EZH2

This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. RefSeq, Feb 2011
Enhancer of zeste homolog 2 (EZH2) is a histone-lysine N-methyltransferase enzyme (EC 2.1.1.43) encoded by EZH2 gene, that participates in DNA methylation and, ultimately, transcriptional repression. EZH2 catalyzes the addition of methyl groups to histone H3 at lysine 27, by using the cofactor S-adenosyl-L-methionine.wikipedia

EZH2

PDB image
PDB 2C6V

PDB 2C6V 4MI0 4MI5
ENCODE experiments
Ensemble search
Entrez 2146
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia EZH2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

astrocyte - Bernstein - ENCSR000ARR

loading

B cell - Bernstein - ENCSR000AUZ

loading

DND-41 - Bernstein - ENCSR000ASW

loading

endothelial cell of umbilical vein - Bernstein - ENCSR000ATA

loading

fibroblast of dermis - Bernstein - ENCSR000ASE

loading

fibroblast of lung - Bernstein - ENCSR000ARO

loading

GM12878 - Bernstein - ENCSR000ARD

loading

H1-hESC - Bernstein - ENCSR000ASY

loading

HeLa-S3 - Bernstein - ENCSR000ATC

loading

HepG2 - Bernstein - ENCSR000ARI

loading

K562 - Bernstein - ENCSR000AQE

loading

keratinocyte - Bernstein - ENCSR000ARK

loading

mammary epithelial cell - Bernstein - ENCSR000ARE

loading

myotube - Bernstein - ENCSR000ASZ

loading

skeletal muscle myoblast - Bernstein - ENCSR000ARH

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

B cell - Bernstein - ENCSR000AUZ

1.
81 / 500
3.1e-453
ATGGAATGGAATGGAATGGAATGGA
small heat map img p-value: 0.00
pct_center: 0.08
pct_ratio: 0.52
2.
41 / 500
2.0e-291
AGAAGTTTCTGAGAATGCTTCTGTCTAG
small heat map img p-value: 0.02
pct_center: 0.11
pct_ratio: 0.50
3.
112 / 500
1.2e-404
CATCGAATGGAATTGAATGGAATCATC
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.50
4.
34 / 500
5.4e-265
ATAGAGCAGTTTTGAAACACTCTTTTTGTA
small heat map img p-value: 0.01
pct_center: 0.13
pct_ratio: 0.50
5.
43 / 500
4.2e-226
TGAGGCCTACGGTGGAAAAGGAAATATCTT
small heat map img p-value: 0.21
pct_center: 0.12
pct_ratio: 0.50
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

DND-41 - Bernstein - ENCSR000ASW

1.
81 / 500
4.1e-60
TGTTTTTTTGTATTTGTTTTT
small heat map img p-value: 0.04
pct_center: 0.10
pct_ratio: 0.35
2.
109 / 500
1.3e-25
GGGAGCGGGGGGGAGGGGGGGGGGGAGGG
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 0.56
3.
29 / 500
0.0023
GCGGCAGCGGCAGCAGCAGCA
small heat map img p-value: 0.09
pct_center: 0.65
pct_ratio: 0.58
4.
38 / 500
0.34
AAGTTTGAAAA
small heat map img p-value: 0.00
pct_center: 0.06
pct_ratio: 0.43
5.
25 / 500
32
AAAAAGCAAAA
small heat map img p-value: 0.03
pct_center: 0.09
pct_ratio: 0.39
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Bernstein - ENCSR000ARD

1.
137 / 500
2.3e-71
GGGGAAGGGAGGGAGAGAGAG
small heat map img p-value: 0.00
pct_center: 0.49
pct_ratio: 0.50
2.
69 / 500
4.6e-38
TGTGTGTGTTTGTGTTGTTTGTGGTTGGTT
small heat map img p-value: 0.18
pct_center: 0.21
pct_ratio: 0.51
3.
28 / 500
0.0036
GTGTGTGTGTG
small heat map img p-value: 0.03
pct_center: 0.17
pct_ratio: 0.58
4.
64 / 500
0.00047
GCTGTGGTTT
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.89
5.
46 / 500
0.00035
TGCTGGGAGAGGGGG
small heat map img p-value: 0.97
pct_center: 0.36
pct_ratio: 0.41
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Bernstein - ENCSR000ASY

