FOXP2

This gene encodes a member of the forkhead/winged-helix (FOX) family of transcription factors. It is expressed in fetal and adult brain as well as in several other organs such as the lung and gut. The protein product contains a FOX DNA-binding domain and a large polyglutamine tract and is an evolutionarily conserved transcription factor, which may bind directly to approximately 300 to 400 gene promoters in the human genome to regulate the expression of a variety of genes. This gene is required for proper development of speech and language regions of the brain during embryogenesis, and may be involved in a variety of biological pathways and cascades that may ultimately influence language development. Mutations in this gene cause speech-language disorder 1 (SPCH1), also known as autosomal dominant speech and language disorder with orofacial dyspraxia. Multiple alternative transcripts encoding different isoforms have been identified in this gene.RefSeq, Feb 2010
Forkhead box protein P2 (FOXP2) is a protein that, in humans, is encoded by the FOXP2 gene, also known as CAGH44, SPCH1 or TNRC10, and is required for proper development of speech and language. Initially identified as the genetic factor of speech disorder in KE family, its gene is the first gene discovered associated with speech and language.wikipedia

FOXP2

PDB image
PDB 2A07

PDB 2A07 2AS5
ENCODE experiments
Ensemble search
Entrez 93986
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia FOXP2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

PFSK-1 - Myers - ENCSR000BGA

1.
267 / 500
7.6e-282
TGTAAACAGGC
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 1.06
2.
23 / 500
2.7e-79
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.75
3.
147 / 500
2.1e-36
GAACAGGAAGT
small heat map img p-value: 0.00
pct_center: 0.37
pct_ratio: 1.00
4.
94 / 500
5.8e-21
GTGACTCA
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 1.37
5.
46 / 500
1.9e-14
TGTGTGTGTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

SK-N-MC - Myers - ENCSR000BGB

1.
393 / 500
4.1e-313
ATGTAAACAGA
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 1.21
2.
132 / 500
4.6e-27
GGGGGGGAGGGGGCAGGGGGG
small heat map img p-value: 0.00
pct_center: 0.56
pct_ratio: 0.56
3.
8 / 500
1.3e-20
GTGTGTGTGTGTGTGTGTGTGTGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.69
4.
60 / 500
5.1e-21
ACAGCAGGAAG
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.86
5.
16 / 500
73
AAAACAGCAAGAAAA
small heat map img p-value: 0.16
pct_center: 0.16
pct_ratio: 0.39
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at FOXP2 peaks

PFSK-1 - Myers - ENCSR000BGA

PFSK-1
Myers
FOXP2
ENCSR000BGA
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 18,182 (download )

SK-N-MC - Myers - ENCSR000BGB

SK-N-MC
Myers
FOXP2
ENCSR000BGB
r=1.00

small heat map img

SK-N-MC
Myers
H3K4me3
ENCSR000DXL
r=0.21

small heat map img
10,000 randomly-selected peaks from a total of 14,695 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at FOXP2 peaks

PFSK-1 - Myers - ENCSR000BGA

PFSK-1
Myers
FOXP2
ENCSR000BGA
r=1.00

small heat map img

PFSK-1
Myers
REST
ENCSR000BJP
r=0.30

small heat map img

PFSK-1
Myers
TAF1
ENCSR000BQN
r=0.28

small heat map img

PFSK-1
Myers
REST
ENCSR000BOX
r=0.22

small heat map img

PFSK-1
Myers
SIN3A
ENCSR000BOY
r=0.21

small heat map img
10,000 randomly-selected peaks from a total of 18,182 (download )

SK-N-MC - Myers - ENCSR000BGB

SK-N-MC
Myers
FOXP2
ENCSR000BGB
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 14,695 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help