FOXA2

This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific genes such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. This gene has been linked to sporadic cases of maturity-onset diabetes of the young. Transcript variants encoding different isoforms have been identified for this gene. RefSeq, Oct 2008
Hepatocyte nuclear factor 3-beta (HNF-3B), also known as forkhead box protein A2 (FOXA2) or transcription factor 3B (TCF-3B) is a protein that in humans is encoded by the FOXA2 gene.wikipedia

FOXA2


ENCODE experiments
Ensemble search
Entrez 3170
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia FOXA2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

A549 - Myers - ENCSR000BRE

loading

HepG2 - Myers - ENCSR000BNI

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

A549 - Myers - ENCSR000BRE

1.
270 / 500
1.6e-151
TGTTTACTTAG
small heat map img p-value: 0.00
pct_center: 0.56
pct_ratio: 3.02
2.
100 / 500
3.2e-28
GGGCAGGGGGGGGGGGGGGGC
small heat map img p-value: 0.71
pct_center: 0.52
pct_ratio: 0.67
3.
7 / 500
7.3e-27
GTGAGGTGACTGAACTGCAAGATGAGGTGG
small heat map img p-value: 0.72
pct_center: 0.11
pct_ratio: 0.47
4.
10 / 500
4.1e-9
TGCAGAGAGGGCAGCCTGAATGCTGAAATT
small heat map img p-value: 0.16
pct_center: 0.19
pct_ratio: 0.91
5.
47 / 500
0.000025
GCCCAGGGTGG
small heat map img p-value: 1.00
pct_center: 0.23
pct_ratio: 0.43
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Myers - ENCSR000BNI

1.
494 / 500
4.9e-570
CCTAAGTAAACAGGG
small heat map img p-value: 0.00
pct_center: 0.52
pct_ratio: 2.93
2.
326 / 500
3.6e-60
TGTTTACTTAG
small heat map img p-value: 0.00
pct_center: 0.52
pct_ratio: 2.36
3.
44 / 500
2.1
GGGGGAGG
small heat map img p-value: 1.00
pct_center: 0.25
pct_ratio: 0.45
4.
51 / 500
0.32
CAAGGTCAAAGTTCA
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.99
5.
18 / 500
1.3e+3
GAGCAGAAAAAGCAGTCAGGG
small heat map img p-value: 0.57
pct_center: 0.16
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at FOXA2 peaks

A549 - Myers - ENCSR000BRE

A549
Myers
FOXA2
ENCSR000BRE
r=1.00

small heat map img

A549
Myers
H3K4me2
ENCSR000AVI
r=0.34

small heat map img

A549
Myers
H3K4me2
ENCSR000ATO
r=0.34

small heat map img

A549
Myers
H3K27ac
ENCSR000AUI
r=0.31

small heat map img

A549
Myers
H3K4me1
ENCSR000AUM
r=0.29

small heat map img

A549
Myers
H2AFZ
ENCSR000AUG
r=0.29

small heat map img

A549
Myers
H3K4me1
ENCSR000AVH
r=0.29

small heat map img

A549
Myers
H3K27ac
ENCSR000AVF
r=0.29

small heat map img

A549
Myers
H2AFZ
ENCSR000AUH
r=0.29

small heat map img

A549
Myers
H3K4me3
ENCSR000ASH
r=0.28

small heat map img

A549
Myers
H3K9ac
ENCSR000ASV
r=0.26

small heat map img

A549
Myers
H3K4me3
ENCSR000AST
r=0.25

small heat map img

A549
Myers
H3K4me3
ENCSR000DPD
r=0.17

small heat map img

A549
Myers
H3K79me2
ENCSR000ATP
r=0.09

small heat map img

A549
Myers
H3K79me2
ENCSR000ASU
r=0.08

small heat map img

A549
Myers
H4K20me1
ENCSR000AUO
r=0.07

small heat map img

A549
Myers
H3K36me3
ENCSR000AUL
r=0.07

small heat map img

A549
Myers
H3K36me3
ENCSR000AVG
r=0.06

small heat map img

A549
Myers
H3K9me3
ENCSR000AUN
r=0.02

small heat map img

A549
Myers
H3K27me3
ENCSR000AUK
r=0.00

small heat map img

A549
Myers
H3K27me3
ENCSR000AUJ
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 23,001 (download )