1.
98 / 500
2.0e-61
GAAAAGAAGGAGAGAGAGAAAGAGAAAAA
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 0.49
2.
5 / 500
0.0000053
GGTTCTGGAACCAGATGTTGACCTGTCTCT
small heat map img p-value: 0.03
pct_center: 0.08
pct_ratio: 0.51
3.
59 / 500
0.00011
GGCGGGGGCGGCGGCGGTGGCGGCGGCGG
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 0.55
4.
20 / 500
12
AGAAAGAAAAG
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.38
5.
7 / 500
1.6e+3
TTTTTAAAGCCATATGATTGAGTAAAT
small heat map img p-value: 0.01
pct_center: 0.02
pct_ratio: 0.27
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Bernstein - ENCSR000ATC

1.
201 / 500
6.8e-25
AGGCAGGAAAG
small heat map img p-value: 0.96
pct_center: 0.41
pct_ratio: 0.55
2.
7 / 500
9.2e-13
TCCCAAGTTGCTGGGATTACAGGCAT
small heat map img p-value: 1.00
pct_center: 0.12
pct_ratio: 0.55
3.
6 / 500
6.8e-15
GTGCAGTGGCGTGATCTCGGCTCACTGCA
small heat map img p-value: 1.00
pct_center: 0.08
pct_ratio: 0.46
4.
63 / 500
0.000075
CAGCCTGG
small heat map img p-value: 1.00
pct_center: 0.24
pct_ratio: 0.56
5.
30 / 500
0.038
TTTTTTTGTTTTTTTGTTTTT
small heat map img p-value: 1.00
pct_center: 0.13
pct_ratio: 0.27
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Bernstein - ENCSR000ARI

1.
131 / 500
1.1e-97
AGAGAGAGAGAGAGGAAGGAA
small heat map img p-value: 0.00
pct_center: 0.49
pct_ratio: 0.51
2.
39 / 500
4.6e-20
TGTGTGTGTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.60
3.
33 / 500
0.000054
GGGAGCAAAAAGCCACGGGGGCGAGGGAG
small heat map img p-value: 0.00
pct_center: 0.37
pct_ratio: 0.48
4.
26 / 500
0.0000051
TTTTTTTTGTTTTTA
small heat map img p-value: 1.00
pct_center: 0.09
pct_ratio: 0.40
5.
42 / 500
0.0026
AGAGGAAGAGA
small heat map img p-value: 0.01
pct_center: 0.28
pct_ratio: 0.53
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Bernstein - ENCSR000AQE

1.
195 / 500
2.9e-35
GGGAAGGCGGAGGGAGGGGGAGGAGGAAA
small heat map img p-value: 0.00
pct_center: 0.52
pct_ratio: 0.48
2.
6 / 500
0.10
ATGCTTAGGGAACGTCTTCAGTGTGCACA
small heat map img p-value: 0.10
pct_center: 0.05
pct_ratio: 0.37
3.
13 / 500
6.8
ATGGTGTGTGTGTGCGTGTGTGTGTGTGAG
small heat map img p-value: 0.05
pct_center: 0.10
pct_ratio: 0.54
4.
12 / 500
1.3e+2
TGTTACCCAGGCTGG
small heat map img p-value: 1.00
pct_center: 0.18
pct_ratio: 0.38
5.
13 / 500
2.3e+3
TCTTTGTATTTACAGTAGAGA
small heat map img p-value: 1.00
pct_center: 0.08
pct_ratio: 0.34
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

astrocyte - Bernstein - ENCSR000ARR

1.
22 / 500
3.7e-23
AAAAAGCAGAGGCGGGGAGGGGGCAAAAA
small heat map img p-value: 0.44
pct_center: 0.14
pct_ratio: 0.39
2.
96 / 500
4.1e-15
GAGGGGGGAAAGGAGGAGGAG
small heat map img p-value: 0.00
pct_center: 0.77
pct_ratio: 0.52
3.
13 / 500
0.000073
GTGTGTGTGTGTGTGTGTGT
small heat map img p-value: 0.75
pct_center: 0.20
pct_ratio: 0.51
4.
12 / 500
11
TGTTCTGGAAGCTCAGCTGCA
small heat map img p-value: 0.17
pct_center: 0.16
pct_ratio: 0.53
5.
10 / 500
1.5e+3
ATGAGGAACTGGTCGATGAAG
small heat map img p-value: 0.29
pct_center: 0.06
pct_ratio: 0.51
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

