heat map img

H1-hESC
Myers
MYC
ENCSR000DLI
r=0.05

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000EUQ
r=0.05

small heat map img
8,447 peaks (download )

H1-hESC - Snyder - ENCSR000EBZ

H1-hESC
Snyder
JUND
ENCSR000EBZ
r=1.00

small heat map img

H1-hESC
Snyder
JUN
ENCSR000ECA
r=0.77

small heat map img

H1-hESC
Snyder
BRCA1
ENCSR000EBX
r=0.56

small heat map img

H1-hESC
Snyder
CEBPB
ENCSR000EBV
r=0.56

small heat map img

H1-hESC
Snyder
MYC
ENCSR000EBY
r=0.56

small heat map img

H1-hESC
Snyder
MXI1
ENCSR000EBR
r=0.55

small heat map img

H1-hESC
Snyder
TEAD4
ENCSR000BRY
r=0.52

small heat map img

H1-hESC
Snyder
SIN3A
ENCSR000EBO
r=0.52

small heat map img

H1-hESC
Snyder
MAX
ENCSR000EUP
r=0.51

small heat map img

H1-hESC
Snyder
MAFK
ENCSR000EBS
r=0.50

small heat map img

H1-hESC
Snyder
CHD7
ENCSR000AVA
r=0.50

small heat map img

H1-hESC
Snyder
BACH1
ENCSR000EBQ
r=0.49

small heat map img

H1-hESC
Snyder
JUND
ENCSR000BKP
r=0.48

small heat map img

H1-hESC
Snyder
CTBP2
ENCSR000EUO
r=0.47

small heat map img

H1-hESC
Snyder
ZNF143
ENCSR000EBW
r=0.46

small heat map img

H1-hESC
Snyder
EP300
ENCSR000AUQ
r=0.45

small heat map img

H1-hESC
Snyder
TBP
ENCSR000ECB
r=0.45

small heat map img

H1-hESC
Snyder
USF2
ENCSR000ECD
r=0.44

small heat map img

H1-hESC
Snyder
MAX
ENCSR000BSJ
r=0.44

small heat map img

H1-hESC
Snyder
RBBP5
ENCSR000AQC
r=0.42

small heat map img

H1-hESC
Snyder
CHD1
ENCSR000EBU
r=0.42

small heat map img

H1-hESC
Snyder
ATF2
ENCSR000BQU
r=0.41

small heat map img

H1-hESC
Snyder
HDAC2
ENCSR000AVB
r=0.40

small heat map img

H1-hESC
Snyder
CREB1
ENCSR000BSN
r=0.40

small heat map img

H1-hESC
Snyder
NRF1
ENCSR000ECC
r=0.40

small heat map img

H1-hESC
Snyder
SP1
ENCSR000BIR
r=0.39

small heat map img

H1-hESC
Snyder
POLR2A
ENCSR000DLJ
r=0.39

small heat map img

H1-hESC
Snyder
RAD21
ENCSR000ECE
r=0.38

small heat map img

H1-hESC
Snyder
SIRT6
ENCSR000AUS
r=0.36

small heat map img

H1-hESC
Snyder
RFX5
ENCSR000ECF
r=0.36

small heat map img

H1-hESC
Snyder
YY1
ENCSR000BKD
r=0.35

small heat map img

H1-hESC
Snyder
TAF1
ENCSR000BHO
r=0.34

small heat map img

H1-hESC
Snyder
E2F6
ENCSR000BSI
r=0.34

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000AMF
r=0.33

small heat map img

H1-hESC
Snyder
EP300
ENCSR000BKK
r=0.30

small heat map img

H1-hESC
Snyder
POLR2A
ENCSR000BHN
r=0.30

small heat map img

H1-hESC
Snyder
RAD21
ENCSR000BLD
r=0.30

small heat map img

H1-hESC
Snyder
SAP30
ENCSR000ATR
r=0.29

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000DLK
r=0.29

small heat map img

H1-hESC
Snyder
KDM4A
ENCSR000AVC
r=0.28

small heat map img

H1-hESC
Snyder
HDAC6
ENCSR000ATQ
r=0.28

small heat map img

H1-hESC
Snyder
GABPA
ENCSR000BIW
r=0.28

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000BNH
r=0.28

small heat map img

H1-hESC
Snyder
PHF8
ENCSR000ATK
r=0.27

small heat map img

H1-hESC
Snyder
SUZ12
ENCSR000ATS
r=0.27

small heat map img

H1-hESC
Snyder
KDM5A
ENCSR000AQL
r=0.26

small heat map img

H1-hESC
Snyder
ATF3
ENCSR000BKC
r=0.23

small heat map img

H1-hESC
Snyder
EZH2
ENCSR000ASY
r=0.23

small heat map img

H1-hESC
Snyder
SIN3A
ENCSR000BIS
r=0.23

small heat map img

H1-hESC
Snyder
SP4
ENCSR000BQV
r=0.22

small heat map img

H1-hESC
Snyder
TCF12
ENCSR000BIT
r=0.21

small heat map img

H1-hESC
Snyder
CHD1
ENCSR000AQK
r=0.20

small heat map img

H1-hESC
Snyder
EGR1
ENCSR000BJA
r=0.20

small heat map img

H1-hESC
Snyder
SRF
ENCSR000BIV
r=0.20

small heat map img

H1-hESC
Snyder
USF1
ENCSR000BIU
r=0.20

small heat map img

H1-hESC
Snyder
HDAC2
ENCSR000BNR
r=0.19

small heat map img

H1-hESC
Snyder
SIX5
ENCSR000BIQ
r=0.19

small heat map img

H1-hESC
Snyder
TAF7
ENCSR000BLU
r=0.18

small heat map img

H1-hESC
Snyder
KDM5B
ENCSR000AUR
r=0.18

small heat map img

H1-hESC
Snyder
NANOG
ENCSR000BMT
r=0.17

small heat map img

H1-hESC
Snyder
BCL11A
ENCSR000BIP
r=0.17

small heat map img

H1-hESC
Snyder
BCL11A
ENCSR000BMJ
r=0.16

small heat map img

H1-hESC
Snyder
FOSL1
ENCSR000BNS
r=0.14

small heat map img

H1-hESC
Snyder
SP2
ENCSR000BQG
r=0.12

small heat map img

H1-hESC
Snyder
MYC
ENCSR000DLI
r=0.11

small heat map img

H1-hESC
Snyder
SUZ12
ENCSR000EUQ
r=0.11

small heat map img

H1-hESC
Snyder
RXRA
ENCSR000BJW
r=0.09

small heat map img

H1-hESC
Snyder
REST
ENCSR000BHM
r=0.09

small heat map img

H1-hESC
Snyder
ZNF274
ENCSR000EUN
r=0.06

small heat map img
9,550 peaks (download )

