FOXM1

The protein encoded by this gene is a transcriptional activator involved in cell proliferation. The encoded protein is phosphorylated in M phase and regulates the expression of several cell cycle genes, such as cyclin B1 and cyclin D1. Several transcript variants encoding different isoforms have been found for this gene. RefSeq, Jul 2011
Forkhead box protein M1 is a protein that in humans is encoded by the FOXM1 gene. The protein encoded by this gene is a member of the FOX family of transcription factors.wikipedia

FOXM1

PDB image
PDB 3G73

PDB 3G73
ENCODE experiments
Ensemble search
Entrez 2305
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia FOXM1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

GM12878 - Myers - ENCSR000BRU

loading

MCF-7 - Myers - ENCSR000BUJ

loading

SK-N-SH - Myers - ENCSR000BTB

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

GM12878 - Myers - ENCSR000BRU

1.
196 / 500
8.6e-91
AAGAGGAAGTGAAAA
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 0.69
2.
172 / 500
1.8e-86
TTTAGATATGAGTCA
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 1.46
3.
112 / 500
2.3e-22
TGTGGT
small heat map img p-value: 0.00
pct_center:
pct_ratio:
4.
79 / 500
1.5e-19
GGGAAAATCCC
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.73
5.
57 / 500
4.4e-14
TGTGTGGGTGGGGGG
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Ishikawa - Myers - ENCSR000BUS

1.
112 / 500
2.8e-88
GGGGCGGGGGCGGGGGTGGGGAGTGGGGG
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 0.54
2.
139 / 500
4.4e-77
TGGAATCAAAAAAAGAAAAAGAAAAGAAA
small heat map img p-value: 0.89
pct_center: 0.24
pct_ratio: 0.42
3.
80 / 500
1.8e-43
GCCCCCAGGTGTGGCCGGGGCGGCAGCTG
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 0.60
4.
36 / 500
2.0e-36
CAGTTTTTTCATTTGTCAATGTGGAAAATA
small heat map img p-value: 0.21
pct_center: 0.12
pct_ratio: 0.44
5.
20 / 500
8.7e-32
TAGTGGCAGAGACACCTGGCTGAGGTCAGG
small heat map img p-value: 0.32
pct_center: 0.18
pct_ratio: 0.57
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF-7 - Myers - ENCSR000BUJ

1.
116 / 500
4.3e-92
AGGTCAGAGTGACCC
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 1.40
2.
86 / 500
1.8e-34
GAGGGCGGGGGAGGGGCGGGGGCGGAGGC
small heat map img p-value: 1.00
pct_center: 0.26
pct_ratio: 0.49
3.
101 / 500
5.5e-9
TGAGCAAACAATT
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 0.94
4.
6 / 500
0.0063
TTAAGATAAGGAAGTCTGTTAACCAA
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.58
5.
27 / 500
5.0
TGTGTGTGTGTTTGT
small heat map img p-value: 1.00
pct_center: 0.21
pct_ratio: 0.44
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

SK-N-SH - Myers - ENCSR000BTB

1.
36 / 500
5.4e-31
GGGCGGGGGCGGGGGCAGGAGGGCCGGCGC
small heat map img p-value: 0.90
pct_center: 0.11
pct_ratio: 0.66
2.
92 / 500
7.6e-14
TGAGTCAT
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 1.17
3.
33 / 500
7.0e-9
AAAAAAAAAAAAAAA
small heat map img p-value: 1.00
pct_center: 0.27
pct_ratio: 0.34
4.
55 / 500
3.2e-7
GAAAAAAGAGGGAGAGAGGAA
small heat map img p-value: 0.98
pct_center: 0.29
pct_ratio: 0.49
5.
34 / 500
0.013
TGTGGTTT
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 1.11
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at FOXM1 peaks

