GATA2

This gene encodes a member of the GATA family of zinc-finger transcription factors that are named for the consensus nucleotide sequence they bind in the promoter regions of target genes. The encoded protein plays an essential role in regulating transcription of genes involved in the development and proliferation of hematopoietic and endocrine cell lineages. Alternative splicing results in multiple transcript variants.RefSeq, Mar 2009
GATA2 is a human gene which makes a protein called GATA binding protein 2 - a transcription factor.wikipedia

GATA2


ENCODE experiments
Ensemble search
Entrez 2624
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia GATA2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

endothelial cell of umbilical vein - Farnham - ENCSR000EVW

loading

K562 - Farnham - ENCSR000EWG

loading

K562 - Myers - ENCSR000BKM

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

K562 - Farnham - ENCSR000EWG

1.
479 / 500
2.1e-467
CCCTGGGGGGGGCAGATAAGG
small heat map img p-value: 0.00
pct_center: 0.48
pct_ratio: 4.46
2.
203 / 500
5.2e-54
CAGATAAG
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 3.85
3.
229 / 500
8.5e-10
GCAGGCAG
small heat map img p-value: 1.00
pct_center: 0.33
pct_ratio: 0.55
4.
58 / 500
65
AACAGCTG
small heat map img p-value: 0.01
pct_center: 0.19
pct_ratio: 0.76
5.
3 / 500
1.0e+2
TCAAGGAGCATGGTGCCAGGGAGTGATTGC
small heat map img p-value: 0.20
pct_center: 0.12
pct_ratio: 0.62
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Myers - ENCSR000BKM

1.
495 / 500
9.8e-454
GCAGATAAGA
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 3.21
2.
179 / 500
3.5e-45
CTGGTGGAGGCAGAT
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 1.58
3.
177 / 500
9.7e-23
GGCAGCTG
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.80
4.
16 / 500
0.000063
AGGAACTGTGTCTGGTTGCCTTGATAAGC
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.74
5.
74 / 500
0.0000058
GGGGGCAGGGCAGGG
small heat map img p-value: 0.74
pct_center: 0.29
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

SH-SY5Y - Farnham - ENCSR000EYB

1.
500 / 500
2.9e-279
GCAGATAAGAACCT
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 2.31
2.
112 / 500
1.7e-23
CCAGAGGCAGG
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.63
3.
202 / 500
3.2e-9
CAGGCA
small heat map img p-value: 0.00
pct_center:
pct_ratio:
4.
74 / 500
0.32
CCTGGGGGCAG
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.61
5.
14 / 500
0.65
CTGAGCTGATAAAAGCCAGTG
small heat map img p-value: 0.04
pct_center: 0.13
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

endothelial cell of umbilical vein - Farnham - ENCSR000EVW

1.
499 / 500
5.0e-231
ACAGATAAGAA
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 1.67
2.
245 / 500
1.5e-133
CAGGAAAT
small heat map img p-value: 0.00
pct_center: 0.38
pct_ratio: 1.32
3.
137 / 500
4.4e-46
ATGAGTCA
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 2.05
4.
10 / 500
0.098
GCCTGCTAGAAGTCAGACT
small heat map img p-value: 0.12
pct_center: 0.10
pct_ratio: 0.61
5.
40 / 500
0.00064
GGGGAGGGGCAGGGG
small heat map img p-value: 1.00
pct_center: 0.32
pct_ratio: 0.50
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at GATA2 peaks

K562 - Farnham - ENCSR000EWG

K562
Farnham
GATA2
ENCSR000EWG
r=1.00

small heat map img

K562
Farnham
GATA2
ENCSR000BKM
r=0.79

small heat map img

K562
Farnham
H3K4me1
ENCSR000AKS
r=0.37

small heat map img

K562
Farnham
H3K4me2
ENCSR000AKT
r=0.34

small heat map img

K562
Farnham
H3K27ac
ENCSR000AKP
r=0.34

small heat map img

K562
Farnham
H3K4me3
ENCSR000AKU
r=0.31

small heat map img

K562
Farnham
H2AFZ
ENCSR000APC
r=0.27

small heat map img

K562
Farnham
H3K9ac
ENCSR000AKV
r=0.26

small heat map img

K562
Farnham
H3K4me1
ENCSR000EWC
r=0.25

small heat map img

K562
Farnham
H3K9ac
ENCSR000EVZ
r=0.21

small heat map img

K562
Farnham
H3K9me1
ENCSR000AKW
r=0.19

small heat map img

K562
Farnham
H4K20me1
ENCSR000AKX
r=0.18

small heat map img

K562
Farnham
H3K4me3
ENCSR000DWD
r=0.13

small heat map img

K562
Farnham
H3K4me3
ENCSR000EWA
r=0.10

small heat map img

K562
Farnham
H3K9me3
ENCSR000APE
r=0.09

small heat map img

K562
Farnham
H3K79me2
ENCSR000APD
r=0.06

small heat map img

K562
Farnham
H3K36me3
ENCSR000AKR
r=0.06

small heat map img

K562
Farnham
H3K27me3
ENCSR000AKQ
r=0.04

small heat map img

K562
Farnham
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Farnham
H3K36me3
ENCSR000DWB
r=0.01

small heat map img

K562
Farnham
H3K27me3
ENCSR000EWB
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 10,648 (download )