HCT116 - Myers - ENCSR000BSA

HCT116
Myers
JUND
ENCSR000BSA
r=1.00

small heat map img

HCT116
Myers
FOSL1
ENCSR000BTE
r=0.89

small heat map img

HCT116
Myers
SP1
ENCSR000BSF
r=0.88

small heat map img

HCT116
Myers
CEBPB
ENCSR000BSD
r=0.79

small heat map img

HCT116
Myers
CBX3
ENCSR000BUH
r=0.79

small heat map img

HCT116
Myers
SRF
ENCSR000BSC
r=0.78

small heat map img

HCT116
Myers
SIN3A
ENCSR000BSG
r=0.78

small heat map img

HCT116
Myers
MAX
ENCSR000BSH
r=0.78

small heat map img

HCT116
Myers
ATF3
ENCSR000BUG
r=0.76

small heat map img

HCT116
Myers
TEAD4
ENCSR000BVJ
r=0.76

small heat map img

HCT116
Myers
USF1
ENCSR000BVK
r=0.72

small heat map img

HCT116
Myers
RAD21
ENCSR000BSB
r=0.69

small heat map img

HCT116
Myers
EGR1
ENCSR000BRZ
r=0.62

small heat map img

HCT116
Myers
ELF1
ENCSR000BVH
r=0.62

small heat map img

HCT116
Myers
TCF7L2
ENCSR000EUV
r=0.61

small heat map img

HCT116
Myers
REST
ENCSR000BVI
r=0.48

small heat map img

HCT116
Myers
ZBTB33
ENCSR000BNY
r=0.37

small heat map img

HCT116
Myers
CTCF
ENCSR000BSE
r=0.31

small heat map img

HCT116
Myers
YY1
ENCSR000BNX
r=0.23

small heat map img

HCT116
Myers
POLR2A
ENCSR000EUU
r=0.22

small heat map img

HCT116
Myers
CTCF
ENCSR000DTO
r=0.16

small heat map img
8,479 peaks (download )

HeLa-S3 - Snyder - ENCSR000EDH

HeLa-S3
Snyder
JUND
ENCSR000EDH
r=1.00

small heat map img

HeLa-S3
Snyder
JUN
ENCSR000EDG
r=0.91

small heat map img

HeLa-S3
Snyder
FOS
ENCSR000EZE
r=0.80

small heat map img

HeLa-S3
Snyder
EP300
ENCSR000ECV
r=0.77

small heat map img

HeLa-S3
Snyder
STAT3
ENCSR000EDC
r=0.76

small heat map img

HeLa-S3
Snyder
RCOR1
ENCSR000ECM
r=0.71

small heat map img

HeLa-S3
Snyder
MAFK
ENCSR000ECK
r=0.66

small heat map img

HeLa-S3
Snyder
RFX5
ENCSR000ECX
r=0.64

small heat map img

HeLa-S3
Snyder
BRCA1
ENCSR000EDB
r=0.63

small heat map img

HeLa-S3
Snyder
MAX
ENCSR000ECN
r=0.63

small heat map img

HeLa-S3
Snyder
CEBPB
ENCSR000EDA
r=0.63

small heat map img

HeLa-S3
Snyder
MAX
ENCSR000EZF
r=0.59

small heat map img

HeLa-S3
Snyder
MXI1
ENCSR000ECU
r=0.59

small heat map img

HeLa-S3
Snyder
MYC
ENCSR000EZD
r=0.58

small heat map img

HeLa-S3
Snyder
RAD21
ENCSR000EDE
r=0.58

small heat map img

HeLa-S3
Snyder
SMC3
ENCSR000ECS
r=0.57

small heat map img

HeLa-S3
Snyder
ZKSCAN1
ENCSR000ECJ
r=0.56

small heat map img

HeLa-S3
Snyder
ELK1
ENCSR000ECI
r=0.55

small heat map img

HeLa-S3
Snyder
PRDM1
ENCSR000ECY
r=0.54

small heat map img

HeLa-S3
Snyder
MYC
ENCSR000DLN
r=0.54

small heat map img

HeLa-S3
Snyder
HCFC1
ENCSR000ECH
r=0.52

small heat map img

HeLa-S3
Snyder
TCF7L2
ENCSR000EVE
r=0.52

small heat map img

HeLa-S3
Snyder
USF2
ENCSR000ECW
r=0.52

small heat map img

HeLa-S3
Snyder
TBP
ENCSR000EDD
r=0.50

small heat map img

HeLa-S3
Snyder
SMARCC1
ENCSR000EDM
r=0.50

small heat map img

HeLa-S3
Snyder
IRF3
ENCSR000EDF
r=0.48

small heat map img

HeLa-S3
Snyder
STAT1
ENCSR000EZK
r=0.47

small heat map img

HeLa-S3
Snyder
ZNF143
ENCSR000ECO
r=0.44

small heat map img

HeLa-S3
Snyder
SMARCC2
ENCSR000EDL
r=0.42

small heat map img

HeLa-S3
Snyder
NFYA
ENCSR000DNS
r=0.40

small heat map img

HeLa-S3
Snyder
NFYB
ENCSR000DNR
r=0.39

small heat map img

HeLa-S3
Snyder
TCF7L2
ENCSR000EVF
r=0.39

small heat map img

HeLa-S3
Snyder
SMARCA4
ENCSR000EZC
r=0.37

small heat map img

HeLa-S3
Snyder
ELK4
ENCSR000EVI
r=0.35

small heat map img

HeLa-S3
Snyder
NRF1
ENCSR000EDJ
r=0.34

small heat map img

HeLa-S3
Snyder
GTF3C2
ENCSR000DNY
r=0.29

small heat map img

HeLa-S3
Snyder
SMARCB1
ENCSR000EDK
r=0.27

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000DLM
r=0.24

small heat map img

HeLa-S3
Snyder
SUPT20H
ENCSR000ECQ
r=0.24

small heat map img

HeLa-S3
Snyder
KAT2A
ENCSR000ECR
r=0.22

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000DLO
r=0.20

small heat map img

HeLa-S3
Snyder
E2F4
ENCSR000EVL
r=0.19

small heat map img

HeLa-S3
Snyder
E2F6
ENCSR000EVK
r=0.19

small heat map img

HeLa-S3
Snyder
NR2C2
ENCSR000EVN
r=0.19

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000BGO
r=0.18

small heat map img

HeLa-S3
Snyder
EZH2
ENCSR000ATC
r=0.18

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000AOA
r=0.16

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000EZL
r=0.15

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000DUB
r=0.14

small heat map img

HeLa-S3
Snyder
BDP1
ENCSR000DNX
r=0.13

small heat map img

HeLa-S3
Snyder
E2F1
ENCSR000EVJ
r=0.12

small heat map img

HeLa-S3
Snyder
POLR3A
ENCSR000DNU
r=0.12

small heat map img

HeLa-S3
Snyder
BRF2
ENCSR000DNV
r=0.10

small heat map img

HeLa-S3
Snyder
TAF1
ENCSR000BHT
r=0.10

small heat map img

HeLa-S3
Snyder
ZNF274
ENCSR000EVG
r=0.10

small heat map img

HeLa-S3
Snyder
ZZZ3
ENCSR000DNT
r=0.08

small heat map img

HeLa-S3
Snyder
GABPA
ENCSR000BHS
r=0.08

small heat map img

HeLa-S3
Snyder
REST
ENCSR000BMN
r=0.08

small heat map img

HeLa-S3
Snyder
BRF1
ENCSR000DNW
r=0.06

small heat map img
10,000 randomly-selected peaks from a total of 31,633 (download )