HepG2 - Myers - ENCSR000BNI

HepG2
Myers
FOXA2
ENCSR000BNI
r=1.00

small heat map img

HepG2
Myers
H3K4me1
ENCSR000APV
r=0.17

small heat map img

HepG2
Myers
H3K27ac
ENCSR000AMO
r=0.15

small heat map img

HepG2
Myers
H3K4me2
ENCSR000AMC
r=0.12

small heat map img

HepG2
Myers
H3K9ac
ENCSR000AMD
r=0.10

small heat map img

HepG2
Myers
H2AFZ
ENCSR000AOK
r=0.09

small heat map img

HepG2
Myers
H3K4me3
ENCSR000AMP
r=0.07

small heat map img

HepG2
Myers
H3K9me3
ENCSR000ATD
r=0.05

small heat map img

HepG2
Myers
H3K79me2
ENCSR000AOM
r=0.03

small heat map img

HepG2
Myers
H3K4me3
ENCSR000DUF
r=0.03

small heat map img

HepG2
Myers
H3K27me3
ENCSR000AOL
r=0.02

small heat map img

HepG2
Myers
H4K20me1
ENCSR000AMQ
r=0.02

small heat map img

HepG2
Myers
H3K36me3
ENCSR000AMB
r=0.01

small heat map img

HepG2
Myers
H3K27me3
ENCSR000DUE
r=0.01

small heat map img

HepG2
Myers
H3K36me3
ENCSR000DUD
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 40,989 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at FOXA2 peaks