K562 - Myers - ENCSR000BKM

K562
Myers
GATA2
ENCSR000BKM
r=1.00

small heat map img

K562
Myers
GATA2
ENCSR000EWG
r=0.75

small heat map img

K562
Myers
H3K4me1
ENCSR000AKS
r=0.32

small heat map img

K562
Myers
H3K27ac
ENCSR000AKP
r=0.28

small heat map img

K562
Myers
H3K4me2
ENCSR000AKT
r=0.26

small heat map img

K562
Myers
H3K4me3
ENCSR000AKU
r=0.24

small heat map img

K562
Myers
H2AFZ
ENCSR000APC
r=0.20

small heat map img

K562
Myers
H3K9ac
ENCSR000AKV
r=0.20

small heat map img

K562
Myers
H3K4me1
ENCSR000EWC
r=0.18

small heat map img

K562
Myers
H3K9me1
ENCSR000AKW
r=0.14

small heat map img

K562
Myers
H4K20me1
ENCSR000AKX
r=0.13

small heat map img

K562
Myers
H3K9ac
ENCSR000EVZ
r=0.11

small heat map img

K562
Myers
H3K9me3
ENCSR000APE
r=0.07

small heat map img

K562
Myers
H3K4me3
ENCSR000DWD
r=0.06

small heat map img

K562
Myers
H3K36me3
ENCSR000AKR
r=0.05

small heat map img

K562
Myers
H3K79me2
ENCSR000APD
r=0.04

small heat map img

K562
Myers
H3K4me3
ENCSR000EWA
r=0.04

small heat map img

K562
Myers
H3K27me3
ENCSR000AKQ
r=0.02

small heat map img

K562
Myers
H3K27me3
ENCSR000DWC
r=-0.01

small heat map img

K562
Myers
H3K36me3
ENCSR000DWB
r=-0.02

small heat map img

K562
Myers
H3K27me3
ENCSR000EWB
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 19,322 (download )

SH-SY5Y - Farnham - ENCSR000EYB

SH-SY5Y
Farnham
GATA2
ENCSR000EYB
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 35,620 (download )

endothelial cell of umbilical vein - Farnham - ENCSR000EVW

endothelial cell of umbilical vein
Farnham
GATA2
ENCSR000EVW
r=1.00

small heat map img

endothelial cell of umbilical vein
Farnham
H3K4me1
ENCSR000AKL
r=0.41

small heat map img

endothelial cell of umbilical vein
Farnham
H3K4me2
ENCSR000AKM
r=0.37

small heat map img

endothelial cell of umbilical vein
Farnham
H3K27ac
ENCSR000ALB
r=0.36

small heat map img

endothelial cell of umbilical vein
Farnham
H3K9ac
ENCSR000ALD
r=0.28

small heat map img

endothelial cell of umbilical vein
Farnham
H2AFZ
ENCSR000ASC
r=0.26

small heat map img

endothelial cell of umbilical vein
Farnham
H3K4me3
ENCSR000AKN
r=0.16

small heat map img

endothelial cell of umbilical vein
Farnham
H3K9me1
ENCSR000ALE
r=0.09

small heat map img

endothelial cell of umbilical vein
Farnham
H3K4me3
ENCSR000DVN
r=0.04

small heat map img

endothelial cell of umbilical vein
Farnham
H3K9me3
ENCSR000ATB
r=0.03

small heat map img

endothelial cell of umbilical vein
Farnham
H3K79me2
ENCSR000ASD
r=0.00

small heat map img

endothelial cell of umbilical vein
Farnham
H4K20me1
ENCSR000ALF
r=-0.00

small heat map img

endothelial cell of umbilical vein
Farnham
H3K36me3
ENCSR000ALC
r=-0.01

small heat map img

endothelial cell of umbilical vein
Farnham
H3K36me3
ENCSR000DVM
r=-0.03

small heat map img

endothelial cell of umbilical vein
Farnham
H3K27me3
ENCSR000AKK
r=-0.07

small heat map img

endothelial cell of umbilical vein
Farnham
H3K27me3
ENCSR000DVO
r=-0.08

small heat map img
10,000 randomly-selected peaks from a total of 27,454 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at GATA2 peaks

