GATA3

This gene encodes a protein which belongs to the GATA family of transcription factors. The protein contains two GATA-type zinc fingers and is an important regulator of T-cell development and plays an important role in endothelial cell biology. Defects in this gene are the cause of hypoparathyroidism with sensorineural deafness and renal dysplasia. RefSeq, Nov 2009
Trans-acting T-cell-specific transcription factor GATA-3 is a protein that in humans is encoded by the GATA3 gene.wikipedia

GATA3

PDB image
PDB 4HC7

PDB 4HC7 4HC9 4HCA
ENCODE experiments
Ensemble search
Entrez 2625
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia GATA3

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

A549 - Myers - ENCSR000BTI

loading

MCF-7 - Farnham - ENCSR000EWS

loading

MCF-7 - Farnham - ENCSR000EWV

loading

MCF-7 - Myers - ENCSR000BST

loading

SK-N-SH - Myers - ENCSR000BTH

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

A549 - Myers - ENCSR000BTI

1.
90 / 500
9.9e-37
GCCAGGGGGTAGGGGTGGGGG
small heat map img p-value: 0.99
pct_center: 0.31
pct_ratio: 0.52
2.
163 / 500
1.6e-21
TGTTTGCTTT
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 0.97
3.
45 / 500
0.0000079
GCCTGGGGCAT
small heat map img p-value: 1.00
pct_center: 0.20
pct_ratio: 0.45
4.
58 / 500
0.00027
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 1.61
5.
19 / 500
1.4
GCAGCTTGCCGGGAG
small heat map img p-value: 0.30
pct_center: 0.14
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF-7 - Farnham - ENCSR000EWV

1.
61 / 500
1.6e-38
AGATAAAAATC
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 1.45
2.
68 / 500
4.0e-37
AGGTCAAGGTGACCT
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.82
3.
101 / 500
2.6e-30
CAGATAAGATCAG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 1.50
4.
87 / 500
3.5e-17
AAAGTAAACA
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 0.96
5.
168 / 500
2.0e-9
AGGCAGGG
small heat map img p-value: 1.00
pct_center: 0.12
pct_ratio: 0.36
MEME output

MCF-7 - Farnham - ENCSR000EWS

1.
500 / 500
5.0e-93
GCAGATAAGAA
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 1.13
2.
194 / 500
8.5e-28
CAGGCAGG
small heat map img p-value: 1.00
pct_center: 0.30
pct_ratio: 0.51
3.
37 / 500
0.000036
AGGTCACAGTG
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.69
4.
37 / 500
0.0028
TGGCCTCAGGG
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.78
5.
41 / 500
0.048
ATGAGTAAACA
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.75
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF-7 - Myers - ENCSR000BST

1.
50 / 500
1.6e-20
GGCAAGCAAGGGGCGGGGGATGAGCCCAG
small heat map img p-value: 1.00
pct_center: 0.23
pct_ratio: 0.42
2.
29 / 500
0.0000012
CAGCCTGGGGA
small heat map img p-value: 0.99
pct_center: 0.16
pct_ratio: 0.45
3.
54 / 500
2.6e-7
TTTCAAAGAAAAGAAAAAAAAAAAAAAAA
small heat map img p-value: 1.00
pct_center: 0.27
pct_ratio: 0.39
4.
5 / 500
0.040
GTGTGTGTGTGTGTGTGTG
small heat map img p-value: 0.82
pct_center: 0.10
pct_ratio: 0.48
5.
25 / 500
0.13
GGGAGGCTGGGGAAG
small heat map img p-value: 1.00
pct_center: 0.24
pct_ratio: 0.41
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

SH-SY5Y - Farnham - ENCSR000EXZ

1.
499 / 500
1.5e-189
CAGATAAGAA
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 1.70
2.
113 / 500
1.3e-21
GGCATCTG
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.96
3.
192 / 500
3.9e-13
CAGGCA
small heat map img p-value: 0.00
pct_center:
pct_ratio:
4.
51 / 500
0.0068
AGCAGACAGCA
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.65
5.
32 / 500
0.098
AGCCCTGGAGA
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.62
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