endothelial cell of umbilical vein - Bernstein - ENCSR000ATA

1.
91 / 500
4.6e-13
TGGAGAAAGAGAAGAGGAGGG
small heat map img p-value: 0.00
pct_center: 0.67
pct_ratio: 0.49
2.
36 / 500
0.00013
CAGCAGCCGCAGGAAGCAGACGTTGCGGAA
small heat map img p-value: 0.31
pct_center: 0.39
pct_ratio: 0.55
3.
12 / 500
12
TGTGTGTGTGTGAGTGTGTGCCTGTGTGT
small heat map img p-value: 1.00
pct_center: 0.37
pct_ratio: 0.48
4.
7 / 500
32
AAATCACGTTAATTGGTTATTTGGCATTTT
small heat map img p-value: 0.48
pct_center: 0.01
pct_ratio: 0.37
5.
16 / 500
2.5e+2
CAAGGGCAGCTTCTGCAT
small heat map img p-value: 0.27
pct_center: 0.11
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of dermis - Bernstein - ENCSR000ASE

1.
173 / 500
3.9e-41
GAGGAGGAGCGGGGAGAGGGA
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 0.52
2.
29 / 500
2.9e-12
TTTTATCCGCAGTGGTTTTGT
small heat map img p-value: 0.00
pct_center: 0.04
pct_ratio: 0.40
3.
10 / 500
0.000011
TGTGTGTGTGTGTGTGTGTGTGTGCGTGTG
small heat map img p-value: 0.12
pct_center: 0.26
pct_ratio: 0.53
4.
12 / 500
0.000066
AAAAAGCCGCGGCGG
small heat map img p-value: 0.08
pct_center: 0.27
pct_ratio: 0.54
5.
13 / 500
0.092
CATTTTCCAAGAGG
small heat map img p-value: 0.40
pct_center: 0.02
pct_ratio: 0.35
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of lung - Bernstein - ENCSR000ARO

1.
64 / 500
1.8e-92
CTGTGTGTGTGTCTCTGTGTGTGTGTGTCT
small heat map img p-value: 0.01
pct_center: 0.35
pct_ratio: 0.54
2.
158 / 500
4.0e-55
GAGGGGGAGGAAGAGGAGGAG
small heat map img p-value: 0.00
pct_center: 0.67
pct_ratio: 0.48
3.
33 / 500
4.0e-12
GTGTGTGCATGTGTG
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.59
4.
13 / 500
0.000026
AGAACATGTGCAAGCTGAAGCCGTTGCTGA
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.55
5.
62 / 500
0.031
ACTTGCAGAGGTTGCTGCTGCTGCAGCAG
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

keratinocyte - Bernstein - ENCSR000ARK

1.
50 / 500
1.1e-56
GTGTGTGTGTGTGTGTGTGTG
small heat map img p-value: 0.02
pct_center: 0.20
pct_ratio: 0.56
2.
89 / 500
1.8e-62
GGGGGGGAAGAGGAGGGGGGGGAAAAAAGA
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 0.48
3.
24 / 500
0.00028
TTTGTGTTTTTTTTT
small heat map img p-value: 0.78
pct_center: 0.08
pct_ratio: 0.35
4.
80 / 500
0.00046
GGAGAGAGGCAGGAG
small heat map img p-value: 0.97
pct_center: 0.61
pct_ratio: 0.49
5.
10 / 500
5.0e+2
GGGGGCAAAAAGCCGTGACAG
small heat map img p-value: 0.57
pct_center: 0.29
pct_ratio: 0.46
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

mammary epithelial cell - Bernstein - ENCSR000ARE

1.
86 / 500
5.2e-54
GTCTGTGTGTGCGTGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.63
2.
96 / 500
1.5e-58
GGGGAGGGGAGGGGGGAGAGG
small heat map img p-value: 0.00
pct_center: 0.63
pct_ratio: 0.48
3.
6 / 500
0.79
AAGCTCAAGCCGCTGCTGAACAAGTGGTT
small heat map img p-value: 0.68
pct_center: 0.05
pct_ratio: 0.51
4.
14 / 500
0.0035
GTGCGTGTGCATGTGAGCGCGTGTGTGTG
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.63
5.
18 / 500
67
GGTGAAAAGAGCCGCAGGGAGGTGAAAAGC
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.49
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