K562 - Farnham - ENCSR000EWG

K562
Farnham
GATA2
ENCSR000EWG
r=1.00

small heat map img

K562
Farnham
GATA1
ENCSR000EWM
r=0.83

small heat map img

K562
Farnham
GATA1
ENCSR000EFT
r=0.81

small heat map img

K562
Farnham
GATA2
ENCSR000BKM
r=0.79

small heat map img

K562
Farnham
CEBPD
ENCSR000BVY
r=0.76

small heat map img

K562
Farnham
RCOR1
ENCSR000EGG
r=0.75

small heat map img

K562
Farnham
EP300
ENCSR000EGE
r=0.75

small heat map img

K562
Farnham
TAL1
ENCSR000EHB
r=0.74

small heat map img

K562
Farnham
TEAD4
ENCSR000BRK
r=0.74

small heat map img

K562
Farnham
ZMIZ1
ENCSR000EFQ
r=0.72

small heat map img

K562
Farnham
TBL1XR1
ENCSR000EGB
r=0.72

small heat map img

K562
Farnham
STAT5A
ENCSR000BRR
r=0.71

small heat map img

K562
Farnham
STAT2
ENCSR000FAT
r=0.70

small heat map img

K562
Farnham
RCOR1
ENCSR000EGC
r=0.70

small heat map img

K562
Farnham
ATF1
ENCSR000DNZ
r=0.69

small heat map img

K562
Farnham
NR2F2
ENCSR000BRS
r=0.69

small heat map img

K562
Farnham
MYC
ENCSR000EZV
r=0.68

small heat map img

K562
Farnham
MYC
ENCSR000EZU
r=0.68

small heat map img

K562
Farnham
CCNT2
ENCSR000DOA
r=0.68

small heat map img

K562
Farnham
TRIM28
ENCSR000BRW
r=0.67

small heat map img

K562
Farnham
MYC
ENCSR000EGS
r=0.67

small heat map img

K562
Farnham
MYC
ENCSR000FAZ
r=0.67

small heat map img

K562
Farnham
TBL1XR1
ENCSR000EGA
r=0.65

small heat map img

K562
Farnham
STAT1
ENCSR000FAU
r=0.64

small heat map img

K562
Farnham
STAT2
ENCSR000FBC
r=0.64

small heat map img

K562
Farnham
JUND
ENCSR000EGN
r=0.63

small heat map img

K562
Farnham
JUN
ENCSR000EZT
r=0.63

small heat map img

K562
Farnham
KDM1A
ENCSR000ATX
r=0.63

small heat map img

K562
Farnham
IRF1
ENCSR000EGT
r=0.63

small heat map img

K562
Farnham
JUN
ENCSR000EZX
r=0.62

small heat map img

K562
Farnham
STAT1
ENCSR000FAV
r=0.62

small heat map img

K562
Farnham
STAT1
ENCSR000EHJ
r=0.62

small heat map img

K562
Farnham
MYC
ENCSR000FAG
r=0.62

small heat map img

K562
Farnham
EP300
ENCSR000EGY
r=0.62

small heat map img

K562
Farnham
STAT1
ENCSR000EHK
r=0.61

small heat map img

K562
Farnham
JUN
ENCSR000FAH
r=0.60

small heat map img

K562
Farnham
IRF1
ENCSR000EGK
r=0.60

small heat map img

K562
Farnham
POLR2A
ENCSR000EHL
r=0.60

small heat map img

K562
Farnham
JUN
ENCSR000EFS
r=0.60

small heat map img

K562
Farnham
IRF1
ENCSR000EGL
r=0.60

small heat map img

K562
Farnham
ARID3A
ENCSR000EFY
r=0.59

small heat map img

K562
Farnham
JUN
ENCSR000EGH
r=0.59

small heat map img

K562
Farnham
HMGN3
ENCSR000DOB
r=0.59

small heat map img

K562
Farnham
JUN
ENCSR000EZW
r=0.59

small heat map img

K562
Farnham
MYC
ENCSR000DLZ
r=0.59

small heat map img

K562
Farnham
BHLHE40
ENCSR000EGV
r=0.58

small heat map img

K562
Farnham
MYC
ENCSR000EGJ
r=0.58

small heat map img

K562
Farnham
PML
ENCSR000BQY
r=0.58

small heat map img

K562
Farnham
EP300
ENCSR000AQB
r=0.58

small heat map img

K562
Farnham
SIRT6
ENCSR000DOH
r=0.58

small heat map img

K562
Farnham
MAX
ENCSR000EFV
r=0.56

small heat map img

K562
Farnham
REST
ENCSR000BMW
r=0.56

small heat map img

K562
Farnham
MXI1
ENCSR000EGZ
r=0.55

small heat map img

K562
Farnham
SMARCA4
ENCSR000EHO
r=0.55

small heat map img

K562