SK-N-SH - Myers - ENCSR000BTH

1.
56 / 500
9.0e-24
GCAGGAGTTGGGAAGGGAGGGAAGAAAGGG
small heat map img p-value: 0.93
pct_center: 0.23
pct_ratio: 0.42
2.
56 / 500
0.0000048
TCTTCTTTTTGTTTTGTTTTG
small heat map img p-value: 1.00
pct_center: 0.27
pct_ratio: 0.42
3.
47 / 500
0.0000029
GATGACTCATA
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 1.49
4.
37 / 500
0.0014
TGAAAGAAAAAAAT
small heat map img p-value: 0.54
pct_center: 0.23
pct_ratio: 0.43
5.
26 / 500
4.2
GGGCTCTCTCTGGGAGAGGGA
small heat map img p-value: 0.95
pct_center: 0.10
pct_ratio: 0.53
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

T47D - Myers - ENCSR000BMX

1.
97 / 500
1.6e-62
CAGATAAGAATCTGT
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 1.53
2.
194 / 500
2.9e-45
AAGCAAACAGA
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.91
3.
85 / 500
5.9e-38
AGATGTTATCA
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 2.23
4.
110 / 500
8.4e-13
TGCCTGTGGCA
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.58
5.
45 / 500
5.1e-19
AGATGACACCGCAGATAA
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 1.08
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at GATA3 peaks

A549 - Myers - ENCSR000BTI

A549
Myers
GATA3
ENCSR000BTI
r=1.00

small heat map img

A549
Myers
H3K4me2
ENCSR000AVI
r=0.41

small heat map img

A549
Myers
H3K4me2
ENCSR000ATO
r=0.40

small heat map img

A549
Myers
H3K27ac
ENCSR000AUI
r=0.40

small heat map img

A549
Myers
H3K27ac
ENCSR000AVF
r=0.36

small heat map img

A549
Myers
H3K4me3
ENCSR000ASH
r=0.35

small heat map img

A549
Myers
H3K9ac
ENCSR000ASV
r=0.33

small heat map img

A549
Myers
H3K4me3
ENCSR000AST
r=0.32

small heat map img

A549
Myers
H2AFZ
ENCSR000AUG
r=0.30

small heat map img

A549
Myers
H3K4me1
ENCSR000AUM
r=0.30

small heat map img

A549
Myers
H3K4me1
ENCSR000AVH
r=0.30

small heat map img

A549
Myers
H2AFZ
ENCSR000AUH
r=0.29

small heat map img

A549
Myers
H3K4me3
ENCSR000DPD
r=0.19

small heat map img

A549
Myers
H3K79me2
ENCSR000ATP
r=0.07

small heat map img

A549
Myers
H3K79me2
ENCSR000ASU
r=0.06

small heat map img

A549
Myers
H4K20me1
ENCSR000AUO
r=0.05

small heat map img

A549
Myers
H3K36me3
ENCSR000AUL
r=0.02

small heat map img

A549
Myers
H3K36me3
ENCSR000AVG
r=0.01

small heat map img

A549
Myers
H3K27me3
ENCSR000AUK
r=-0.03

small heat map img

A549
Myers
H3K9me3
ENCSR000AUN
r=-0.05

small heat map img

A549
Myers
H3K27me3
ENCSR000AUJ
r=-0.06

small heat map img
5,743 peaks (download )

MCF-7 - Farnham - ENCSR000EWS

MCF-7
Farnham
GATA3
ENCSR000EWS
r=1.00

small heat map img

MCF-7
Farnham
GATA3
ENCSR000EWV
r=0.79

small heat map img

MCF-7
Farnham
GATA3
ENCSR000BST
r=0.79

small heat map img

MCF-7
Farnham
H3K27ac
ENCSR000EWR
r=0.31

small heat map img

MCF-7
Farnham
H3K4me3
ENCSR000DWJ
r=0.17

small heat map img

MCF-7
Farnham
H3K9me3
ENCSR000EWQ
r=0.10

small heat map img

MCF-7
Farnham
H3K36me3
ENCSR000EWO
r=0.06

small heat map img

MCF-7
Farnham
H3K27me3
ENCSR000EWP
r=0.04

small heat map img
10,000 randomly-selected peaks from a total of 12,077 (download )

