HSF1 - Factorbook

The product of this gene is a heat-shock transcription factor. Transcription of heat-shock genes is rapidly induced after temperature stress. Hsp90, by itself and/or associated with multichaperone complexes, is a major repressor of this gene. RefSeq, Jul 2008

Heat shock factor protein 1 is a protein that in humans is encoded by the HSF1 gene.wikipedia

HSF1
PDB 2LDU
PDB	2LDU
ENCODE	experiments
Ensemble	search
Entrez	3297
GO	search
Gene Card	search
HGNC	search
RefSeq	search
UCSC	browse
UniProt	search
Wikipedia	HSF1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

HepG2 - Snyder - ENCSR000EET

Legend

Proximal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Distal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

HepG2 - Snyder

HepG2 - Snyder - ENCSR000EET

1. 193 / 500 3.3e-498 GGATTCGAACCCGGG		p-value: 0.20 pct_center: 0.10 pct_ratio: 0.73
2. 213 / 500 2.4e-310 GTGGCTCAGTGGTTA		p-value: 0.00 pct_center: 0.10 pct_ratio: 0.88
3. 97 / 500 5.7e-267 CTTTGGATTAGGAGTCCAACG		p-value: 0.01 pct_center: 0.08 pct_ratio: 0.71
4. 173 / 500 8.4e-239 AGAACCTTCTAGAAG		p-value: 0.00 pct_center: 0.34 pct_ratio: 1.84
5. 52 / 500 4.7e-100 TCTCGCATGCTAAGCGAG		p-value: 0.00 pct_center: 0.07 pct_ratio: 0.79

MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at HSF1 peaks

HepG2 - Snyder

HepG2 - Snyder - ENCSR000EET

HepG2 Snyder HSF1 ENCSR000EET r=1.00
HepG2 Snyder H3K4me3 ENCSR000AMP r=0.37
HepG2 Snyder H3K4me2 ENCSR000AMC r=0.34
HepG2 Snyder H3K4me3 ENCSR000DUF r=0.32
HepG2 Snyder H3K9ac ENCSR000AMD r=0.32
HepG2 Snyder H2AFZ ENCSR000AOK r=0.32
HepG2 Snyder H3K27ac ENCSR000AMO r=0.29
HepG2 Snyder H3K27me3 ENCSR000AOL r=0.21
HepG2 Snyder H3K4me1 ENCSR000APV r=0.10
HepG2 Snyder H4K20me1 ENCSR000AMQ r=0.05
HepG2 Snyder H3K27me3 ENCSR000DUE r=0.04
HepG2 Snyder H3K79me2 ENCSR000AOM r=0.02
HepG2 Snyder H3K9me3 ENCSR000ATD r=0.01
HepG2 Snyder H3K36me3 ENCSR000DUD r=-0.04
HepG2 Snyder H3K36me3 ENCSR000AMB r=-0.07