Farnham
ZNF274
ENCSR000EVX
r=0.55

small heat map img

K562
Farnham
CUX1
ENCSR000EFO
r=0.54

small heat map img

K562
Farnham
GABPA
ENCSR000BLO
r=0.54

small heat map img

K562
Farnham
CBX3
ENCSR000BRT
r=0.54

small heat map img

K562
Farnham
IRF1
ENCSR000EGU
r=0.53

small heat map img

K562
Farnham
CEBPB
ENCSR000BRQ
r=0.52

small heat map img

K562
Farnham
CREB1
ENCSR000BSO
r=0.50

small heat map img

K562
Farnham
MAX
ENCSR000FAE
r=0.49

small heat map img

K562
Farnham
EZH2
ENCSR000AQE
r=0.49

small heat map img

K562
Farnham
FOS
ENCSR000FAI
r=0.48

small heat map img

K562
Farnham
SMARCB1
ENCSR000EHN
r=0.47

small heat map img

K562
Farnham
HDAC2
ENCSR000BMG
r=0.47

small heat map img

K562
Farnham
E2F4
ENCSR000EWL
r=0.46

small heat map img

K562
Farnham
HDAC1
ENCSR000AQF
r=0.45

small heat map img

K562
Farnham
SMC3
ENCSR000EGW
r=0.45

small heat map img

K562
Farnham
NFYA
ENCSR000EGR
r=0.45

small heat map img

K562
Farnham
NCOR1
ENCSR000ATY
r=0.44

small heat map img

K562
Farnham
SETDB1
ENCSR000AUT
r=0.44

small heat map img

K562
Farnham
MAFK
ENCSR000EGX
r=0.44

small heat map img

K562
Farnham
MAX
ENCSR000BLP
r=0.44

small heat map img

K562
Farnham
MAFF
ENCSR000EGI
r=0.43

small heat map img

K562
Farnham
HDAC2
ENCSR000AQG
r=0.42

small heat map img

K562
Farnham
ZNF384
ENCSR000EFP
r=0.42

small heat map img

K562
Farnham
CHD7
ENCSR000AVD
r=0.41

small heat map img

K562
Farnham
ELK1
ENCSR000EFU
r=0.39

small heat map img

K562
Farnham
RAD21
ENCSR000FAD
r=0.39

small heat map img

K562
Farnham
EGR1
ENCSR000BNE
r=0.39

small heat map img

K562
Farnham
POLR2A
ENCSR000DLY
r=0.39

small heat map img

K562
Farnham
ZNF143
ENCSR000EGP
r=0.38

small heat map img

K562
Farnham
NFE2
ENCSR000FAF
r=0.38

small heat map img

K562
Farnham
E2F6
ENCSR000EWJ
r=0.38

small heat map img

K562
Farnham
CEBPB
ENCSR000EHE
r=0.37

small heat map img

K562
Farnham
BACH1
ENCSR000EGD
r=0.37

small heat map img

K562
Farnham
RBBP5
ENCSR000AQI
r=0.37

small heat map img

K562
Farnham
KAT2B
ENCSR000ATZ
r=0.36

small heat map img

K562
Farnham
HCFC1
ENCSR000EFN
r=0.36

small heat map img

K562
Farnham
SETDB1
ENCSR000EWI
r=0.34

small heat map img

K562
Farnham
BRF2
ENCSR000DOC
r=0.33

small heat map img

K562
Farnham
MEF2A
ENCSR000BNV
r=0.33

small heat map img

K562
Farnham
GTF2B
ENCSR000DOE
r=0.32

small heat map img

K562
Farnham
FOSL1
ENCSR000BMV
r=0.32

small heat map img

K562
Farnham
USF1
ENCSR000BKT
r=0.32

small heat map img

K562
Farnham
POLR2A
ENCSR000FAY
r=0.32

small heat map img

K562
Farnham
POLR2A
ENCSR000FAX
r=0.32

small heat map img

K562
Farnham
GTF3C2
ENCSR000DOD
r=0.31

small heat map img

K562
Farnham
TRIM28
ENCSR000EVY
r=0.31

small heat map img

K562
Farnham
CREBBP
ENCSR000ATT
r=0.30

small heat map img

K562
Farnham
ATF3
ENCSR000DOG
r=0.30

small heat map img

K562
Farnham
POLR2A
ENCSR000FAJ
r=0.30

small heat map img

K562
Farnham
BDP1
ENCSR000DOK
r=0.30

small heat map img

K562
Farnham
CBX3
ENCSR000ATV
r=0.29

small heat map img

K562
Farnham
POLR2A
ENCSR000BMR
r=0.29

small heat map img

K562
Farnham
RFX5
ENCSR000EGO
r=0.29

small heat map img

K562
Farnham
SAP30
ENCSR000AQJ
r=0.28

small heat map img

K562
Farnham
HDAC6