MCF-7 - Farnham - ENCSR000EWV

MCF-7
Farnham
GATA3
ENCSR000EWV
r=1.00

small heat map img

MCF-7
Farnham
GATA3
ENCSR000EWS
r=0.77

small heat map img

MCF-7
Farnham
GATA3
ENCSR000BST
r=0.65

small heat map img

MCF-7
Farnham
H3K27ac
ENCSR000EWR
r=0.37

small heat map img

MCF-7
Farnham
H3K9me3
ENCSR000EWQ
r=0.33

small heat map img

MCF-7
Farnham
H3K27me3
ENCSR000EWP
r=0.30

small heat map img

MCF-7
Farnham
H3K4me3
ENCSR000DWJ
r=0.29

small heat map img

MCF-7
Farnham
H3K36me3
ENCSR000EWO
r=0.25

small heat map img
6,081 peaks (download )

MCF-7 - Myers - ENCSR000BST

MCF-7
Myers
GATA3
ENCSR000BST
r=1.00

small heat map img

MCF-7
Myers
GATA3
ENCSR000EWS
r=0.75

small heat map img

MCF-7
Myers
GATA3
ENCSR000EWV
r=0.67

small heat map img

MCF-7
Myers
H3K27ac
ENCSR000EWR
r=0.24

small heat map img

MCF-7
Myers
H3K4me3
ENCSR000DWJ
r=0.10

small heat map img

MCF-7
Myers
H3K9me3
ENCSR000EWQ
r=0.03

small heat map img

MCF-7
Myers
H3K27me3
ENCSR000EWP
r=0.01

small heat map img

MCF-7
Myers
H3K36me3
ENCSR000EWO
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 20,592 (download )

SH-SY5Y - Farnham - ENCSR000EXZ

SH-SY5Y
Farnham
GATA3
ENCSR000EXZ
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 15,879 (download )

SK-N-SH - Myers - ENCSR000BTH

SK-N-SH
Myers
GATA3
ENCSR000BTH
r=1.00

small heat map img

SK-N-SH
Myers
H3K4me3
ENCSR000DXR
r=0.04

small heat map img

SK-N-SH
Myers
H3K36me3
ENCSR000DXO
r=0.01

small heat map img

SK-N-SH
Myers
H3K27me3
ENCSR000DXP
r=0.00

small heat map img
10,000 randomly-selected peaks from a total of 0 (download )

T47D - Myers - ENCSR000BMX

T47D
Myers
GATA3
ENCSR000BMX
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 37,199 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at GATA3 peaks