GM12878 - Myers - ENCSR000BRU

GM12878
Myers
FOXM1
ENCSR000BRU
r=1.00

small heat map img

GM12878
Myers
H3K27ac
ENCSR000AKC
r=0.34

small heat map img

GM12878
Myers
H3K4me2
ENCSR000AKG
r=0.31

small heat map img

GM12878
Myers
H3K4me1
ENCSR000AKF
r=0.29

small heat map img

GM12878
Myers
H2AFZ
ENCSR000AOV
r=0.27

small heat map img

GM12878
Myers
H3K4me3
ENCSR000AKA
r=0.27

small heat map img

GM12878
Myers
H3K9ac
ENCSR000AKH
r=0.27

small heat map img

GM12878
Myers
H3K4me3
ENCSR000DRY
r=0.15

small heat map img

GM12878
Myers
H3K79me2
ENCSR000AOW
r=0.11

small heat map img

GM12878
Myers
H3K9me3
ENCSR000AOX
r=0.05

small heat map img

GM12878
Myers
H3K36me3
ENCSR000DRW
r=-0.01

small heat map img

GM12878
Myers
H4K20me1
ENCSR000AKI
r=-0.01

small heat map img

GM12878
Myers
H3K36me3
ENCSR000AKE
r=-0.02

small heat map img

GM12878
Myers
H3K27me3
ENCSR000AKD
r=-0.06

small heat map img

GM12878
Myers
H3K27me3
ENCSR000DRX
r=-0.06

small heat map img
10,000 randomly-selected peaks from a total of 22,926 (download )

Ishikawa - Myers - ENCSR000BUS

Ishikawa
Myers
FOXM1
ENCSR000BUS
r=1.00

small heat map img
6,180 peaks (download )

MCF-7 - Myers - ENCSR000BUJ

MCF-7
Myers
FOXM1
ENCSR000BUJ
r=1.00

small heat map img

MCF-7
Myers
H3K27ac
ENCSR000EWR
r=0.30

small heat map img

MCF-7
Myers
H3K4me3
ENCSR000DWJ
r=0.21

small heat map img

MCF-7
Myers
H3K36me3
ENCSR000EWO
r=0.00

small heat map img

MCF-7
Myers
H3K9me3
ENCSR000EWQ
r=-0.00

small heat map img

MCF-7
Myers
H3K27me3
ENCSR000EWP
r=-0.06

small heat map img
1,841 peaks (download )

SK-N-SH - Myers - ENCSR000BTB

SK-N-SH
Myers
FOXM1
ENCSR000BTB
r=1.00

small heat map img

SK-N-SH
Myers
H3K4me3
ENCSR000DXR
r=0.15

small heat map img

SK-N-SH
Myers
H3K27me3
ENCSR000DXP
r=0.01

small heat map img

SK-N-SH
Myers
H3K36me3
ENCSR000DXO
r=-0.02

small heat map img
1,114 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at FOXM1 peaks