ENCSR000ATJ
r=0.28

small heat map img

K562
Farnham
CTCF
ENCSR000EGM
r=0.28

small heat map img

K562
Farnham
USF2
ENCSR000EHG
r=0.28

small heat map img

K562
Farnham
SPI1
ENCSR000BGW
r=0.28

small heat map img

K562
Farnham
WHSC1
ENCSR000AVE
r=0.28

small heat map img

K562
Farnham
ETS1
ENCSR000BKQ
r=0.27

small heat map img

K562
Farnham
CHD4
ENCSR000ATL
r=0.27

small heat map img

K562
Farnham
SRF
ENCSR000BLK
r=0.27

small heat map img

K562
Farnham
POLR2A
ENCSR000EHP
r=0.27

small heat map img

K562
Farnham
RNF2
ENCSR000AUA
r=0.26

small heat map img

K562
Farnham
TBP
ENCSR000EHA
r=0.26

small heat map img

K562
Farnham
POLR2A
ENCSR000FAW
r=0.26

small heat map img

K562
Farnham
TAF1
ENCSR000BKS
r=0.25

small heat map img

K562
Farnham
SP1
ENCSR000BKO
r=0.25

small heat map img

K562
Farnham
KDM5B
ENCSR000AQA
r=0.25

small heat map img

K562
Farnham
XRCC4
ENCSR000FAC
r=0.25

small heat map img

K562
Farnham
YY1
ENCSR000EWF
r=0.24

small heat map img

K562
Farnham
SIRT6
ENCSR000AUB
r=0.23

small heat map img

K562
Farnham
NRF1
ENCSR000EHH
r=0.23

small heat map img

K562
Farnham
YY1
ENCSR000BKU
r=0.23

small heat map img

K562
Farnham
ATF3
ENCSR000BNU
r=0.23

small heat map img

K562
Farnham
CTCF
ENCSR000AKO
r=0.21

small heat map img

K562
Farnham
ZNF263
ENCSR000EWN
r=0.20

small heat map img

K562
Farnham
CTCF
ENCSR000DMA
r=0.20

small heat map img

K562
Farnham
ZBTB7A
ENCSR000BME
r=0.20

small heat map img

K562
Farnham
ZBTB33
ENCSR000BKF
r=0.20

small heat map img

K562
Farnham
BRF1
ENCSR000DOJ
r=0.20

small heat map img

K562
Farnham
SETDB1
ENCSR000EWD
r=0.19

small heat map img

K562
Farnham
POLR3G
ENCSR000EHQ
r=0.19

small heat map img

K562
Farnham
RAD21
ENCSR000BKV
r=0.19

small heat map img

K562
Farnham
UBTF
ENCSR000EFZ
r=0.19

small heat map img

K562
Farnham
REST
ENCSR000ATM
r=0.18

small heat map img

K562
Farnham
SUZ12
ENCSR000AUC
r=0.18

small heat map img

K562
Farnham
NFYB
ENCSR000EGQ
r=0.17

small heat map img

K562
Farnham
CTCF
ENCSR000DWE
r=0.17

small heat map img

K562
Farnham
ELF1
ENCSR000BMD
r=0.16

small heat map img

K562
Farnham
E2F6
ENCSR000BLI
r=0.16

small heat map img

K562
Farnham
CHD1
ENCSR000AQD
r=0.16

small heat map img

K562
Farnham
UBTF
ENCSR000EFW
r=0.15

small heat map img

K562
Farnham
CTCF
ENCSR000BPJ
r=0.15

small heat map img

K562
Farnham
SIN3A
ENCSR000BLR
r=0.14

small heat map img

K562
Farnham
NR2C2
ENCSR000EWH
r=0.14

small heat map img

K562
Farnham
PHF8
ENCSR000AQH
r=0.13

small heat map img

K562
Farnham
YY1
ENCSR000BMH
r=0.11

small heat map img

K562
Farnham
CTCFL
ENCSR000BNK
r=0.11

small heat map img

K562
Farnham
TAF7
ENCSR000BNM
r=0.11

small heat map img

K562
Farnham
POLR3A
ENCSR000DOI
r=0.11

small heat map img

K562
Farnham
CBX8
ENCSR000ATW
r=0.11

small heat map img

K562
Farnham
SP2
ENCSR000BNL
r=0.10

small heat map img

K562
Farnham
THAP1
ENCSR000BNN
r=0.09

small heat map img

K562
Farnham
SIX5
ENCSR000BNW
r=0.08

small heat map img

K562
Farnham
ZNF274
ENCSR000EWE
r=0.07

small heat map img

K562
Farnham
SIX5
ENCSR000BGX
r=0.06

small heat map img

K562
Farnham
CBX2
ENCSR000ATU
r=0.06

small heat map img
10,000 randomly-selected peaks from a total of 10,648 (download )