HepG2 - Myers - ENCSR000BGK

HepG2
Myers
JUND
ENCSR000BGK
r=1.00

small heat map img

HepG2
Myers
FOSL2
ENCSR000BHP
r=0.71

small heat map img

HepG2
Myers
JUND
ENCSR000EEI
r=0.56

small heat map img

HepG2
Myers
SP1
ENCSR000BJX
r=0.48

small heat map img

HepG2
Myers
EP300
ENCSR000EDV
r=0.47

small heat map img

HepG2
Myers
HNF4A
ENCSR000EEU
r=0.46

small heat map img

HepG2
Myers
MXI1
ENCSR000EDU
r=0.46

small heat map img

HepG2
Myers
NR2F2
ENCSR000BVM
r=0.45

small heat map img

HepG2
Myers
RCOR1
ENCSR000EDQ
r=0.45

small heat map img

HepG2
Myers
JUN
ENCSR000EEK
r=0.45

small heat map img

HepG2
Myers
EP300
ENCSR000BLW
r=0.44

small heat map img

HepG2
Myers
TCF12
ENCSR000BJG
r=0.43

small heat map img

HepG2
Myers
MAX
ENCSR000BTM
r=0.43

small heat map img

HepG2
Myers
BHLHE40
ENCSR000EDT
r=0.42

small heat map img

HepG2
Myers
HNF4G
ENCSR000BNJ
r=0.42

small heat map img

HepG2
Myers
ARID3A
ENCSR000EDP
r=0.42

small heat map img

HepG2
Myers
HDAC2
ENCSR000BMC
r=0.41

small heat map img

HepG2
Myers
CREB1
ENCSR000BVL
r=0.41

small heat map img

HepG2
Myers
MAX
ENCSR000EDS
r=0.41

small heat map img

HepG2
Myers
ZEB1
ENCSR000BVN
r=0.40

small heat map img

HepG2
Myers
MYC
ENCSR000DLR
r=0.39

small heat map img

HepG2
Myers
MAFF
ENCSR000EEC
r=0.39

small heat map img

HepG2
Myers
CEBPB
ENCSR000EEX
r=0.39

small heat map img

HepG2
Myers
FOXA1
ENCSR000BMO
r=0.38

small heat map img

HepG2
Myers
MYBL2
ENCSR000BRO
r=0.38

small heat map img

HepG2
Myers
HNF4A
ENCSR000BLF
r=0.38

small heat map img

HepG2
Myers
SMC3
ENCSR000EDW
r=0.38

small heat map img

HepG2
Myers
NFIC
ENCSR000BQX
r=0.37

small heat map img

HepG2
Myers
HSF1
ENCSR000EET
r=0.37

small heat map img

HepG2
Myers
MAFK
ENCSR000EDZ
r=0.36

small heat map img

HepG2
Myers
TEAD4
ENCSR000BRP
r=0.36

small heat map img

HepG2
Myers
FOXA1
ENCSR000BLE
r=0.35

small heat map img

HepG2
Myers
TBP
ENCSR000EEL
r=0.35

small heat map img

HepG2
Myers
MAFK
ENCSR000EEB
r=0.35

small heat map img

HepG2
Myers
RAD21
ENCSR000EEG
r=0.35

small heat map img

HepG2
Myers
BRCA1
ENCSR000EDY
r=0.33

small heat map img

HepG2
Myers
MBD4
ENCSR000BQW
r=0.33

small heat map img

HepG2
Myers
ESRRA
ENCSR000EEW
r=0.33

small heat map img

HepG2
Myers
SREBF1
ENCSR000EEO
r=0.33

small heat map img

HepG2
Myers
RFX5
ENCSR000EEA
r=0.33

small heat map img

HepG2
Myers
POLR2A
ENCSR000BJM
r=0.33

small heat map img

HepG2
Myers
ELF1
ENCSR000BMZ
r=0.32

small heat map img

HepG2
Myers
SIN3A
ENCSR000BGL
r=0.31

small heat map img

HepG2
Myers
POLR2A
ENCSR000EEP
r=0.30

small heat map img

HepG2
Myers
POLR2A
ENCSR000EEM
r=0.30

small heat map img

HepG2
Myers
CEBPB
ENCSR000EEE
r=0.30

small heat map img

HepG2
Myers
CEBPD
ENCSR000BQJ
r=0.30

small heat map img

HepG2
Myers
TAF1
ENCSR000BJN
r=0.29

small heat map img

HepG2
Myers
RAD21
ENCSR000BLS
r=0.29

small heat map img

HepG2
Myers
POLR2A
ENCSR000EZQ
r=0.28

small heat map img

HepG2
Myers
RXRA
ENCSR000BHU
r=0.28

small heat map img

HepG2
Myers
YY1
ENCSR000BNT
r=0.28

small heat map img

HepG2
Myers
NR2C2
ENCSR000EVS
r=0.27

small heat map img

HepG2
Myers
REST
ENCSR000BOT
r=0.27

small heat map img

HepG2
Myers
USF2
ENCSR000EEF
r=0.26

small heat map img

HepG2
Myers
POLR2A
ENCSR000DLQ
r=0.23

small heat map img

HepG2
Myers
CEBPB
ENCSR000BQI
r=0.23

small heat map img

HepG2
Myers
NR3C1
ENCSR000EEV
r=0.23

small heat map img

HepG2
Myers
BHLHE40
ENCSR000BID
r=0.22

small heat map img

HepG2
Myers
ZBTB7A
ENCSR000BQA
r=0.22

small heat map img

HepG2
Myers
USF1
ENCSR000BGM
r=0.21

small heat map img

HepG2
Myers
ATF3
ENCSR000BKE
r=0.20

small heat map img

HepG2
Myers
SREBF1
ENCSR000EZP
r=0.19

small heat map img

HepG2
Myers
TCF7L2
ENCSR000EVQ
r=0.19

small heat map img

HepG2
Myers
SRF
ENCSR000BLV
r=0.18

small heat map img

HepG2
Myers
REST
ENCSR000BJL
r=0.17

small heat map img

HepG2
Myers
SREBF2
ENCSR000EZO
r=0.17

small heat map img

HepG2
Myers
CTCF
ENCSR000DLS
r=0.16

small heat map img

HepG2
Myers
ZBTB33
ENCSR000BHR
r=0.16

small heat map img

HepG2
Myers
CTCF
ENCSR000AMA
r=0.15

small heat map img

HepG2
Myers
CTCF
ENCSR000BIE
r=0.15

small heat map img

HepG2
Myers
IRF3
ENCSR000EEJ
r=0.14

small heat map img

HepG2
Myers
CTCF
ENCSR000DUG
r=0.14

small heat map img

HepG2
Myers
FOXA2
ENCSR000BNI
r=0.13

small heat map img

HepG2
Myers
NRF1
ENCSR000EEH
r=0.12

small heat map img

HepG2
Myers
ZBTB33
ENCSR000BNA
r=0.11

small heat map img

HepG2
Myers
EZH2
ENCSR000ARI
r=0.10

small heat map img

HepG2
Myers
SP2
ENCSR000BOU
r=0.09

small heat map img

HepG2
Myers
GABPA
ENCSR000BJK
r=0.09

small heat map img

HepG2
Myers
ZNF274
ENCSR000EVR
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 21,614 (download )