GM12878 - Myers - ENCSR000BRU

GM12878
Myers
FOXM1
ENCSR000BRU
r=1.00

small heat map img

GM12878
Myers
RUNX3
ENCSR000BRI
r=0.70

small heat map img

GM12878
Myers
TBL1XR1
ENCSR000DYZ
r=0.67

small heat map img

GM12878
Myers
EP300
ENCSR000DZG
r=0.67

small heat map img

GM12878
Myers
EP300
ENCSR000DZD
r=0.66

small heat map img

GM12878
Myers
NFIC
ENCSR000BRN
r=0.66

small heat map img

GM12878
Myers
RELA
ENCSR000EAG
r=0.66

small heat map img

GM12878
Myers
ATF2
ENCSR000BQK
r=0.63

small heat map img

GM12878
Myers
RCOR1
ENCSR000DZC
r=0.60

small heat map img

GM12878
Myers
STAT3
ENCSR000DZV
r=0.59

small heat map img

GM12878
Myers
CUX1
ENCSR000DYR
r=0.58

small heat map img

GM12878
Myers
BHLHE40
ENCSR000DZJ
r=0.56

small heat map img

GM12878
Myers
JUND
ENCSR000DYS
r=0.56

small heat map img

GM12878
Myers
IKZF1
ENCSR000EUJ
r=0.55

small heat map img

GM12878
Myers
CEBPB
ENCSR000BRX
r=0.54

small heat map img

GM12878
Myers
BCL3
ENCSR000BNQ
r=0.52

small heat map img

GM12878
Myers
SP1
ENCSR000BHK
r=0.51

small heat map img

GM12878
Myers
MEF2A
ENCSR000BKB
r=0.49

small heat map img

GM12878
Myers
NFATC1
ENCSR000BQL
r=0.49

small heat map img

GM12878
Myers
JUND
ENCSR000EYV
r=0.49

small heat map img

GM12878
Myers
MXI1
ENCSR000DZI
r=0.48

small heat map img

GM12878
Myers
ESRRA
ENCSR000DYQ
r=0.48

small heat map img

GM12878
Myers
STAT1
ENCSR000DZM
r=0.48

small heat map img

GM12878
Myers
SREBF1
ENCSR000DYU
r=0.48

small heat map img

GM12878
Myers
STAT5A
ENCSR000BQZ
r=0.47

small heat map img

GM12878
Myers
ELK1
ENCSR000DZB
r=0.47

small heat map img

GM12878
Myers
MAX
ENCSR000DZF
r=0.46

small heat map img

GM12878
Myers
BATF
ENCSR000BGT
r=0.45

small heat map img

GM12878
Myers
BCL11A
ENCSR000BHA
r=0.45

small heat map img

GM12878
Myers
MTA3
ENCSR000BRH
r=0.45

small heat map img

GM12878
Myers
PAX5
ENCSR000BHD
r=0.44

small heat map img

GM12878
Myers
PML
ENCSR000BQM
r=0.44

small heat map img

GM12878
Myers
CREB1
ENCSR000BUF
r=0.43

small heat map img

GM12878
Myers
EBF1
ENCSR000DZQ
r=0.43

small heat map img

GM12878
Myers
MAFK
ENCSR000DYV
r=0.43

small heat map img

GM12878
Myers
TCF12
ENCSR000BGZ
r=0.42

small heat map img

GM12878
Myers
CHD1
ENCSR000DZE
r=0.42

small heat map img

GM12878
Myers
ZNF384
ENCSR000DYP
r=0.41

small heat map img

GM12878
Myers
TBP
ENCSR000DZZ
r=0.41

small heat map img

GM12878
Myers
IRF4
ENCSR000BGY
r=0.41

small heat map img

GM12878
Myers
WRNIP1
ENCSR000EAA
r=0.41

small heat map img

GM12878
Myers
SMC3
ENCSR000DZP
r=0.40

small heat map img

GM12878
Myers
SREBF2
ENCSR000DYT
r=0.39

small heat map img

GM12878
Myers
EP300
ENCSR000BHB
r=0.39

small heat map img

GM12878
Myers
IRF3
ENCSR000DZX
r=0.38

small heat map img

GM12878
Myers
RAD21
ENCSR000EAC
r=0.38

small heat map img

GM12878
Myers
POU2F2
ENCSR000BGP
r=0.38

small heat map img

GM12878
Myers
PAX5
ENCSR000BHJ
r=0.38

small heat map img

GM12878
Myers
EBF1
ENCSR000BGU
r=0.37

small heat map img

GM12878
Myers
TCF3
ENCSR000BQT
r=0.36