K562 - Myers - ENCSR000BKM

K562
Myers
GATA2
ENCSR000BKM
r=1.00

small heat map img

K562
Myers
TAL1
ENCSR000EHB
r=0.80

small heat map img

K562
Myers
TEAD4
ENCSR000BRK
r=0.79

small heat map img

K562
Myers
GATA2
ENCSR000EWG
r=0.75

small heat map img

K562
Myers
GATA1
ENCSR000EFT
r=0.75

small heat map img

K562
Myers
CEBPD
ENCSR000BVY
r=0.75

small heat map img

K562
Myers
EP300
ENCSR000EGE
r=0.75

small heat map img

K562
Myers
STAT5A
ENCSR000BRR
r=0.73

small heat map img

K562
Myers
ZMIZ1
ENCSR000EFQ
r=0.69

small heat map img

K562
Myers
NR2F2
ENCSR000BRS
r=0.69

small heat map img

K562
Myers
TBL1XR1
ENCSR000EGB
r=0.65

small heat map img

K562
Myers
RCOR1
ENCSR000EGG
r=0.65

small heat map img

K562
Myers
TRIM28
ENCSR000BRW
r=0.64

small heat map img

K562
Myers
GATA1
ENCSR000EWM
r=0.63

small heat map img

K562
Myers
CCNT2
ENCSR000DOA
r=0.61

small heat map img

K562
Myers
ATF1
ENCSR000DNZ
r=0.61

small heat map img

K562
Myers
JUN
ENCSR000EZT
r=0.60

small heat map img

K562
Myers
PML
ENCSR000BQY
r=0.59

small heat map img

K562
Myers
STAT2
ENCSR000FAT
r=0.58

small heat map img

K562
Myers
RCOR1
ENCSR000EGC
r=0.58

small heat map img

K562
Myers
EP300
ENCSR000EGY
r=0.58

small heat map img

K562
Myers
MYC
ENCSR000EZU
r=0.57

small heat map img

K562
Myers
STAT2
ENCSR000FBC
r=0.57

small heat map img

K562
Myers
MYC
ENCSR000EGS
r=0.56

small heat map img

K562
Myers
KDM1A
ENCSR000ATX
r=0.56

small heat map img

K562
Myers
JUN
ENCSR000EZW
r=0.56

small heat map img

K562
Myers
JUND
ENCSR000EGN
r=0.56

small heat map img

K562
Myers
ARID3A
ENCSR000EFY
r=0.56

small heat map img

K562
Myers
MYC
ENCSR000EZV
r=0.56

small heat map img

K562
Myers
REST
ENCSR000BMW
r=0.55

small heat map img

K562
Myers
JUN
ENCSR000EZX
r=0.55

small heat map img

K562
Myers
STAT1
ENCSR000FAU
r=0.54

small heat map img

K562
Myers
MYC
ENCSR000FAZ
r=0.53

small heat map img

K562
Myers
GABPA
ENCSR000BLO
r=0.53

small heat map img

K562
Myers
IRF1
ENCSR000EGK
r=0.53

small heat map img

K562
Myers
IRF1
ENCSR000EGL
r=0.53

small heat map img

K562
Myers
JUN
ENCSR000EGH
r=0.53

small heat map img

K562
Myers
CEBPB
ENCSR000BRQ
r=0.52

small heat map img

K562
Myers
STAT1
ENCSR000FAV
r=0.52

small heat map img

K562
Myers
TBL1XR1
ENCSR000EGA
r=0.52

small heat map img

K562
Myers
JUN
ENCSR000FAH
r=0.51

small heat map img

K562
Myers
IRF1
ENCSR000EGT
r=0.51

small heat map img

K562
Myers
STAT1
ENCSR000EHK
r=0.51

small heat map img

K562
Myers
JUN
ENCSR000EFS
r=0.50

small heat map img

K562
Myers
STAT1
ENCSR000EHJ
r=0.49

small heat map img

K562
Myers
BHLHE40
ENCSR000EGV
r=0.49

small heat map img

K562
Myers
HMGN3
ENCSR000DOB
r=0.49

small heat map img

K562
Myers
SIRT6
ENCSR000DOH
r=0.48

small heat map img

K562
Myers
MYC
ENCSR000FAG
r=0.48

small heat map img

K562
Myers
SMARCA4
ENCSR000EHO
r=0.48

small heat map img

K562
Myers
MYC
ENCSR000DLZ
r=0.48

small heat map img

K562
Myers
CBX3
ENCSR000BRT
r=0.47

small heat map img

K562
Myers
ZNF274
ENCSR000EVX
r=0.47

small heat map img

K562
Myers
EP300
ENCSR000AQB
r=0.46

small heat map img

K562
Myers
MXI1
ENCSR000EGZ
r=0.46

small heat map img

K562
Myers
CUX1
ENCSR000EFO
r=0.46

small heat map img

K562
Myers
MYC
ENCSR000EGJ
r=0.46

small heat map img

K562
Myers
FOS
ENCSR000FAI
r=0.45

small heat map img

K562
Myers
IRF1
ENCSR000EGU
r=0.44

small heat map img

K562
Myers
POLR2A
ENCSR000EHL
r=0.44

small heat map img

K562
Myers
MAX
ENCSR000EFV
r=0.43

small heat map img

K562
Myers
EZH2
ENCSR000AQE
r=0.41

small heat map img

K562
Myers
CREB1
ENCSR000BSO
r=0.41

small heat map img

K562
Myers
MAFF