HepG2 - Snyder - ENCSR000EEI

HepG2
Snyder
JUND
ENCSR000EEI
r=1.00

small heat map img

HepG2
Snyder
JUN
ENCSR000EEK
r=0.86

small heat map img

HepG2
Snyder
FOSL2
ENCSR000BHP
r=0.59

small heat map img

HepG2
Snyder
ARID3A
ENCSR000EDP
r=0.48

small heat map img

HepG2
Snyder
JUND
ENCSR000BGK
r=0.47

small heat map img

HepG2
Snyder
EP300
ENCSR000EDV
r=0.47

small heat map img

HepG2
Snyder
CEBPB
ENCSR000EEE
r=0.43

small heat map img

HepG2
Snyder
MAFF
ENCSR000EEC
r=0.43

small heat map img

HepG2
Snyder
SMC3
ENCSR000EDW
r=0.43

small heat map img

HepG2
Snyder
CEBPB
ENCSR000EEX
r=0.42

small heat map img

HepG2
Snyder
MXI1
ENCSR000EDU
r=0.42

small heat map img

HepG2
Snyder
MAFK
ENCSR000EDZ
r=0.41

small heat map img

HepG2
Snyder
EP300
ENCSR000BLW
r=0.41

small heat map img

HepG2
Snyder
RCOR1
ENCSR000EDQ
r=0.41

small heat map img

HepG2
Snyder
BHLHE40
ENCSR000EDT
r=0.40

small heat map img

HepG2
Snyder
HNF4A
ENCSR000EEU
r=0.39

small heat map img

HepG2
Snyder
MAFK
ENCSR000EEB
r=0.38

small heat map img

HepG2
Snyder
FOXA1
ENCSR000BLE
r=0.38

small heat map img

HepG2
Snyder
NR2F2
ENCSR000BVM
r=0.37

small heat map img

HepG2
Snyder
FOXA1
ENCSR000BMO
r=0.37

small heat map img

HepG2
Snyder
MAX
ENCSR000EDS
r=0.37

small heat map img

HepG2
Snyder
SP1
ENCSR000BJX
r=0.36

small heat map img

HepG2
Snyder
TEAD4
ENCSR000BRP
r=0.36

small heat map img

HepG2
Snyder
RAD21
ENCSR000EEG
r=0.35

small heat map img

HepG2
Snyder
RFX5
ENCSR000EEA
r=0.34

small heat map img

HepG2
Snyder
CREB1
ENCSR000BVL
r=0.34

small heat map img

HepG2
Snyder
MAX
ENCSR000BTM
r=0.34

small heat map img

HepG2
Snyder
HDAC2
ENCSR000BMC
r=0.34

small heat map img

HepG2
Snyder
TBP
ENCSR000EEL
r=0.34

small heat map img

HepG2
Snyder
MYC
ENCSR000DLR
r=0.32

small heat map img

HepG2
Snyder
HNF4G
ENCSR000BNJ
r=0.32

small heat map img

HepG2
Snyder
BRCA1
ENCSR000EDY
r=0.32

small heat map img

HepG2
Snyder
ZEB1
ENCSR000BVN
r=0.32

small heat map img

HepG2
Snyder
HSF1
ENCSR000EET
r=0.31

small heat map img

HepG2
Snyder
HNF4A
ENCSR000BLF
r=0.30

small heat map img

HepG2
Snyder
NFIC
ENCSR000BQX
r=0.29

small heat map img

HepG2
Snyder
MYBL2
ENCSR000BRO
r=0.29

small heat map img

HepG2
Snyder
USF2
ENCSR000EEF
r=0.29

small heat map img

HepG2
Snyder
MBD4
ENCSR000BQW
r=0.28

small heat map img

HepG2
Snyder
TCF12
ENCSR000BJG
r=0.27

small heat map img

HepG2
Snyder
CEBPB
ENCSR000BQI
r=0.24

small heat map img

HepG2
Snyder
ESRRA
ENCSR000EEW
r=0.24

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEM
r=0.24

small heat map img

HepG2
Snyder
TCF7L2
ENCSR000EVQ
r=0.22

small heat map img

HepG2
Snyder
ELF1
ENCSR000BMZ
r=0.22

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EZQ
r=0.22

small heat map img

HepG2
Snyder
RAD21
ENCSR000BLS
r=0.21

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEP
r=0.20

small heat map img

HepG2
Snyder
IRF3
ENCSR000EEJ
r=0.20

small heat map img

HepG2
Snyder
SREBF1
ENCSR000EEO
r=0.20

small heat map img

HepG2
Snyder
NR2C2
ENCSR000EVS
r=0.20

small heat map img

HepG2
Snyder
NR3C1
ENCSR000EEV
r=0.19

small heat map img

HepG2
Snyder
SREBF1
ENCSR000EZP
r=0.19

small heat map img

HepG2
Snyder
SIN3A
ENCSR000BGL
r=0.18

small heat map img

HepG2
Snyder
ATF3
ENCSR000BKE
r=0.18

small heat map img

HepG2
Snyder
NRF1
ENCSR000EEH
r=0.18

small heat map img

HepG2
Snyder
SREBF2
ENCSR000EZO
r=0.18

small heat map img

HepG2
Snyder
CTCF
ENCSR000AMA
r=0.17

small heat map img

HepG2
Snyder
RXRA
ENCSR000BHU
r=0.17

small heat map img

HepG2
Snyder
EZH2
ENCSR000ARI
r=0.17

small heat map img

HepG2
Snyder
CTCF
ENCSR000DLS
r=0.17

small heat map img

HepG2
Snyder
REST
ENCSR000BOT
r=0.17

small heat map img

HepG2
Snyder
USF1
ENCSR000BGM
r=0.17

small heat map img

HepG2
Snyder
YY1
ENCSR000BNT
r=0.17

small heat map img

HepG2
Snyder
POLR2A
ENCSR000DLQ
r=0.16

small heat map img

HepG2
Snyder
CEBPD
ENCSR000BQJ
r=0.16

small heat map img

HepG2
Snyder
FOXA2
ENCSR000BNI
r=0.15

small heat map img

HepG2
Snyder
POLR2A
ENCSR000BJM
r=0.15

small heat map img

HepG2
Snyder
CTCF
ENCSR000DUG
r=0.14

small heat map img

HepG2
Snyder
ZBTB7A
ENCSR000BQA
r=0.14

small heat map img

HepG2
Snyder
SRF
ENCSR000BLV
r=0.14

small heat map img

HepG2
Snyder
BHLHE40
ENCSR000BID
r=0.14

small heat map img

HepG2
Snyder
CTCF
ENCSR000BIE
r=0.13

small heat map img

HepG2
Snyder
ZNF274
ENCSR000EVR
r=0.12

small heat map img

HepG2
Snyder
TAF1
ENCSR000BJN
r=0.11

small heat map img

HepG2
Snyder
SP2
ENCSR000BOU
r=0.07

small heat map img

HepG2
Snyder
REST
ENCSR000BJL
r=0.07

small heat map img

HepG2
Snyder
ZBTB33
ENCSR000BNA
r=0.07

small heat map img

HepG2
Snyder
GABPA
ENCSR000BJK
r=0.06

small heat map img

HepG2
Snyder
ZBTB33
ENCSR000BHR
r=0.06

small heat map img
10,000 randomly-selected peaks from a total of 32,275 (download )