A549 - Myers - ENCSR000BTI

A549
Myers
GATA3
ENCSR000BTI
r=1.00

small heat map img

A549
Myers
SP1
ENCSR000BPE
r=0.75

small heat map img

A549
Myers
TEAD4
ENCSR000BUD
r=0.69

small heat map img

A549
Myers
EP300
ENCSR000BPW
r=0.68

small heat map img

A549
Myers
CEBPB
ENCSR000BUB
r=0.66

small heat map img

A549
Myers
JUND
ENCSR000BRF
r=0.62

small heat map img

A549
Myers
FOSL2
ENCSR000BQO
r=0.61

small heat map img

A549
Myers
MAX
ENCSR000BTJ
r=0.61

small heat map img

A549
Myers
PBX3
ENCSR000BTN
r=0.61

small heat map img

A549
Myers
FOXA1
ENCSR000BPX
r=0.60

small heat map img

A549
Myers
TCF12
ENCSR000BQQ
r=0.60

small heat map img

A549
Myers
FOXA2
ENCSR000BRE
r=0.58

small heat map img

A549
Myers
BCL3
ENCSR000BQH
r=0.55

small heat map img

A549
Myers
NR3C1
ENCSR000BHF
r=0.55

small heat map img

A549
Myers
RAD21
ENCSR000BUC
r=0.55

small heat map img

A549
Myers
ZBTB33
ENCSR000BPZ
r=0.55

small heat map img

A549
Myers
CEBPB
ENCSR000DYI
r=0.54

small heat map img

A549
Myers
GABPA
ENCSR000BPY
r=0.53

small heat map img

A549
Myers
MAX
ENCSR000DYG
r=0.52

small heat map img

A549
Myers
RAD21
ENCSR000DYE
r=0.49

small heat map img

A549
Myers
BHLHE40
ENCSR000DYJ
r=0.49

small heat map img

A549
Myers
NR3C1
ENCSR000BHG
r=0.48

small heat map img

A549
Myers
ATF3
ENCSR000BPS
r=0.48

small heat map img

A549
Myers
NR3C1
ENCSR000BJR
r=0.46

small heat map img

A549
Myers
MYC
ENCSR000DYC
r=0.46

small heat map img

A549
Myers
CREB1
ENCSR000BRB
r=0.44

small heat map img

A549
Myers
REST
ENCSR000BQP
r=0.42

small heat map img

A549
Myers
USF1
ENCSR000BHX
r=0.42

small heat map img

A549
Myers
SIX5
ENCSR000BRL
r=0.41

small heat map img

A549
Myers
ETS1
ENCSR000BPU
r=0.41

small heat map img

A549
Myers
SIN3A
ENCSR000BRM
r=0.41

small heat map img

A549
Myers
E2F6
ENCSR000BTC
r=0.40

small heat map img

A549
Myers
NR3C1
ENCSR000BHE
r=0.37

small heat map img

A549
Myers
YY1
ENCSR000BPM
r=0.35

small heat map img

A549
Myers
CTCF
ENCSR000DYD
r=0.32

small heat map img

A549
Myers
USF1
ENCSR000BJB
r=0.27

small heat map img

A549
Myers
TAF1
ENCSR000BPF
r=0.24

small heat map img

A549
Myers
ELF1
ENCSR000BPT
r=0.22

small heat map img

A549
Myers
USF1
ENCSR000BPV
r=0.20

small heat map img

A549
Myers
CTCF
ENCSR000AUF
r=0.18

small heat map img

A549
Myers
POLR2A
ENCSR000DMZ
r=0.17

small heat map img

A549
Myers
POLR2A
ENCSR000BHH
r=0.17

small heat map img

A549
Myers
POLR2A
ENCSR000BHI
r=0.16

small heat map img

A549
Myers
CTCF
ENCSR000DNA
r=0.15

small heat map img

A549
Myers
CTCF
ENCSR000AUE
r=0.14

small heat map img

A549
Myers
CTCF
ENCSR000BHV
r=0.11

small heat map img

A549
Myers
CTCF
ENCSR000DPF
r=0.09

small heat map img

A549
Myers
CTCF
ENCSR000BHW
r=0.09

small heat map img
5,743 peaks (download )