A549 - Myers - ENCSR000BRE

A549
Myers
FOXA2
ENCSR000BRE
r=1.00

small heat map img

A549
Myers
FOXA1
ENCSR000BPX
r=0.61

small heat map img

A549
Myers
SP1
ENCSR000BPE
r=0.51

small heat map img

A549
Myers
GATA3
ENCSR000BTI
r=0.49

small heat map img

A549
Myers
CEBPB
ENCSR000BUB
r=0.45

small heat map img

A549
Myers
TEAD4
ENCSR000BUD
r=0.44

small heat map img

A549
Myers
MAX
ENCSR000BTJ
r=0.43

small heat map img

A549
Myers
EP300
ENCSR000BPW
r=0.43

small heat map img

A549
Myers
FOSL2
ENCSR000BQO
r=0.41

small heat map img

A549
Myers
MAX
ENCSR000DYG
r=0.40

small heat map img

A549
Myers
CEBPB
ENCSR000DYI
r=0.40

small heat map img

A549
Myers
JUND
ENCSR000BRF
r=0.39

small heat map img

A549
Myers
PBX3
ENCSR000BTN
r=0.39

small heat map img

A549
Myers
RAD21
ENCSR000BUC
r=0.39

small heat map img

A549
Myers
NR3C1
ENCSR000BHF
r=0.38

small heat map img

A549
Myers
RAD21
ENCSR000DYE
r=0.38

small heat map img

A549
Myers
BHLHE40
ENCSR000DYJ
r=0.35

small heat map img

A549
Myers
TCF12
ENCSR000BQQ
r=0.35

small heat map img

A549
Myers
MYC
ENCSR000DYC
r=0.34

small heat map img

A549
Myers
ZBTB33
ENCSR000BPZ
r=0.33

small heat map img

A549
Myers
BCL3
ENCSR000BQH
r=0.32

small heat map img

A549
Myers
CREB1
ENCSR000BRB
r=0.31

small heat map img

A549
Myers
E2F6
ENCSR000BTC
r=0.31

small heat map img

A549
Myers
ATF3
ENCSR000BPS
r=0.30

small heat map img

A549
Myers
NR3C1
ENCSR000BHG
r=0.28

small heat map img

A549
Myers
NR3C1
ENCSR000BJR
r=0.28

small heat map img

A549
Myers
USF1
ENCSR000BHX
r=0.28

small heat map img

A549
Myers
CTCF
ENCSR000DYD
r=0.27

small heat map img

A549
Myers
SIN3A
ENCSR000BRM
r=0.26

small heat map img

A549
Myers
GABPA
ENCSR000BPY
r=0.26

small heat map img

A549
Myers
REST
ENCSR000BQP
r=0.25

small heat map img

A549
Myers
YY1
ENCSR000BPM
r=0.25

small heat map img

A549
Myers
ETS1
ENCSR000BPU
r=0.25

small heat map img

A549
Myers
SIX5
ENCSR000BRL
r=0.22

small heat map img

A549
Myers
CTCF
ENCSR000DNA
r=0.18

small heat map img

A549
Myers
NR3C1
ENCSR000BHE
r=0.18

small heat map img

A549
Myers
USF1
ENCSR000BJB
r=0.17

small heat map img

A549
Myers
CTCF
ENCSR000AUF
r=0.17

small heat map img

A549
Myers
TAF1
ENCSR000BPF
r=0.17

small heat map img

A549
Myers
ELF1
ENCSR000BPT
r=0.16

small heat map img

A549
Myers
CTCF
ENCSR000AUE
r=0.15

small heat map img

A549
Myers
USF1
ENCSR000BPV
r=0.15

small heat map img

A549
Myers
POLR2A
ENCSR000DMZ
r=0.15

small heat map img

A549
Myers
CTCF
ENCSR000BHV
r=0.13

small heat map img

A549
Myers
CTCF
ENCSR000DPF
r=0.12

small heat map img

A549
Myers
CTCF
ENCSR000BHW
r=0.11

small heat map img

A549
Myers
POLR2A
ENCSR000BHH
r=0.10

small heat map img

A549
Myers
POLR2A
ENCSR000BHI
r=0.10

small heat map img
10,000 randomly-selected peaks from a total of 23,001 (download )