K562 - Snyder - ENCSR000EGN

K562
Snyder
JUND
ENCSR000EGN
r=1.00

small heat map img

K562
Snyder
JUN
ENCSR000EFS
r=0.84

small heat map img

K562
Snyder
JUN
ENCSR000EGH
r=0.83

small heat map img

K562
Snyder
JUN
ENCSR000FAH
r=0.82

small heat map img

K562
Snyder
JUN
ENCSR000EZT
r=0.77

small heat map img

K562
Snyder
ATF1
ENCSR000DNZ
r=0.76

small heat map img

K562
Snyder
RCOR1
ENCSR000EGG
r=0.74

small heat map img

K562
Snyder
JUN
ENCSR000EZW
r=0.73

small heat map img

K562
Snyder
JUN
ENCSR000EZX
r=0.73

small heat map img

K562
Snyder
EP300
ENCSR000EGE
r=0.72

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGB
r=0.71

small heat map img

K562
Snyder
ZMIZ1
ENCSR000EFQ
r=0.66

small heat map img

K562
Snyder
FOS
ENCSR000FAI
r=0.64

small heat map img

K562
Snyder
MYC
ENCSR000EGS
r=0.64

small heat map img

K562
Snyder
ARID3A
ENCSR000EFY
r=0.63

small heat map img

K562
Snyder
MYC
ENCSR000EZU
r=0.62

small heat map img

K562
Snyder
BHLHE40
ENCSR000EGV
r=0.62

small heat map img

K562
Snyder
IRF1
ENCSR000EGK
r=0.62

small heat map img

K562
Snyder
IRF1
ENCSR000EGL
r=0.61

small heat map img

K562
Snyder
RCOR1
ENCSR000EGC
r=0.61

small heat map img

K562
Snyder
MAX
ENCSR000EFV
r=0.61

small heat map img

K562
Snyder
MYC
ENCSR000EZV
r=0.61

small heat map img

K562
Snyder
MYC
ENCSR000EGJ
r=0.61

small heat map img

K562
Snyder
STAT2
ENCSR000FAT
r=0.60

small heat map img

K562
Snyder
MYC
ENCSR000FAZ
r=0.59

small heat map img

K562
Snyder
GATA1
ENCSR000EFT
r=0.59

small heat map img

K562
Snyder
MYC
ENCSR000FAG
r=0.58

small heat map img

K562
Snyder
IRF1
ENCSR000EGT
r=0.58

small heat map img

K562
Snyder
CCNT2
ENCSR000DOA
r=0.57

small heat map img

K562
Snyder
CUX1
ENCSR000EFO
r=0.57

small heat map img

K562
Snyder
MAFK
ENCSR000EGX
r=0.57

small heat map img

K562
Snyder
STAT1
ENCSR000EHJ
r=0.56

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGA
r=0.56

small heat map img

K562
Snyder
TRIM28
ENCSR000BRW
r=0.55

small heat map img

K562
Snyder
STAT1
ENCSR000FAU
r=0.54

small heat map img

K562
Snyder
STAT2
ENCSR000FBC
r=0.54

small heat map img

K562
Snyder
MYC
ENCSR000DLZ
r=0.54

small heat map img

K562
Snyder
CBX3
ENCSR000BRT
r=0.53

small heat map img

K562
Snyder
STAT1
ENCSR000EHK
r=0.53

small heat map img

K562
Snyder
STAT1
ENCSR000FAV
r=0.53

small heat map img

K562
Snyder
KDM1A
ENCSR000ATX
r=0.52

small heat map img

K562
Snyder
SETDB1
ENCSR000AUT
r=0.52

small heat map img

K562
Snyder
MXI1
ENCSR000EGZ
r=0.52

small heat map img

K562
Snyder
EP300
ENCSR000AQB
r=0.51

small heat map img

K562
Snyder
CEBPD
ENCSR000BVY
r=0.51

small heat map img

K562
Snyder
NR2F2
ENCSR000BRS
r=0.51

small heat map img

K562
Snyder
POLR2A
ENCSR000EHL
r=0.51

small heat map img

K562
Snyder
MAFF
ENCSR000EGI
r=0.51

small heat map img

K562
Snyder
CREB1
ENCSR000BSO
r=0.51

small heat map img

K562
Snyder
TEAD4
ENCSR000BRK
r=0.51

small heat map img

K562
Snyder
HMGN3
ENCSR000DOB
r=0.50

small heat map img

K562
Snyder
EP300
ENCSR000EGY
r=0.50

small heat map img

K562
Snyder
STAT5A
ENCSR000BRR
r=0.49

small heat map img

K562
Snyder
ELK1
ENCSR000EFU
r=0.49

small heat map img

K562
Snyder
CEBPB
ENCSR000BRQ
r=0.49

small heat map img

K562
Snyder
SIRT6
ENCSR000DOH
r=0.48

small heat map img

K562
Snyder
ZNF384
ENCSR000EFP
r=0.47

small heat map img

K562
Snyder
E2F4
ENCSR000EWL
r=0.47

small heat map img

K562
Snyder
GATA2
ENCSR000EWG
r=0.47

small heat map img

K562
Snyder
MAX
ENCSR000FAE
r=0.47

small heat map img

K562
Snyder
BACH1
ENCSR000EGD
r=0.46

small heat map img

K562
Snyder
IRF1
ENCSR000EGU
r=0.46

small heat map img

K562
Snyder
UBTF
ENCSR000EFZ
r=0.45

small heat map img

K562
Snyder
HCFC1
ENCSR000EFN
r=0.45

small heat map img

K562
Snyder
MAX
ENCSR000BLP
r=0.45

small heat map img

K562
Snyder
SMARCA4
ENCSR000EHO
r=0.44

small heat map img

K562
Snyder
POLR2A
ENCSR000FAJ
r=0.44

small heat map img