ENCSR000EGI
r=0.39

small heat map img

K562
Myers
SMARCB1
ENCSR000EHN
r=0.39

small heat map img

K562
Myers
MAX
ENCSR000FAE
r=0.39

small heat map img

K562
Myers
MAFK
ENCSR000EGX
r=0.38

small heat map img

K562
Myers
HDAC2
ENCSR000BMG
r=0.38

small heat map img

K562
Myers
NFYA
ENCSR000EGR
r=0.36

small heat map img

K562
Myers
NCOR1
ENCSR000ATY
r=0.36

small heat map img

K562
Myers
ZNF384
ENCSR000EFP
r=0.36

small heat map img

K562
Myers
CEBPB
ENCSR000EHE
r=0.34

small heat map img

K562
Myers
MAX
ENCSR000BLP
r=0.33

small heat map img

K562
Myers
MEF2A
ENCSR000BNV
r=0.33

small heat map img

K562
Myers
SMC3
ENCSR000EGW
r=0.33

small heat map img

K562
Myers
EGR1
ENCSR000BNE
r=0.32

small heat map img

K562
Myers
HDAC1
ENCSR000AQF
r=0.31

small heat map img

K562
Myers
RAD21
ENCSR000FAD
r=0.31

small heat map img

K562
Myers
CHD7
ENCSR000AVD
r=0.30

small heat map img

K562
Myers
BACH1
ENCSR000EGD
r=0.30

small heat map img

K562
Myers
POLR2A
ENCSR000DLY
r=0.30

small heat map img

K562
Myers
SETDB1
ENCSR000AUT
r=0.30

small heat map img

K562
Myers
E2F4
ENCSR000EWL
r=0.29

small heat map img

K562
Myers
NFE2
ENCSR000FAF
r=0.29

small heat map img

K562
Myers
ELK1
ENCSR000EFU
r=0.29

small heat map img

K562
Myers
ZNF143
ENCSR000EGP
r=0.28

small heat map img

K562
Myers
FOSL1
ENCSR000BMV
r=0.28

small heat map img

K562
Myers
HDAC2
ENCSR000AQG
r=0.28

small heat map img

K562
Myers
RFX5
ENCSR000EGO
r=0.27

small heat map img

K562
Myers
USF1
ENCSR000BKT
r=0.27

small heat map img

K562
Myers
HCFC1
ENCSR000EFN
r=0.27

small heat map img

K562
Myers
KAT2B
ENCSR000ATZ
r=0.26

small heat map img

K562
Myers
RBBP5
ENCSR000AQI
r=0.26

small heat map img

K562
Myers
TRIM28
ENCSR000EVY
r=0.25

small heat map img

K562
Myers
SPI1
ENCSR000BGW
r=0.25

small heat map img

K562
Myers
POLR2A
ENCSR000BMR
r=0.24

small heat map img

K562
Myers
POLR2A
ENCSR000FAY
r=0.24

small heat map img

K562
Myers
POLR2A
ENCSR000FAX
r=0.24

small heat map img

K562
Myers
GTF2B
ENCSR000DOE
r=0.23

small heat map img

K562
Myers
SP1
ENCSR000BKO
r=0.23

small heat map img

K562
Myers
E2F6
ENCSR000EWJ
r=0.23

small heat map img

K562
Myers
SRF
ENCSR000BLK
r=0.23

small heat map img

K562
Myers
BRF2
ENCSR000DOC
r=0.23

small heat map img

K562
Myers
BDP1
ENCSR000DOK
r=0.22

small heat map img

K562
Myers
ETS1
ENCSR000BKQ
r=0.22

small heat map img

K562
Myers
CREBBP
ENCSR000ATT
r=0.22

small heat map img

K562
Myers
POLR2A
ENCSR000FAJ
r=0.22

small heat map img

K562
Myers
TBP
ENCSR000EHA
r=0.21

small heat map img

K562
Myers
GTF3C2
ENCSR000DOD
r=0.21

small heat map img

K562
Myers
CTCF
ENCSR000EGM
r=0.21

small heat map img

K562
Myers
SETDB1
ENCSR000EWI
r=0.21

small heat map img

K562
Myers
POLR2A
ENCSR000EHP
r=0.20

small heat map img

K562
Myers
CHD4
ENCSR000ATL
r=0.19

small heat map img

K562
Myers
ATF3
ENCSR000DOG
r=0.19

small heat map img

K562
Myers
ZBTB33
ENCSR000BKF
r=0.19

small heat map img

K562
Myers
TAF1
ENCSR000BKS
r=0.19

small heat map img

K562
Myers
RNF2
ENCSR000AUA
r=0.18

small heat map img

K562
Myers
SAP30
ENCSR000AQJ
r=0.18

small heat map img

K562
Myers
POLR2A
ENCSR000FAW
r=0.18

small heat map img

K562
Myers
UBTF
ENCSR000EFZ
r=0.18

small heat map img

K562
Myers
USF2
ENCSR000EHG
r=0.18

small heat map img

K562
Myers
NRF1
ENCSR000EHH
r=0.18

small heat map img

K562
Myers
XRCC4
ENCSR000FAC
r=0.16

small heat map img

K562
Myers
CBX3
ENCSR000ATV
r=0.16

small heat map img

K562
Myers
HDAC6
ENCSR000ATJ
r=0.16

small heat map img

K562
Myers
WHSC1
ENCSR000AVE
r=0.16

small heat map img

K562
Myers
YY1
ENCSR000BKU
r=0.16

small heat map img

