HSF1

The product of this gene is a heat-shock transcription factor. Transcription of heat-shock genes is rapidly induced after temperature stress. Hsp90, by itself and/or associated with multichaperone complexes, is a major repressor of this gene. RefSeq, Jul 2008
Heat shock factor protein 1 is a protein that in humans is encoded by the HSF1 gene.wikipedia

HSF1

PDB image
PDB 2LDU

PDB 2LDU
ENCODE experiments
Ensemble search
Entrez 3297
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia HSF1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

HepG2 - Snyder - ENCSR000EET

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

HepG2 - Snyder - ENCSR000EET

1.
193 / 500
3.3e-498
GGATTCGAACCCGGG
small heat map img p-value: 0.20
pct_center: 0.10
pct_ratio: 0.73
2.
213 / 500
2.4e-310
GTGGCTCAGTGGTTA
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.88
3.
97 / 500
5.7e-267
CTTTGGATTAGGAGTCCAACG
small heat map img p-value: 0.01
pct_center: 0.08
pct_ratio: 0.71
4.
173 / 500
8.4e-239
AGAACCTTCTAGAAG
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 1.84
5.
52 / 500
4.7e-100
TCTCGCATGCTAAGCGAG
small heat map img p-value: 0.00
pct_center: 0.07
pct_ratio: 0.79
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at HSF1 peaks

HepG2 - Snyder - ENCSR000EET

HepG2
Snyder
HSF1
ENCSR000EET
r=1.00

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000AMP
r=0.37

small heat map img

HepG2
Snyder
H3K4me2
ENCSR000AMC
r=0.34

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000DUF
r=0.32

small heat map img

HepG2
Snyder
H3K9ac
ENCSR000AMD
r=0.32

small heat map img

HepG2
Snyder
H2AFZ
ENCSR000AOK
r=0.32

small heat map img

HepG2
Snyder
H3K27ac
ENCSR000AMO
r=0.29

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000AOL
r=0.21

small heat map img

HepG2
Snyder
H3K4me1
ENCSR000APV
r=0.10

small heat map img

HepG2
Snyder
H4K20me1
ENCSR000AMQ
r=0.05

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000DUE
r=0.04

small heat map img

HepG2
Snyder
H3K79me2
ENCSR000AOM
r=0.02

small heat map img

HepG2
Snyder
H3K9me3
ENCSR000ATD
r=0.01

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000DUD
r=-0.04

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000AMB
r=-0.07

small heat map img
1,435 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at HSF1 peaks