MCF-7 - Farnham - ENCSR000EWS

MCF-7
Farnham
GATA3
ENCSR000EWS
r=1.00

small heat map img

MCF-7
Farnham
GATA3
ENCSR000EWV
r=0.79

small heat map img

MCF-7
Farnham
GATA3
ENCSR000BST
r=0.79

small heat map img

MCF-7
Farnham
ZNF217
ENCSR000EWU
r=0.78

small heat map img

MCF-7
Farnham
SIN3A
ENCSR000BUM
r=0.75

small heat map img

MCF-7
Farnham
NR2F2
ENCSR000BUY
r=0.67

small heat map img

MCF-7
Farnham
TCF7L2
ENCSR000EWT
r=0.66

small heat map img

MCF-7
Farnham
HDAC2
ENCSR000BTP
r=0.65

small heat map img

MCF-7
Farnham
TCF12
ENCSR000BUN
r=0.63

small heat map img

MCF-7
Farnham
TEAD4
ENCSR000BUO
r=0.62

small heat map img

MCF-7
Farnham
EP300
ENCSR000BTR
r=0.61

small heat map img

MCF-7
Farnham
FOXM1
ENCSR000BUJ
r=0.60

small heat map img

MCF-7
Farnham
FOSL2
ENCSR000BUI
r=0.54

small heat map img

MCF-7
Farnham
MAX
ENCSR000BUL
r=0.54

small heat map img

MCF-7
Farnham
RAD21
ENCSR000BTQ
r=0.51

small heat map img

MCF-7
Farnham
JUND
ENCSR000BSU
r=0.51

small heat map img

MCF-7
Farnham
CEBPB
ENCSR000BSR
r=0.49

small heat map img

MCF-7
Farnham
GABPA
ENCSR000BUK
r=0.49

small heat map img

MCF-7
Farnham
SRF
ENCSR000BVA
r=0.49

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMQ
r=0.48

small heat map img

MCF-7
Farnham
ELF1
ENCSR000BSS
r=0.44

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMP
r=0.44

small heat map img

MCF-7
Farnham
PML
ENCSR000BUZ
r=0.43

small heat map img

MCF-7
Farnham
REST
ENCSR000BSP
r=0.41

small heat map img

MCF-7
Farnham
EGR1
ENCSR000BUX
r=0.41

small heat map img

MCF-7
Farnham
TAF1
ENCSR000AHF
r=0.38

small heat map img

MCF-7
Farnham
CTCF
ENCSR000AHD
r=0.27

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMT
r=0.25

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DWH
r=0.23

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMM
r=0.22

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMR
r=0.21

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMS
r=0.18

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DML
r=0.15

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMV
r=0.14

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMJ
r=0.14

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMO
r=0.13

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMK
r=0.11

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMN
r=0.11

small heat map img
10,000 randomly-selected peaks from a total of 12,077 (download )

MCF-7 - Farnham - ENCSR000EWV

MCF-7
Farnham
GATA3
ENCSR000EWV
r=1.00

small heat map img

MCF-7
Farnham
ZNF217
ENCSR000EWU
r=0.86

small heat map img

MCF-7
Farnham
GATA3
ENCSR000EWS
r=0.77

small heat map img

MCF-7
Farnham
TCF7L2
ENCSR000EWT
r=0.72

small heat map img

MCF-7
Farnham
GATA3
ENCSR000BST
r=0.65

small heat map img

MCF-7
Farnham
TEAD4
ENCSR000BUO
r=0.63

small heat map img

MCF-7
Farnham
SIN3A
ENCSR000BUM
r=0.63

small heat map img

MCF-7
Farnham
TCF12
ENCSR000BUN
r=0.60

small heat map img

MCF-7
Farnham
EP300
ENCSR000BTR
r=0.59

small heat map img

MCF-7
Farnham
FOXM1
ENCSR000BUJ
r=0.59

small heat map img

MCF-7
Farnham
HDAC2
ENCSR000BTP
r=0.59

small heat map img

MCF-7
Farnham
NR2F2
ENCSR000BUY
r=0.57

small heat map img

MCF-7
Farnham
FOSL2
ENCSR000BUI
r=0.54

small heat map img

MCF-7
Farnham
JUND
ENCSR000BSU
r=0.51

small heat map img

MCF-7
Farnham
GABPA
ENCSR000BUK
r=0.50

small heat map img

MCF-7
Farnham
RAD21
ENCSR000BTQ
r=0.48

small heat map img

MCF-7
Farnham
MAX
ENCSR000BUL
r=0.46

small heat map img

MCF-7
Farnham
SRF
ENCSR000BVA
r=0.45

small heat map img

MCF-7
Farnham
CEBPB
ENCSR000BSR
r=0.45

small heat map img

MCF-7
Farnham
TAF1
ENCSR000AHF
r=0.44

small heat map img

MCF-7
Farnham
EGR1
ENCSR000BUX
r=0.44

small heat map img

MCF-7
Farnham
PML
ENCSR000BUZ
r=0.43

small heat map img

MCF-7
Farnham
REST
ENCSR000BSP
r=0.43

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DWH
r=0.37

small heat map img

MCF-7
Farnham
CTCF
ENCSR000AHD
r=0.33

small heat map img

MCF-7
Farnham
ELF1
ENCSR000BSS
r=0.32

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMT
r=0.23

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMQ
r=0.19

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMP
r=0.13

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMR
r=0.09

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMS
r=0.03

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMM
r=-0.03

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMO
r=-0.04

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DML
r=-0.06

small heat map img

MCF-7
Farnham
CTCF
ENCSR000DMV
r=-0.06

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMN
r=-0.10

small heat map img

MCF-7
Farnham
POLR2A
ENCSR000DMK
r=-0.12

small heat map img

MCF-7
Farnham
MYC
ENCSR000DMJ
r=-0.13

small heat map img
6,081 peaks (download )