K562
Myers
ATF3
ENCSR000BNU
r=0.15

small heat map img

K562
Myers
KDM5B
ENCSR000AQA
r=0.15

small heat map img

K562
Myers
SIRT6
ENCSR000AUB
r=0.14

small heat map img

K562
Myers
YY1
ENCSR000EWF
r=0.14

small heat map img

K562
Myers
ZBTB7A
ENCSR000BME
r=0.14

small heat map img

K562
Myers
UBTF
ENCSR000EFW
r=0.14

small heat map img

K562
Myers
SETDB1
ENCSR000EWD
r=0.14

small heat map img

K562
Myers
NFYB
ENCSR000EGQ
r=0.14

small heat map img

K562
Myers
POLR3G
ENCSR000EHQ
r=0.13

small heat map img

K562
Myers
BRF1
ENCSR000DOJ
r=0.13

small heat map img

K562
Myers
CTCF
ENCSR000DMA
r=0.13

small heat map img

K562
Myers
RAD21
ENCSR000BKV
r=0.13

small heat map img

K562
Myers
CTCF
ENCSR000AKO
r=0.13

small heat map img

K562
Myers
REST
ENCSR000ATM
r=0.12

small heat map img

K562
Myers
E2F6
ENCSR000BLI
r=0.12

small heat map img

K562
Myers
ELF1
ENCSR000BMD
r=0.11

small heat map img

K562
Myers
SUZ12
ENCSR000AUC
r=0.11

small heat map img

K562
Myers
SIN3A
ENCSR000BLR
r=0.11

small heat map img

K562
Myers
POLR3A
ENCSR000DOI
r=0.10

small heat map img

K562
Myers
CHD1
ENCSR000AQD
r=0.09

small heat map img

K562
Myers
CTCF
ENCSR000BPJ
r=0.08

small heat map img

K562
Myers
TAF7
ENCSR000BNM
r=0.08

small heat map img

K562
Myers
CBX8
ENCSR000ATW
r=0.08

small heat map img

K562
Myers
YY1
ENCSR000BMH
r=0.08

small heat map img

K562
Myers
CTCF
ENCSR000DWE
r=0.08

small heat map img

K562
Myers
CTCFL
ENCSR000BNK
r=0.06

small heat map img

K562
Myers
NR2C2
ENCSR000EWH
r=0.06

small heat map img

K562
Myers
SIX5
ENCSR000BNW
r=0.06

small heat map img

K562
Myers
ZNF263
ENCSR000EWN
r=0.06

small heat map img

K562
Myers
SP2
ENCSR000BNL
r=0.05

small heat map img

K562
Myers
PHF8
ENCSR000AQH
r=0.05

small heat map img

K562
Myers
SIX5
ENCSR000BGX
r=0.04

small heat map img

K562
Myers
THAP1
ENCSR000BNN
r=0.03

small heat map img

K562
Myers
ZNF274
ENCSR000EWE
r=0.02

small heat map img

K562
Myers
CBX2
ENCSR000ATU
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 19,322 (download )

SH-SY5Y - Farnham - ENCSR000EYB

SH-SY5Y
Farnham
GATA2
ENCSR000EYB
r=1.00

small heat map img

SH-SY5Y
Farnham
GATA3
ENCSR000EXZ
r=0.79

small heat map img
10,000 randomly-selected peaks from a total of 35,620 (download )

endothelial cell of umbilical vein - Farnham - ENCSR000EVW

endothelial cell of umbilical vein
Farnham
GATA2
ENCSR000EVW
r=1.00

small heat map img

endothelial cell of umbilical vein
Farnham
FOS
ENCSR000EVU
r=0.66

small heat map img

endothelial cell of umbilical vein
Farnham
JUN
ENCSR000EFA
r=0.62

small heat map img

endothelial cell of umbilical vein
Farnham
MYC
ENCSR000DLU
r=0.48

small heat map img

endothelial cell of umbilical vein
Farnham
MAX
ENCSR000EEZ
r=0.38

small heat map img

endothelial cell of umbilical vein
Farnham
POLR2A
ENCSR000BQB
r=0.29

small heat map img

endothelial cell of umbilical vein
Farnham
POLR2A
ENCSR000DLV
r=0.29

small heat map img

endothelial cell of umbilical vein
Farnham
POLR2A
ENCSR000EFB
r=0.22

small heat map img

endothelial cell of umbilical vein
Farnham
EZH2
ENCSR000ATA
r=0.18

small heat map img

endothelial cell of umbilical vein
Farnham
CTCF
ENCSR000DLW
r=0.14

small heat map img

endothelial cell of umbilical vein
Farnham
CTCF
ENCSR000ALA
r=0.12

small heat map img

endothelial cell of umbilical vein
Farnham
CTCF
ENCSR000DVP
r=0.10

small heat map img
10,000 randomly-selected peaks from a total of 27,454 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

K562 - Farnham - ENCSR000EWG

loading

K562 - Myers - ENCSR000BKM

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help