small heat map img

GM12878
Myers
RFX5
ENCSR000DZW
r=0.36

small heat map img

GM12878
Myers
BRCA1
ENCSR000DZS
r=0.35

small heat map img

GM12878
Myers
SIN3A
ENCSR000DYX
r=0.35

small heat map img

GM12878
Myers
ELF1
ENCSR000BMB
r=0.34

small heat map img

GM12878
Myers
E2F4
ENCSR000DYY
r=0.33

small heat map img

GM12878
Myers
NFE2
ENCSR000DZY
r=0.33

small heat map img

GM12878
Myers
USF2
ENCSR000DZU
r=0.33

small heat map img

GM12878
Myers
FOS
ENCSR000EYZ
r=0.33

small heat map img

GM12878
Myers
ETS1
ENCSR000BKA
r=0.32

small heat map img

GM12878
Myers
EZH2
ENCSR000ARD
r=0.32

small heat map img

GM12878
Myers
YY1
ENCSR000BNP
r=0.31

small heat map img

GM12878
Myers
POLR2A
ENCSR000EAD
r=0.31

small heat map img

GM12878
Myers
NRF1
ENCSR000DZO
r=0.30

small heat map img

GM12878
Myers
SRF
ENCSR000BMI
r=0.29

small heat map img

GM12878
Myers
SPI1
ENCSR000BGQ
r=0.29

small heat map img

GM12878
Myers
POLR2A
ENCSR000EYW
r=0.27

small heat map img

GM12878
Myers
YY1
ENCSR000EUM
r=0.27

small heat map img

GM12878
Myers
POLR2A
ENCSR000DKT
r=0.27

small heat map img

GM12878
Myers
ZNF143
ENCSR000DZL
r=0.27

small heat map img

GM12878
Myers
RAD21
ENCSR000BMY
r=0.24

small heat map img

GM12878
Myers
NFYA
ENCSR000DNN
r=0.24

small heat map img

GM12878
Myers
MYC
ENCSR000DKU
r=0.24

small heat map img

GM12878
Myers
EGR1
ENCSR000BMQ
r=0.24

small heat map img

GM12878
Myers
RXRA
ENCSR000BJD
r=0.23

small heat map img

GM12878
Myers
KAT2A
ENCSR000DNO
r=0.22

small heat map img

GM12878
Myers
SIX5
ENCSR000BJE
r=0.22

small heat map img

GM12878
Myers
SUPT20H
ENCSR000DNP
r=0.21

small heat map img

GM12878
Myers
CTCF
ENCSR000DKV
r=0.20

small heat map img

GM12878
Myers
PBX3
ENCSR000BGR
r=0.20

small heat map img

GM12878
Myers
POLR2A
ENCSR000BGD
r=0.19

small heat map img

GM12878
Myers
CTCF
ENCSR000DZN
r=0.19

small heat map img

GM12878
Myers
TAF1
ENCSR000BGS
r=0.19

small heat map img

GM12878
Myers
NFYB
ENCSR000DNM
r=0.18

small heat map img

GM12878
Myers
MEF2C
ENCSR000BNG
r=0.18

small heat map img

GM12878
Myers
CTCF
ENCSR000AKB
r=0.18

small heat map img

GM12878
Myers
CTCF
ENCSR000DRZ
r=0.15

small heat map img

GM12878
Myers
POLR3G
ENCSR000EYU
r=0.14

small heat map img

GM12878
Myers
ZBTB33
ENCSR000BHC
r=0.12

small heat map img

GM12878
Myers
GABPA
ENCSR000BGC
r=0.11

small heat map img

GM12878
Myers
EGR1
ENCSR000BRG
r=0.11

small heat map img

GM12878
Myers
NR2C2
ENCSR000EUL
r=0.10

small heat map img

GM12878
Myers
ZEB1
ENCSR000BND
r=0.10

small heat map img

GM12878
Myers
ATF3
ENCSR000BJY
r=0.10

small heat map img

GM12878
Myers
USF1
ENCSR000BGI
r=0.10

small heat map img

GM12878
Myers
SRF
ENCSR000BGE
r=0.08

small heat map img

GM12878
Myers
REST
ENCSR000BQS
r=0.06

small heat map img

GM12878
Myers
REST
ENCSR000BGF
r=0.05

small heat map img

GM12878
Myers
ZZZ3
ENCSR000DNQ
r=0.03

small heat map img

GM12878
Myers
ZNF274
ENCSR000EUK
r=0.00

small heat map img
10,000 randomly-selected peaks from a total of 22,926 (download )