1,435 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

Binding of other TFs at HSF1 peaks

HepG2 - Snyder

HepG2 - Snyder - ENCSR000EET

HepG2 Snyder HSF1 ENCSR000EET r=1.00
HepG2 Snyder CEBPB ENCSR000EEX r=0.67
HepG2 Snyder TBP ENCSR000EEL r=0.62
HepG2 Snyder MYBL2 ENCSR000BRO r=0.62
HepG2 Snyder FOSL2 ENCSR000BHP r=0.58
HepG2 Snyder RCOR1 ENCSR000EDQ r=0.57
HepG2 Snyder NR2F2 ENCSR000BVM r=0.55
HepG2 Snyder ARID3A ENCSR000EDP r=0.54
HepG2 Snyder MAX ENCSR000BTM r=0.53
HepG2 Snyder TEAD4 ENCSR000BRP r=0.53
HepG2 Snyder EP300 ENCSR000EDV r=0.52
HepG2 Snyder HNF4A ENCSR000EEU r=0.52
HepG2 Snyder MYC ENCSR000DLR r=0.51
HepG2 Snyder ZEB1 ENCSR000BVN r=0.50
HepG2 Snyder MAX ENCSR000EDS r=0.48
HepG2 Snyder SREBF2 ENCSR000EZO r=0.48
HepG2 Snyder MXI1 ENCSR000EDU r=0.46
HepG2 Snyder NFIC ENCSR000BQX r=0.46
HepG2 Snyder SMC3 ENCSR000EDW r=0.46
HepG2 Snyder ESRRA ENCSR000EEW r=0.45
HepG2 Snyder BRCA1 ENCSR000EDY r=0.45
HepG2 Snyder HDAC2 ENCSR000BMC r=0.44
HepG2 Snyder CREB1 ENCSR000BVL r=0.44
HepG2 Snyder MAFF ENCSR000EEC r=0.43
HepG2 Snyder TCF12 ENCSR000BJG r=0.42
HepG2 Snyder JUND ENCSR000BGK r=0.42
HepG2 Snyder JUND ENCSR000EEI r=0.42
HepG2 Snyder SREBF1 ENCSR000EZP r=0.42
HepG2 Snyder BHLHE40 ENCSR000EDT r=0.41
HepG2 Snyder MAFK ENCSR000EEB r=0.41
HepG2 Snyder SP1 ENCSR000BJX r=0.40
HepG2 Snyder MAFK ENCSR000EDZ r=0.39
HepG2 Snyder NR3C1 ENCSR000EEV r=0.38
HepG2 Snyder HNF4G ENCSR000BNJ r=0.38
HepG2 Snyder MBD4 ENCSR000BQW r=0.38
HepG2 Snyder JUN ENCSR000EEK r=0.37
HepG2 Snyder SREBF1 ENCSR000EEO r=0.37
HepG2 Snyder EP300 ENCSR000BLW r=0.37
HepG2 Snyder ELF1 ENCSR000BMZ r=0.36
HepG2 Snyder RAD21 ENCSR000EEG r=0.36
HepG2 Snyder USF2 ENCSR000EEF r=0.35
HepG2 Snyder CEBPB ENCSR000EEE r=0.35
HepG2 Snyder IRF3 ENCSR000EEJ r=0.34
HepG2 Snyder SIN3A ENCSR000BGL r=0.34
HepG2 Snyder FOXA1 ENCSR000BMO r=0.33
HepG2 Snyder RFX5 ENCSR000EEA r=0.33
HepG2 Snyder HNF4A ENCSR000BLF r=0.31
HepG2 Snyder NRF1 ENCSR000EEH r=0.31
HepG2 Snyder CEBPB ENCSR000BQI r=0.28
HepG2 Snyder FOXA1 ENCSR000BLE r=0.28
HepG2 Snyder REST ENCSR000BOT r=0.26
HepG2 Snyder NR2C2 ENCSR000EVS r=0.26
HepG2 Snyder RAD21 ENCSR000BLS r=0.26
HepG2 Snyder BHLHE40 ENCSR000BID r=0.25
HepG2 Snyder RXRA ENCSR000BHU r=0.24
HepG2 Snyder YY1 ENCSR000BNT r=0.24
HepG2 Snyder USF1 ENCSR000BGM r=0.23
HepG2 Snyder CEBPD ENCSR000BQJ r=0.23
HepG2 Snyder CTCF ENCSR000DLS r=0.22
HepG2 Snyder TAF1 ENCSR000BJN r=0.22
HepG2 Snyder ZBTB33 ENCSR000BHR r=0.22
HepG2 Snyder SRF ENCSR000BLV r=0.22
HepG2 Snyder GABPA ENCSR000BJK r=0.22
HepG2 Snyder POLR2A ENCSR000EEP r=0.20
HepG2 Snyder CTCF ENCSR000BIE r=0.20
HepG2 Snyder ZBTB7A ENCSR000BQA r=0.20
HepG2 Snyder POLR2A ENCSR000EEM r=0.19
HepG2 Snyder POLR2A ENCSR000EZQ r=0.19
HepG2 Snyder POLR2A ENCSR000BJM r=0.19
HepG2 Snyder CTCF ENCSR000AMA r=0.18
HepG2 Snyder POLR2A ENCSR000DLQ r=0.18
HepG2 Snyder REST ENCSR000BJL r=0.18
HepG2 Snyder CTCF ENCSR000DUG r=0.17
HepG2 Snyder ZBTB33 ENCSR000BNA r=0.14
HepG2 Snyder ATF3 ENCSR000BKE r=0.14
HepG2 Snyder SP2 ENCSR000BOU r=0.12
HepG2 Snyder TCF7L2 ENCSR000EVQ r=0.12
HepG2 Snyder EZH2 ENCSR000ARI r=0.12
HepG2 Snyder FOXA2 ENCSR000BNI r=0.09
HepG2 Snyder ZNF274 ENCSR000EVR r=0.03

1,435 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.