K562
Snyder
FOSL1
ENCSR000BMV
r=0.44

small heat map img

K562
Snyder
CHD7
ENCSR000AVD
r=0.44

small heat map img

K562
Snyder
UBTF
ENCSR000EFW
r=0.44

small heat map img

K562
Snyder
TAL1
ENCSR000EHB
r=0.44

small heat map img

K562
Snyder
HDAC1
ENCSR000AQF
r=0.43

small heat map img

K562
Snyder
KAT2B
ENCSR000ATZ
r=0.43

small heat map img

K562
Snyder
GATA2
ENCSR000BKM
r=0.43

small heat map img

K562
Snyder
POLR2A
ENCSR000FAX
r=0.43

small heat map img

K562
Snyder
SMARCB1
ENCSR000EHN
r=0.43

small heat map img

K562
Snyder
POLR2A
ENCSR000FAY
r=0.43

small heat map img

K562
Snyder
NFE2
ENCSR000FAF
r=0.43

small heat map img

K562
Snyder
CEBPB
ENCSR000EHE
r=0.42

small heat map img

K562
Snyder
POLR2A
ENCSR000DLY
r=0.42

small heat map img

K562
Snyder
POLR2A
ENCSR000EHP
r=0.41

small heat map img

K562
Snyder
HDAC2
ENCSR000AQG
r=0.41

small heat map img

K562
Snyder
RBBP5
ENCSR000AQI
r=0.41

small heat map img

K562
Snyder
POLR2A
ENCSR000BMR
r=0.40

small heat map img

K562
Snyder
GTF2B
ENCSR000DOE
r=0.40

small heat map img

K562
Snyder
POLR2A
ENCSR000FAW
r=0.40

small heat map img

K562
Snyder
KDM5B
ENCSR000AQA
r=0.40

small heat map img

K562
Snyder
GATA1
ENCSR000EWM
r=0.39

small heat map img

K562
Snyder
NFYA
ENCSR000EGR
r=0.39

small heat map img

K562
Snyder
ATF3
ENCSR000BNU
r=0.39

small heat map img

K562
Snyder
ZNF143
ENCSR000EGP
r=0.39

small heat map img

K562
Snyder
SMC3
ENCSR000EGW
r=0.39

small heat map img

K562
Snyder
E2F6
ENCSR000EWJ
r=0.39

small heat map img

K562
Snyder
EGR1
ENCSR000BNE
r=0.38

small heat map img

K562
Snyder
TBP
ENCSR000EHA
r=0.38

small heat map img

K562
Snyder
PML
ENCSR000BQY
r=0.37

small heat map img

K562
Snyder
RFX5
ENCSR000EGO
r=0.37

small heat map img

K562
Snyder
NCOR1
ENCSR000ATY
r=0.36

small heat map img

K562
Snyder
REST
ENCSR000BMW
r=0.36

small heat map img

K562
Snyder
EZH2
ENCSR000AQE
r=0.35

small heat map img

K562
Snyder
WHSC1
ENCSR000AVE
r=0.34

small heat map img

K562
Snyder
TAF1
ENCSR000BKS
r=0.34

small heat map img

K562
Snyder
HDAC6
ENCSR000ATJ
r=0.34

small heat map img

K562
Snyder
USF1
ENCSR000BKT
r=0.34

small heat map img

K562
Snyder
GABPA
ENCSR000BLO
r=0.33

small heat map img

K562
Snyder
YY1
ENCSR000BKU
r=0.33

small heat map img

K562
Snyder
SAP30
ENCSR000AQJ
r=0.33

small heat map img

K562
Snyder
ATF3
ENCSR000DOG
r=0.33

small heat map img

K562
Snyder
HDAC2
ENCSR000BMG
r=0.32

small heat map img

K562
Snyder
GTF3C2
ENCSR000DOD
r=0.32

small heat map img

K562
Snyder
SETDB1
ENCSR000EWI
r=0.32

small heat map img

K562
Snyder
TRIM28
ENCSR000EVY
r=0.31

small heat map img

K562
Snyder
ELF1
ENCSR000BMD
r=0.31

small heat map img

K562
Snyder
RAD21
ENCSR000FAD
r=0.31

small heat map img

K562
Snyder
CBX3
ENCSR000ATV
r=0.30

small heat map img

K562
Snyder
SRF
ENCSR000BLK
r=0.30

small heat map img

K562
Snyder
NRF1
ENCSR000EHH
r=0.30

small heat map img

K562
Snyder
ZNF274
ENCSR000EVX
r=0.29

small heat map img

K562
Snyder
USF2
ENCSR000EHG
r=0.29

small heat map img

K562
Snyder
CTCF
ENCSR000EGM
r=0.28

small heat map img

K562
Snyder
BRF2
ENCSR000DOC
r=0.28

small heat map img

K562
Snyder
ETS1
ENCSR000BKQ
r=0.28

small heat map img

K562
Snyder
SIRT6
ENCSR000AUB
r=0.28

small heat map img

K562
Snyder
CHD4
ENCSR000ATL
r=0.27

small heat map img

K562
Snyder
PHF8
ENCSR000AQH
r=0.27

small heat map img

K562
Snyder
YY1
ENCSR000EWF
r=0.26

small heat map img

K562
Snyder
MEF2A
ENCSR000BNV
r=0.26

small heat map img

K562
Snyder
RNF2
ENCSR000AUA
r=0.26

small heat map img

K562
Snyder
SPI1
ENCSR000BGW
r=0.26

small heat map img

K562
Snyder
CREBBP
ENCSR000ATT
r=0.25

small heat map img

K562
Snyder
ZNF263
ENCSR000EWN
r=0.25

small heat map img

K562
Snyder
CHD1
ENCSR000AQD
r=0.24

small heat map img

K562
Snyder
NFYB
ENCSR000EGQ
r=0.24

small heat map img

K562
Snyder
SP1
ENCSR000BKO
r=0.23

small heat map img

K562
Snyder
CTCF
ENCSR000AKO