MCF-7 - Myers - ENCSR000BST

MCF-7
Myers
GATA3
ENCSR000BST
r=1.00

small heat map img

MCF-7
Myers
NR2F2
ENCSR000BUY
r=0.78

small heat map img

MCF-7
Myers
SIN3A
ENCSR000BUM
r=0.76

small heat map img

MCF-7
Myers
GATA3
ENCSR000EWS
r=0.75

small heat map img

MCF-7
Myers
ZNF217
ENCSR000EWU
r=0.70

small heat map img

MCF-7
Myers
HDAC2
ENCSR000BTP
r=0.70

small heat map img

MCF-7
Myers
EP300
ENCSR000BTR
r=0.68

small heat map img

MCF-7
Myers
GATA3
ENCSR000EWV
r=0.67

small heat map img

MCF-7
Myers
FOXM1
ENCSR000BUJ
r=0.64

small heat map img

MCF-7
Myers
TCF7L2
ENCSR000EWT
r=0.62

small heat map img

MCF-7
Myers
FOSL2
ENCSR000BUI
r=0.62

small heat map img

MCF-7
Myers
TEAD4
ENCSR000BUO
r=0.60

small heat map img

MCF-7
Myers
TCF12
ENCSR000BUN
r=0.57

small heat map img

MCF-7
Myers
CEBPB
ENCSR000BSR
r=0.57

small heat map img

MCF-7
Myers
MAX
ENCSR000BUL
r=0.56

small heat map img

MCF-7
Myers
JUND
ENCSR000BSU
r=0.53

small heat map img

MCF-7
Myers
GABPA
ENCSR000BUK
r=0.51

small heat map img

MCF-7
Myers
RAD21
ENCSR000BTQ
r=0.48

small heat map img

MCF-7
Myers
SRF
ENCSR000BVA
r=0.44

small heat map img

MCF-7
Myers
ELF1
ENCSR000BSS
r=0.44

small heat map img

MCF-7
Myers
REST
ENCSR000BSP
r=0.42

small heat map img

MCF-7
Myers
MYC
ENCSR000DMQ
r=0.41

small heat map img

MCF-7
Myers
EGR1
ENCSR000BUX
r=0.41

small heat map img

MCF-7
Myers
PML
ENCSR000BUZ
r=0.38

small heat map img

MCF-7
Myers
MYC
ENCSR000DMP
r=0.34

small heat map img

MCF-7
Myers
TAF1
ENCSR000AHF
r=0.33

small heat map img

MCF-7
Myers
CTCF
ENCSR000AHD
r=0.26

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMR
r=0.22

small heat map img

MCF-7
Myers
POLR2A
ENCSR000DMT
r=0.20

small heat map img

MCF-7
Myers
CTCF
ENCSR000DWH
r=0.19

small heat map img

MCF-7
Myers
MYC
ENCSR000DMM
r=0.18

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMS
r=0.17

small heat map img

MCF-7
Myers
CTCF
ENCSR000DML
r=0.14

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMO
r=0.13

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMV
r=0.12

small heat map img

MCF-7
Myers
MYC
ENCSR000DMJ
r=0.09

small heat map img

MCF-7
Myers
POLR2A
ENCSR000DMN
r=0.08

small heat map img

MCF-7
Myers
POLR2A
ENCSR000DMK
r=0.08

small heat map img
10,000 randomly-selected peaks from a total of 20,592 (download )

SH-SY5Y - Farnham - ENCSR000EXZ

SH-SY5Y
Farnham
GATA3
ENCSR000EXZ
r=1.00

small heat map img

SH-SY5Y
Farnham
GATA2
ENCSR000EYB
r=0.83

small heat map img
10,000 randomly-selected peaks from a total of 15,879 (download )