Ishikawa - Myers - ENCSR000BUS

Ishikawa
Myers
FOXM1
ENCSR000BUS
r=1.00

small heat map img

Ishikawa
Myers
EP300
ENCSR000BUE
r=0.84

small heat map img

Ishikawa
Myers
TEAD4
ENCSR000BSW
r=0.78

small heat map img

Ishikawa
Myers
NFIC
ENCSR000BUT
r=0.76

small heat map img

Ishikawa
Myers
TCF12
ENCSR000BUV
r=0.76

small heat map img

Ishikawa
Myers
CEBPB
ENCSR000BTT
r=0.65

small heat map img

Ishikawa
Myers
RAD21
ENCSR000BTU
r=0.64

small heat map img

Ishikawa
Myers
MAX
ENCSR000BTY
r=0.63

small heat map img

Ishikawa
Myers
SRF
ENCSR000BTD
r=0.59

small heat map img

Ishikawa
Myers
NR3C1
ENCSR000BJC
r=0.58

small heat map img

Ishikawa
Myers
YY1
ENCSR000BSY
r=0.56

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BIY
r=0.54

small heat map img

Ishikawa
Myers
USF1
ENCSR000BSX
r=0.49

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BQR
r=0.49

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BKL
r=0.49

small heat map img

Ishikawa
Myers
CREB1
ENCSR000BUR
r=0.48

small heat map img

Ishikawa
Myers
EGR1
ENCSR000BSQ
r=0.43

small heat map img

Ishikawa
Myers
TAF1
ENCSR000BTO
r=0.38

small heat map img

Ishikawa
Myers
ZBTB7A
ENCSR000BSZ
r=0.37

small heat map img

Ishikawa
Myers
REST
ENCSR000BUU
r=0.31

small heat map img

Ishikawa
Myers
FOXA1
ENCSR000BKW
r=0.29

small heat map img

Ishikawa
Myers
POLR2A
ENCSR000BKI
r=0.17

small heat map img

Ishikawa
Myers
CTCF
ENCSR000BQE
r=0.04

small heat map img
6,180 peaks (download )

MCF-7 - Myers - ENCSR000BUJ

MCF-7
Myers
FOXM1
ENCSR000BUJ
r=1.00

small heat map img

MCF-7
Myers
EP300
ENCSR000BTR
r=0.86

small heat map img

MCF-7
Myers
GATA3
ENCSR000BST
r=0.79

small heat map img

MCF-7
Myers
NR2F2
ENCSR000BUY
r=0.79

small heat map img

MCF-7
Myers
SIN3A
ENCSR000BUM
r=0.76

small heat map img

MCF-7
Myers
HDAC2
ENCSR000BTP
r=0.74

small heat map img

MCF-7
Myers
TEAD4
ENCSR000BUO
r=0.72

small heat map img

MCF-7
Myers
GABPA
ENCSR000BUK
r=0.70

small heat map img

MCF-7
Myers
ZNF217
ENCSR000EWU
r=0.70

small heat map img

MCF-7
Myers
TCF12
ENCSR000BUN
r=0.70

small heat map img

MCF-7
Myers
MAX
ENCSR000BUL
r=0.68

small heat map img

MCF-7
Myers
FOSL2
ENCSR000BUI
r=0.68

small heat map img

MCF-7
Myers
JUND
ENCSR000BSU
r=0.67

small heat map img

MCF-7
Myers
GATA3
ENCSR000EWS
r=0.67

small heat map img

MCF-7
Myers
REST
ENCSR000BSP
r=0.61

small heat map img

MCF-7
Myers
GATA3
ENCSR000EWV
r=0.60

small heat map img

MCF-7
Myers
ELF1
ENCSR000BSS
r=0.60

small heat map img

MCF-7
Myers
CEBPB
ENCSR000BSR
r=0.59

small heat map img

MCF-7
Myers
TCF7L2
ENCSR000EWT
r=0.58

small heat map img

MCF-7
Myers
SRF
ENCSR000BVA
r=0.58

small heat map img

MCF-7
Myers
RAD21
ENCSR000BTQ
r=0.56

small heat map img

MCF-7
Myers
MYC
ENCSR000DMQ
r=0.56

small heat map img

MCF-7
Myers
EGR1
ENCSR000BUX
r=0.55

small heat map img

MCF-7
Myers
PML
ENCSR000BUZ
r=0.55

small heat map img

MCF-7
Myers
MYC
ENCSR000DMP
r=0.54

small heat map img

MCF-7
Myers
TAF1
ENCSR000AHF
r=0.46

small heat map img

MCF-7
Myers
MYC
ENCSR000DMM
r=0.35

small heat map img

MCF-7
Myers
POLR2A
ENCSR000DMT
r=0.35

small heat map img

MCF-7
Myers
CTCF
ENCSR000AHD
r=0.33

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMR
r=0.27

small heat map img

MCF-7
Myers
MYC
ENCSR000DMJ
r=0.25

small heat map img

MCF-7
Myers
CTCF
ENCSR000DWH
r=0.25

small heat map img

MCF-7
Myers
POLR2A
ENCSR000DMK
r=0.23

small heat map img

MCF-7
Myers
CTCF
ENCSR000DML
r=0.22

small heat map img

MCF-7
Myers
POLR2A
ENCSR000DMN
r=0.22

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMS
r=0.22

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMV
r=0.21

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMO
r=0.20

small heat map img
1,841 peaks (download )