r=0.22

small heat map img

K562
Snyder
BDP1
ENCSR000DOK
r=0.22

small heat map img

K562
Snyder
CTCF
ENCSR000DMA
r=0.22

small heat map img

K562
Snyder
ZBTB7A
ENCSR000BME
r=0.21

small heat map img

K562
Snyder
E2F6
ENCSR000BLI
r=0.21

small heat map img

K562
Snyder
XRCC4
ENCSR000FAC
r=0.21

small heat map img

K562
Snyder
CTCF
ENCSR000BPJ
r=0.20

small heat map img

K562
Snyder
CTCF
ENCSR000DWE
r=0.20

small heat map img

K562
Snyder
RAD21
ENCSR000BKV
r=0.19

small heat map img

K562
Snyder
SIN3A
ENCSR000BLR
r=0.18

small heat map img

K562
Snyder
REST
ENCSR000ATM
r=0.18

small heat map img

K562
Snyder
SETDB1
ENCSR000EWD
r=0.18

small heat map img

K562
Snyder
SUZ12
ENCSR000AUC
r=0.17

small heat map img

K562
Snyder
THAP1
ENCSR000BNN
r=0.17

small heat map img

K562
Snyder
CTCFL
ENCSR000BNK
r=0.16

small heat map img

K562
Snyder
YY1
ENCSR000BMH
r=0.16

small heat map img

K562
Snyder
TAF7
ENCSR000BNM
r=0.16

small heat map img

K562
Snyder
POLR3G
ENCSR000EHQ
r=0.15

small heat map img

K562
Snyder
SIX5
ENCSR000BGX
r=0.15

small heat map img

K562
Snyder
BRF1
ENCSR000DOJ
r=0.15

small heat map img

K562
Snyder
SP2
ENCSR000BNL
r=0.15

small heat map img

K562
Snyder
SIX5
ENCSR000BNW
r=0.13

small heat map img

K562
Snyder
ZBTB33
ENCSR000BKF
r=0.13

small heat map img

K562
Snyder
POLR3A
ENCSR000DOI
r=0.12

small heat map img

K562
Snyder
NR2C2
ENCSR000EWH
r=0.11

small heat map img

K562
Snyder
CBX8
ENCSR000ATW
r=0.06

small heat map img

K562
Snyder
CBX2
ENCSR000ATU
r=0.05

small heat map img

K562
Snyder
ZNF274
ENCSR000EWE
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 40,052 (download )

MCF-7 - Myers - ENCSR000BSU

MCF-7
Myers
JUND
ENCSR000BSU
r=1.00

small heat map img

MCF-7
Myers
FOSL2
ENCSR000BUI
r=0.79

small heat map img

MCF-7
Myers
SIN3A
ENCSR000BUM
r=0.73

small heat map img

MCF-7
Myers
HDAC2
ENCSR000BTP
r=0.72

small heat map img

MCF-7
Myers
GABPA
ENCSR000BUK
r=0.68

small heat map img

MCF-7
Myers
MAX
ENCSR000BUL
r=0.66

small heat map img

MCF-7
Myers
NR2F2
ENCSR000BUY
r=0.66

small heat map img

MCF-7
Myers
FOXM1
ENCSR000BUJ
r=0.64

small heat map img

MCF-7
Myers
ZNF217
ENCSR000EWU
r=0.64

small heat map img

MCF-7
Myers
EP300
ENCSR000BTR
r=0.64

small heat map img

MCF-7
Myers
TEAD4
ENCSR000BUO
r=0.63

small heat map img

MCF-7
Myers
GATA3
ENCSR000BST
r=0.63

small heat map img

MCF-7
Myers
TCF12
ENCSR000BUN
r=0.61

small heat map img

MCF-7
Myers
SRF
ENCSR000BVA
r=0.59

small heat map img

MCF-7
Myers
ELF1
ENCSR000BSS
r=0.58

small heat map img

MCF-7
Myers
RAD21
ENCSR000BTQ
r=0.55

small heat map img

MCF-7
Myers
GATA3
ENCSR000EWS
r=0.53

small heat map img

MCF-7
Myers
MYC
ENCSR000DMQ
r=0.53

small heat map img

MCF-7
Myers
EGR1
ENCSR000BUX
r=0.53

small heat map img

MCF-7
Myers
CEBPB
ENCSR000BSR
r=0.52

small heat map img

MCF-7
Myers
PML
ENCSR000BUZ
r=0.52

small heat map img

MCF-7
Myers
TCF7L2
ENCSR000EWT
r=0.52

small heat map img

MCF-7
Myers
MYC
ENCSR000DMP
r=0.48

small heat map img

MCF-7
Myers
REST
ENCSR000BSP
r=0.47

small heat map img

MCF-7
Myers
TAF1
ENCSR000AHF
r=0.46

small heat map img

MCF-7
Myers
GATA3
ENCSR000EWV
r=0.43

small heat map img

MCF-7
Myers
MYC
ENCSR000DMM
r=0.38

small heat map img

MCF-7
Myers
CTCF
ENCSR000AHD
r=0.34

small heat map img

MCF-7
Myers
POLR2A
ENCSR000DMT
r=0.30

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMR
r=0.28

small heat map img

MCF-7
Myers
CTCF
ENCSR000DWH
r=0.26

small heat map img

MCF-7
Myers
CTCF
ENCSR000DML
r=0.25

small heat map img

MCF-7
Myers
MYC
ENCSR000DMJ
r=0.25

small heat map img

MCF-7
Myers
POLR2A
ENCSR000DMN
r=0.24

small heat map img

MCF-7
Myers
POLR2A
ENCSR000DMK
r=0.24

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMO
r=0.24

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMV
r=0.23

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMS
r=0.22

small heat map img
2,389 peaks (download )