HepG2 - Snyder - ENCSR000EET

HepG2
Snyder
HSF1
ENCSR000EET
r=1.00

small heat map img

HepG2
Snyder
CEBPB
ENCSR000EEX
r=0.67

small heat map img

HepG2
Snyder
TBP
ENCSR000EEL
r=0.62

small heat map img

HepG2
Snyder
MYBL2
ENCSR000BRO
r=0.62

small heat map img

HepG2
Snyder
FOSL2
ENCSR000BHP
r=0.58

small heat map img

HepG2
Snyder
RCOR1
ENCSR000EDQ
r=0.57

small heat map img

HepG2
Snyder
NR2F2
ENCSR000BVM
r=0.55

small heat map img

HepG2
Snyder
ARID3A
ENCSR000EDP
r=0.54

small heat map img

HepG2
Snyder
MAX
ENCSR000BTM
r=0.53

small heat map img

HepG2
Snyder
TEAD4
ENCSR000BRP
r=0.53

small heat map img

HepG2
Snyder
EP300
ENCSR000EDV
r=0.52

small heat map img

HepG2
Snyder
HNF4A
ENCSR000EEU
r=0.52

small heat map img

HepG2
Snyder
MYC
ENCSR000DLR
r=0.51

small heat map img

HepG2
Snyder
ZEB1
ENCSR000BVN
r=0.50

small heat map img

HepG2
Snyder
MAX
ENCSR000EDS
r=0.48

small heat map img

HepG2
Snyder
SREBF2
ENCSR000EZO
r=0.48

small heat map img

HepG2
Snyder
MXI1
ENCSR000EDU
r=0.46

small heat map img

HepG2
Snyder
NFIC
ENCSR000BQX
r=0.46

small heat map img

HepG2
Snyder
SMC3
ENCSR000EDW
r=0.46

small heat map img

HepG2
Snyder
ESRRA
ENCSR000EEW
r=0.45

small heat map img

HepG2
Snyder
BRCA1
ENCSR000EDY
r=0.45

small heat map img

HepG2
Snyder
HDAC2
ENCSR000BMC
r=0.44

small heat map img

HepG2
Snyder
CREB1
ENCSR000BVL
r=0.44

small heat map img

HepG2
Snyder
MAFF
ENCSR000EEC
r=0.43

small heat map img

HepG2
Snyder
TCF12
ENCSR000BJG
r=0.42

small heat map img

HepG2
Snyder
JUND
ENCSR000BGK
r=0.42

small heat map img

HepG2
Snyder
JUND
ENCSR000EEI
r=0.42

small heat map img

HepG2
Snyder
SREBF1
ENCSR000EZP
r=0.42

small heat map img

HepG2
Snyder
BHLHE40
ENCSR000EDT
r=0.41

small heat map img

HepG2
Snyder
MAFK
ENCSR000EEB
r=0.41

small heat map img

HepG2
Snyder
SP1
ENCSR000BJX
r=0.40

small heat map img

HepG2
Snyder
MAFK
ENCSR000EDZ
r=0.39

small heat map img

HepG2
Snyder
NR3C1
ENCSR000EEV
r=0.38

small heat map img

HepG2
Snyder
HNF4G
ENCSR000BNJ
r=0.38

small heat map img

HepG2
Snyder
MBD4
ENCSR000BQW
r=0.38

small heat map img

HepG2
Snyder
JUN
ENCSR000EEK
r=0.37

small heat map img

HepG2
Snyder
SREBF1
ENCSR000EEO
r=0.37

small heat map img

HepG2
Snyder
EP300
ENCSR000BLW
r=0.37

small heat map img

HepG2
Snyder
ELF1
ENCSR000BMZ
r=0.36

small heat map img

HepG2
Snyder
RAD21
ENCSR000EEG
r=0.36

small heat map img

HepG2
Snyder
USF2
ENCSR000EEF
r=0.35

small heat map img

HepG2
Snyder
CEBPB
ENCSR000EEE
r=0.35

small heat map img

HepG2
Snyder
IRF3
ENCSR000EEJ
r=0.34

small heat map img

HepG2
Snyder
SIN3A
ENCSR000BGL
r=0.34

small heat map img

HepG2
Snyder
FOXA1
ENCSR000BMO
r=0.33

small heat map img

HepG2
Snyder
RFX5
ENCSR000EEA
r=0.33

small heat map img

HepG2
Snyder
HNF4A
ENCSR000BLF
r=0.31

small heat map img

HepG2
Snyder
NRF1
ENCSR000EEH
r=0.31

small heat map img

HepG2
Snyder
CEBPB
ENCSR000BQI
r=0.28

small heat map img

HepG2
Snyder
FOXA1
ENCSR000BLE
r=0.28

small heat map img

HepG2
Snyder
REST
ENCSR000BOT
r=0.26

small heat map img

HepG2
Snyder
NR2C2
ENCSR000EVS
r=0.26

small heat map img

HepG2
Snyder
RAD21
ENCSR000BLS
r=0.26

small heat map img

HepG2
Snyder
BHLHE40
ENCSR000BID
r=0.25

small heat map img

HepG2
Snyder
RXRA
ENCSR000BHU
r=0.24

small heat map img

HepG2
Snyder
YY1
ENCSR000BNT
r=0.24

small heat map img

HepG2
Snyder
USF1
ENCSR000BGM
r=0.23

small heat map img

HepG2
Snyder
CEBPD
ENCSR000BQJ
r=0.23

small heat map img

HepG2
Snyder
CTCF
ENCSR000DLS
r=0.22

small heat map img

HepG2
Snyder
TAF1
ENCSR000BJN
r=0.22

small heat map img

HepG2
Snyder
ZBTB33
ENCSR000BHR
r=0.22

small heat map img

HepG2
Snyder
SRF
ENCSR000BLV
r=0.22

small heat map img

HepG2
Snyder
GABPA
ENCSR000BJK
r=0.22

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEP
r=0.20

small heat map img

HepG2
Snyder
CTCF
ENCSR000BIE
r=0.20

small heat map img

HepG2
Snyder
ZBTB7A
ENCSR000BQA
r=0.20

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEM
r=0.19

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EZQ
r=0.19

small heat map img

HepG2
Snyder
POLR2A
ENCSR000BJM
r=0.19

small heat map img

HepG2
Snyder
CTCF
ENCSR000AMA
r=0.18

small heat map img

HepG2
Snyder
POLR2A
ENCSR000DLQ
r=0.18

small heat map img

HepG2
Snyder
REST
ENCSR000BJL
r=0.18

small heat map img

HepG2
Snyder
CTCF
ENCSR000DUG
r=0.17

small heat map img

HepG2
Snyder
ZBTB33
ENCSR000BNA
r=0.14

small heat map img

HepG2
Snyder
ATF3
ENCSR000BKE
r=0.14

small heat map img

HepG2
Snyder
SP2
ENCSR000BOU
r=0.12

small heat map img

HepG2
Snyder
TCF7L2
ENCSR000EVQ
r=0.12

small heat map img

HepG2
Snyder
EZH2
ENCSR000ARI
r=0.12

small heat map img

HepG2
Snyder
FOXA2
ENCSR000BNI
r=0.09

small heat map img

HepG2
Snyder
ZNF274
ENCSR000EVR
r=0.03

small heat map img
1,435 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help