SK-N-SH - Myers - ENCSR000BTH

SK-N-SH
Myers
GATA3
ENCSR000BTH
r=1.00

small heat map img

SK-N-SH
Myers
TCF12
ENCSR000BSL
r=0.82

small heat map img

SK-N-SH
Myers
PBX3
ENCSR000BVE
r=0.80

small heat map img

SK-N-SH
Myers
EP300
ENCSR000BUA
r=0.79

small heat map img

SK-N-SH
Myers
NFIC
ENCSR000BSV
r=0.76

small heat map img

SK-N-SH
Myers
JUND
ENCSR000BSK
r=0.76

small heat map img

SK-N-SH
Myers
FOSL2
ENCSR000BVB
r=0.71

small heat map img

SK-N-SH
Myers
JUND
ENCSR000EIB
r=0.67

small heat map img

SK-N-SH
Myers
RXRA
ENCSR000BVG
r=0.66

small heat map img

SK-N-SH
Myers
TEAD4
ENCSR000BUQ
r=0.63

small heat map img

SK-N-SH
Myers
MEF2A
ENCSR000BVC
r=0.59

small heat map img

SK-N-SH
Myers
ZBTB33
ENCSR000BTS
r=0.58

small heat map img

SK-N-SH
Myers
EP300
ENCSR000BMA
r=0.56

small heat map img

SK-N-SH
Myers
MAX
ENCSR000BVD
r=0.54

small heat map img

SK-N-SH
Myers
FOXM1
ENCSR000BTB
r=0.51

small heat map img

SK-N-SH
Myers
EP300
ENCSR000EHV
r=0.51

small heat map img

SK-N-SH
Myers
ELF1
ENCSR000BTA
r=0.47

small heat map img

SK-N-SH
Myers
SMC3
ENCSR000EHW
r=0.43

small heat map img

SK-N-SH
Myers
RAD21
ENCSR000EHX
r=0.37

small heat map img

SK-N-SH
Myers
GABPA
ENCSR000BTG
r=0.36

small heat map img

SK-N-SH
Myers
MXI1
ENCSR000EIA
r=0.36

small heat map img

SK-N-SH
Myers
RFX5
ENCSR000EHY
r=0.35

small heat map img

SK-N-SH
Myers
USF1
ENCSR000BTZ
r=0.34

small heat map img

SK-N-SH
Myers
RAD21
ENCSR000BLY
r=0.33

small heat map img

SK-N-SH
Myers
YY1
ENCSR000BSM
r=0.28

small heat map img

SK-N-SH
Myers
REST
ENCSR000BOZ
r=0.28

small heat map img

SK-N-SH
Myers
CTCF
ENCSR000EIC
r=0.25

small heat map img

SK-N-SH
Myers
NRF1
ENCSR000EHZ
r=0.24

small heat map img

SK-N-SH
Myers
SIN3A
ENCSR000BPB
r=0.22

small heat map img

SK-N-SH
Myers
YY1
ENCSR000BLZ
r=0.21

small heat map img

SK-N-SH
Myers
USF1
ENCSR000BMF
r=0.18

small heat map img

SK-N-SH
Myers
TAF1
ENCSR000BQF
r=0.12

small heat map img

SK-N-SH
Myers
CTCF
ENCSR000DXQ
r=0.10

small heat map img

SK-N-SH
Myers
CTCF
ENCSR000BLX
r=0.05

small heat map img

SK-N-SH
Myers
REST
ENCSR000BJJ
r=0.04

small heat map img
10,000 randomly-selected peaks from a total of 0 (download )

T47D - Myers - ENCSR000BMX

T47D
Myers
GATA3
ENCSR000BMX
r=1.00

small heat map img

T47D
Myers
FOXA1
ENCSR000BKY
r=0.53

small heat map img

T47D
Myers
EP300
ENCSR000BLM
r=0.52

small heat map img

T47D
Myers
JUND
ENCSR000BVO
r=0.49

small heat map img

T47D
Myers
ESR1
ENCSR000BJS
r=0.47

small heat map img

T47D
Myers
ESR1
ENCSR000BKN
r=0.43

small heat map img

T47D
Myers
ESR1
ENCSR000BQD
r=0.34

small heat map img

T47D
Myers
CTCF
ENCSR000BNO
r=0.07

small heat map img
10,000 randomly-selected peaks from a total of 37,199 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help