SK-N-SH - Myers - ENCSR000BSK

SK-N-SH
Myers
JUND
ENCSR000BSK
r=1.00

small heat map img

SK-N-SH
Myers
FOSL2
ENCSR000BVB
r=0.90

small heat map img

SK-N-SH
Myers
EP300
ENCSR000BUA
r=0.85

small heat map img

SK-N-SH
Myers
JUND
ENCSR000EIB
r=0.85

small heat map img

SK-N-SH
Myers
TCF12
ENCSR000BSL
r=0.85

small heat map img

SK-N-SH
Myers
PBX3
ENCSR000BVE
r=0.83

small heat map img

SK-N-SH
Myers
NFIC
ENCSR000BSV
r=0.81

small heat map img

SK-N-SH
Myers
GATA3
ENCSR000BTH
r=0.79

small heat map img

SK-N-SH
Myers
RXRA
ENCSR000BVG
r=0.78

small heat map img

SK-N-SH
Myers
TEAD4
ENCSR000BUQ
r=0.73

small heat map img

SK-N-SH
Myers
MEF2A
ENCSR000BVC
r=0.71

small heat map img

SK-N-SH
Myers
ZBTB33
ENCSR000BTS
r=0.69

small heat map img

SK-N-SH
Myers
MAX
ENCSR000BVD
r=0.66

small heat map img

SK-N-SH
Myers
EP300
ENCSR000EHV
r=0.64

small heat map img

SK-N-SH
Myers
EP300
ENCSR000BMA
r=0.63

small heat map img

SK-N-SH
Myers
FOXM1
ENCSR000BTB
r=0.62

small heat map img

SK-N-SH
Myers
ELF1
ENCSR000BTA
r=0.60

small heat map img

SK-N-SH
Myers
SMC3
ENCSR000EHW
r=0.49

small heat map img

SK-N-SH
Myers
RAD21
ENCSR000EHX
r=0.47

small heat map img

SK-N-SH
Myers
GABPA
ENCSR000BTG
r=0.46

small heat map img

SK-N-SH
Myers
USF1
ENCSR000BTZ
r=0.44

small heat map img

SK-N-SH
Myers
MXI1
ENCSR000EIA
r=0.44

small heat map img

SK-N-SH
Myers
RAD21
ENCSR000BLY
r=0.42

small heat map img

SK-N-SH
Myers
RFX5
ENCSR000EHY
r=0.41

small heat map img

SK-N-SH
Myers
REST
ENCSR000BOZ
r=0.38

small heat map img

SK-N-SH
Myers
YY1
ENCSR000BSM
r=0.37

small heat map img

SK-N-SH
Myers
CTCF
ENCSR000EIC
r=0.29

small heat map img

SK-N-SH
Myers
SIN3A
ENCSR000BPB
r=0.29

small heat map img

SK-N-SH
Myers
NRF1
ENCSR000EHZ
r=0.28

small heat map img

SK-N-SH
Myers
YY1
ENCSR000BLZ
r=0.25

small heat map img

SK-N-SH
Myers
USF1
ENCSR000BMF
r=0.22

small heat map img

SK-N-SH
Myers
TAF1
ENCSR000BQF
r=0.15

small heat map img

SK-N-SH
Myers
CTCF
ENCSR000DXQ
r=0.11

small heat map img

SK-N-SH
Myers
CTCF
ENCSR000BLX
r=0.05

small heat map img

SK-N-SH
Myers
REST
ENCSR000BJJ
r=0.04

small heat map img
10,000 randomly-selected peaks from a total of 0 (download )

SK-N-SH - Snyder - ENCSR000EIB

SK-N-SH
Snyder
JUND
ENCSR000EIB
r=1.00

small heat map img

SK-N-SH
Snyder
FOSL2
ENCSR000BVB
r=0.83

small heat map img

SK-N-SH
Snyder
JUND
ENCSR000BSK
r=0.81

small heat map img

SK-N-SH
Snyder
TCF12
ENCSR000BSL
r=0.72

small heat map img

SK-N-SH
Snyder
EP300
ENCSR000BUA
r=0.71

small heat map img

SK-N-SH
Snyder
PBX3
ENCSR000BVE
r=0.69

small heat map img

SK-N-SH
Snyder
NFIC
ENCSR000BSV
r=0.67

small heat map img

SK-N-SH
Snyder
GATA3
ENCSR000BTH
r=0.65

small heat map img

SK-N-SH
Snyder
RXRA
ENCSR000BVG
r=0.65

small heat map img

SK-N-SH
Snyder
EP300
ENCSR000EHV
r=0.64

small heat map img

SK-N-SH
Snyder
MAX
ENCSR000BVD
r=0.62

small heat map img

SK-N-SH
Snyder
ZBTB33
ENCSR000BTS
r=0.59

small heat map img

SK-N-SH
Snyder
MEF2A
ENCSR000BVC
r=0.58

small heat map img

SK-N-SH
Snyder
TEAD4
ENCSR000BUQ
r=0.57

small heat map img

SK-N-SH
Snyder
EP300
ENCSR000BMA
r=0.55

small heat map img

SK-N-SH
Snyder
ELF1
ENCSR000BTA
r=0.54

small heat map img

SK-N-SH
Snyder
SMC3
ENCSR000EHW
r=0.48

small heat map img

SK-N-SH
Snyder
FOXM1
ENCSR000BTB
r=0.46

small heat map img

SK-N-SH
Snyder
RAD21
ENCSR000EHX
r=0.46

small heat map img

SK-N-SH
Snyder
RFX5
ENCSR000EHY
r=0.45

small heat map img

SK-N-SH
Snyder
MXI1
ENCSR000EIA
r=0.43

small heat map img

SK-N-SH
Snyder
GABPA
ENCSR000BTG
r=0.43

small heat map img

SK-N-SH
Snyder
USF1
ENCSR000BTZ
r=0.40

small heat map img

SK-N-SH
Snyder
RAD21
ENCSR000BLY
r=0.39

small heat map img

SK-N-SH
Snyder
REST
ENCSR000BOZ
r=0.35

small heat map img

SK-N-SH
Snyder
YY1
ENCSR000BSM
r=0.34

small heat map img

SK-N-SH
Snyder
NRF1
ENCSR000EHZ
r=0.33

small heat map img

SK-N-SH
Snyder
CTCF
ENCSR000EIC
r=0.30

small heat map img

SK-N-SH
Snyder
YY1
ENCSR000BLZ
r=0.27

small heat map img

SK-N-SH
Snyder
USF1
ENCSR000BMF
r=0.27

small heat map img

SK-N-SH
Snyder
SIN3A
ENCSR000BPB
r=0.24

small heat map img

SK-N-SH
Snyder
TAF1
ENCSR000BQF
r=0.17

small heat map img

SK-N-SH
Snyder
CTCF
ENCSR000DXQ
r=0.16

small heat map img

SK-N-SH
Snyder
CTCF
ENCSR000BLX
r=0.09

small heat map img

SK-N-SH
Snyder
REST
ENCSR000BJJ
r=0.09

small heat map img
10,000 randomly-selected peaks from a total of 15,632 (download )

T47D - Myers - ENCSR000BVO

T47D
Myers
JUND
ENCSR000BVO
r=1.00

small heat map img

T47D
Myers
GATA3
ENCSR000BMX
r=0.76

small heat map img

T47D
Myers
EP300
ENCSR000BLM
r=0.74

small heat map img

T47D
Myers
FOXA1
ENCSR000BKY
r=0.70

small heat map img

T47D
Myers
ESR1
ENCSR000BJS
r=0.60

small heat map img

T47D
Myers
ESR1
ENCSR000BKN
r=0.56

small heat map img

T47D
Myers
ESR1
ENCSR000BQD
r=0.52

small heat map img

T47D
Myers
CTCF
ENCSR000BNO
r=0.05

small heat map img
1,909 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DYS

loading

GM12878 - Weissman - ENCSR000EYV

loading

K562 - Snyder - ENCSR000EGN

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help