SK-N-SH - Myers - ENCSR000BTB

SK-N-SH
Myers
FOXM1
ENCSR000BTB
r=1.00

small heat map img

SK-N-SH
Myers
EP300
ENCSR000BUA
r=0.80

small heat map img

SK-N-SH
Myers
TEAD4
ENCSR000BUQ
r=0.77

small heat map img

SK-N-SH
Myers
JUND
ENCSR000BSK
r=0.77

small heat map img

SK-N-SH
Myers
TCF12
ENCSR000BSL
r=0.77

small heat map img

SK-N-SH
Myers
NFIC
ENCSR000BSV
r=0.76

small heat map img

SK-N-SH
Myers
PBX3
ENCSR000BVE
r=0.76

small heat map img

SK-N-SH
Myers
GATA3
ENCSR000BTH
r=0.75

small heat map img

SK-N-SH
Myers
RXRA
ENCSR000BVG
r=0.73

small heat map img

SK-N-SH
Myers
FOSL2
ENCSR000BVB
r=0.73

small heat map img

SK-N-SH
Myers
MEF2A
ENCSR000BVC
r=0.71

small heat map img

SK-N-SH
Myers
ZBTB33
ENCSR000BTS
r=0.69

small heat map img

SK-N-SH
Myers
JUND
ENCSR000EIB
r=0.69

small heat map img

SK-N-SH
Myers
EP300
ENCSR000EHV
r=0.65

small heat map img

SK-N-SH
Myers
ELF1
ENCSR000BTA
r=0.63

small heat map img

SK-N-SH
Myers
EP300
ENCSR000BMA
r=0.62

small heat map img

SK-N-SH
Myers
MAX
ENCSR000BVD
r=0.62

small heat map img

SK-N-SH
Myers
USF1
ENCSR000BTZ
r=0.52

small heat map img

SK-N-SH
Myers
SMC3
ENCSR000EHW
r=0.50

small heat map img

SK-N-SH
Myers
GABPA
ENCSR000BTG
r=0.48

small heat map img

SK-N-SH
Myers
RAD21
ENCSR000EHX
r=0.45

small heat map img

SK-N-SH
Myers
RFX5
ENCSR000EHY
r=0.44

small heat map img

SK-N-SH
Myers
YY1
ENCSR000BSM
r=0.43

small heat map img

SK-N-SH
Myers
MXI1
ENCSR000EIA
r=0.41

small heat map img

SK-N-SH
Myers
RAD21
ENCSR000BLY
r=0.40

small heat map img

SK-N-SH
Myers
SIN3A
ENCSR000BPB
r=0.36

small heat map img

SK-N-SH
Myers
REST
ENCSR000BOZ
r=0.35

small heat map img

SK-N-SH
Myers
CTCF
ENCSR000EIC
r=0.30

small heat map img

SK-N-SH
Myers
NRF1
ENCSR000EHZ
r=0.30

small heat map img

SK-N-SH
Myers
YY1
ENCSR000BLZ
r=0.28

small heat map img

SK-N-SH
Myers
USF1
ENCSR000BMF
r=0.24

small heat map img

SK-N-SH
Myers
TAF1
ENCSR000BQF
r=0.21

small heat map img

SK-N-SH
Myers
CTCF
ENCSR000DXQ
r=0.12

small heat map img

SK-N-SH
Myers
REST
ENCSR000BJJ
r=0.06

small heat map img

SK-N-SH
Myers
CTCF
ENCSR000BLX
r=0.05

small heat map img
1,114 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Myers - ENCSR000BRU

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help