HepG2 - Myers - ENCSR000BNI

HepG2
Myers
FOXA2
ENCSR000BNI
r=1.00

small heat map img

HepG2
Myers
FOXA1
ENCSR000BLE
r=0.37

small heat map img

HepG2
Myers
FOXA1
ENCSR000BMO
r=0.35

small heat map img

HepG2
Myers
ARID3A
ENCSR000EDP
r=0.32

small heat map img

HepG2
Myers
EP300
ENCSR000BLW
r=0.28

small heat map img

HepG2
Myers
TCF7L2
ENCSR000EVQ
r=0.27

small heat map img

HepG2
Myers
EP300
ENCSR000EDV
r=0.26

small heat map img

HepG2
Myers
SP1
ENCSR000BJX
r=0.25

small heat map img

HepG2
Myers
NR2F2
ENCSR000BVM
r=0.24

small heat map img

HepG2
Myers
SMC3
ENCSR000EDW
r=0.24

small heat map img

HepG2
Myers
TEAD4
ENCSR000BRP
r=0.24

small heat map img

HepG2
Myers
RCOR1
ENCSR000EDQ
r=0.23

small heat map img

HepG2
Myers
JUN
ENCSR000EEK
r=0.23

small heat map img

HepG2
Myers
JUND
ENCSR000EEI
r=0.22

small heat map img

HepG2
Myers
MAFF
ENCSR000EEC
r=0.22

small heat map img

HepG2
Myers
MAFK
ENCSR000EDZ
r=0.21

small heat map img

HepG2
Myers
HDAC2
ENCSR000BMC
r=0.20

small heat map img

HepG2
Myers
NFIC
ENCSR000BQX
r=0.20

small heat map img

HepG2
Myers
MXI1
ENCSR000EDU
r=0.20

small heat map img

HepG2
Myers
MAFK
ENCSR000EEB
r=0.20

small heat map img

HepG2
Myers
BHLHE40
ENCSR000EDT
r=0.20

small heat map img

HepG2
Myers
HNF4A
ENCSR000BLF
r=0.19

small heat map img

HepG2
Myers
MBD4
ENCSR000BQW
r=0.19

small heat map img

HepG2
Myers
CEBPB
ENCSR000EEE
r=0.19

small heat map img

HepG2
Myers
HNF4A
ENCSR000EEU
r=0.19

small heat map img

HepG2
Myers
ZEB1
ENCSR000BVN
r=0.18

small heat map img

HepG2
Myers
HNF4G
ENCSR000BNJ
r=0.18

small heat map img

HepG2
Myers
RAD21
ENCSR000EEG
r=0.18

small heat map img

HepG2
Myers
MYBL2
ENCSR000BRO
r=0.18

small heat map img

HepG2
Myers
CREB1
ENCSR000BVL
r=0.17

small heat map img

HepG2
Myers
MAX
ENCSR000EDS
r=0.17

small heat map img

HepG2
Myers
FOSL2
ENCSR000BHP
r=0.17

small heat map img

HepG2
Myers
BRCA1
ENCSR000EDY
r=0.16

small heat map img

HepG2
Myers
RFX5
ENCSR000EEA
r=0.16

small heat map img

HepG2
Myers
MAX
ENCSR000BTM
r=0.16

small heat map img

HepG2
Myers
TCF12
ENCSR000BJG
r=0.15

small heat map img

HepG2
Myers
CEBPB
ENCSR000EEX
r=0.15

small heat map img

HepG2
Myers
TBP
ENCSR000EEL
r=0.15

small heat map img

HepG2
Myers
MYC
ENCSR000DLR
r=0.15

small heat map img

HepG2
Myers
JUND
ENCSR000BGK
r=0.14

small heat map img

HepG2
Myers
IRF3
ENCSR000EEJ
r=0.14

small heat map img

HepG2
Myers
RXRA
ENCSR000BHU
r=0.14

small heat map img

HepG2
Myers
HSF1
ENCSR000EET
r=0.13

small heat map img

HepG2
Myers
NRF1
ENCSR000EEH
r=0.12

small heat map img

HepG2
Myers
SREBF1
ENCSR000EZP
r=0.12

small heat map img

HepG2
Myers
CEBPB
ENCSR000BQI
r=0.12

small heat map img

HepG2
Myers
REST
ENCSR000BOT
r=0.11

small heat map img

HepG2
Myers
USF2
ENCSR000EEF
r=0.11

small heat map img

HepG2
Myers
EZH2
ENCSR000ARI
r=0.11

small heat map img

HepG2
Myers
SREBF2
ENCSR000EZO
r=0.10

small heat map img

HepG2
Myers
SIN3A
ENCSR000BGL
r=0.09

small heat map img

HepG2
Myers
ZNF274
ENCSR000EVR
r=0.09

small heat map img

HepG2
Myers
POLR2A
ENCSR000EEM
r=0.09

small heat map img

HepG2
Myers
RAD21
ENCSR000BLS
r=0.09

small heat map img

HepG2
Myers
ELF1
ENCSR000BMZ
r=0.08

small heat map img

HepG2
Myers
NR3C1
ENCSR000EEV
r=0.08

small heat map img

HepG2
Myers
ESRRA
ENCSR000EEW
r=0.08

small heat map img

HepG2
Myers
SRF
ENCSR000BLV
r=0.08

small heat map img

HepG2
Myers
BHLHE40
ENCSR000BID
r=0.08

small heat map img

HepG2
Myers
POLR2A
ENCSR000EZQ
r=0.08

small heat map img

HepG2
Myers
NR2C2
ENCSR000EVS
r=0.07

small heat map img

HepG2
Myers
USF1
ENCSR000BGM
r=0.07

small heat map img

HepG2
Myers
ZBTB7A
ENCSR000BQA
r=0.07

small heat map img

HepG2
Myers
CEBPD
ENCSR000BQJ
r=0.06

small heat map img

HepG2
Myers
YY1
ENCSR000BNT
r=0.06

small heat map img

HepG2
Myers
POLR2A
ENCSR000EEP
r=0.05

small heat map img

HepG2
Myers
CTCF
ENCSR000AMA
r=0.05

small heat map img

HepG2
Myers
ZBTB33
ENCSR000BNA
r=0.04

small heat map img

HepG2
Myers
SREBF1
ENCSR000EEO
r=0.04

small heat map img

HepG2
Myers
SP2
ENCSR000BOU
r=0.04

small heat map img

HepG2
Myers
POLR2A
ENCSR000DLQ
r=0.04

small heat map img

HepG2
Myers
CTCF
ENCSR000DLS
r=0.03

small heat map img

HepG2
Myers
ZBTB33
ENCSR000BHR
r=0.03

small heat map img

HepG2
Myers
ATF3
ENCSR000BKE
r=0.03

small heat map img

HepG2
Myers
POLR2A
ENCSR000BJM
r=0.03

small heat map img

HepG2
Myers
CTCF
ENCSR000BIE
r=0.03

small heat map img

HepG2
Myers
CTCF
ENCSR000DUG
r=0.02

small heat map img

HepG2
Myers
REST
ENCSR000BJL
r=0.01

small heat map img

HepG2
Myers
TAF1
ENCSR000BJN
r=0.00

small heat map img

HepG2
Myers
GABPA
ENCSR000BJK
r=0.00

small heat map img
10,000 randomly-selected peaks from a total of 40,989 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help