myotube - Bernstein - ENCSR000ASZ

1.
80 / 500
1.3e-87
AAAAAGCAGAGGGAGAGGGGGAAAGAA
small heat map img p-value: 0.02
pct_center: 0.48
pct_ratio: 0.46
2.
32 / 500
1.4e-32
CATTGTTGTATTTTGAATTTTTTTAATTC
small heat map img p-value: 0.00
pct_center: 0.03
pct_ratio: 0.36
3.
20 / 500
1.7e-21
GGCAAAAAGCCGCGG
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.63
4.
17 / 500
1.1e-9
GGGGGCAAAAAGCCG
small heat map img p-value: 0.00
pct_center: 0.38
pct_ratio: 0.57
5.
13 / 500
6.6e-8
TGCGTGTGTGTGTGTGTGCGTGTGTGTGTG
small heat map img p-value: 0.67
pct_center: 0.21
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

skeletal muscle myoblast - Bernstein - ENCSR000ARH

1.
101 / 500
1.3e-89
AGGGGAGAGGAGGGGGAGGGAGGGAAAGA
small heat map img p-value: 0.00
pct_center: 0.59
pct_ratio: 0.50
2.
40 / 500
2.0e-22
ATTTAAGTTTTAAATAGCACAGATTGAAAA
small heat map img p-value: 0.31
pct_center: 0.05
pct_ratio: 0.36
3.
101 / 500
0.90
GGGGAGGGGAA
small heat map img p-value: 0.96
pct_center: 0.48
pct_ratio: 0.49
4.
5 / 500
4.3
GGGCAAAAAGCCGCGGCGGCGGGGG
small heat map img p-value: 0.01
pct_center: 0.27
pct_ratio: 0.42
5.
13 / 500
47
TTTAATTTTGTTTTTACGTTT
small heat map img p-value: 0.02
pct_center: 0.10
pct_ratio: 0.50
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at EZH2 peaks

B cell - Bernstein - ENCSR000AUZ

B cell
Bernstein
EZH2
ENCSR000AUZ
r=1.00

small heat map img

B cell
Bernstein
H3K4me2
ENCSR000AUY
r=0.32

small heat map img

B cell
Bernstein
H2AFZ
ENCSR000AUX
r=0.31

small heat map img

B cell
Bernstein
H3K4me3
ENCSR000DQR
r=0.22

small heat map img

B cell
Bernstein
H3K4me3
ENCSR000DQP
r=0.22

small heat map img

B cell
Bernstein
H4K20me1
ENCSR000AVJ
r=0.11

small heat map img

B cell
Bernstein
H3K27ac
ENCSR000AUP
r=0.05

small heat map img
10,000 randomly-selected peaks from a total of 12,970 (download )

DND-41 - Bernstein - ENCSR000ASW

DND-41
Bernstein
EZH2
ENCSR000ASW
r=1.00

small heat map img

DND-41
Bernstein
H3K27me3
ENCSR000ASX
r=0.53

small heat map img

DND-41
Bernstein
H3K4me2
ENCSR000AQZ
r=0.28

small heat map img

DND-41
Bernstein
H3K4me1
ENCSR000AQY
r=0.27

small heat map img

DND-41
Bernstein
H3K4me3
ENCSR000ARA
r=0.23

small heat map img

DND-41
Bernstein
H2AFZ
ENCSR000AQV
r=0.21

small heat map img

DND-41
Bernstein
H3K9ac
ENCSR000ARY
r=0.19

small heat map img

DND-41
Bernstein
H4K20me1
ENCSR000ARC
r=0.17

small heat map img

DND-41
Bernstein
H3K9me3
ENCSR000ARZ
r=0.12

small heat map img

DND-41
Bernstein
H3K27ac
ENCSR000AQW
r=0.09

small heat map img

DND-41
Bernstein
H3K36me3
ENCSR000AQX
r=0.02

small heat map img

DND-41
Bernstein
H3K79me2
ENCSR000ARB
r=-0.03

small heat map img
1,732 peaks (download )

GM12878 - Bernstein - ENCSR000ARD

GM12878
Bernstein
EZH2
ENCSR000ARD
r=1.00

small heat map img

GM12878
Bernstein
H3K27me3
ENCSR000AKD
r=0.34

small heat map img

GM12878
Bernstein
H3K27me3
ENCSR000DRX
r=0.27

small heat map img

GM12878
Bernstein
H3K4me2
ENCSR000AKG
r=0.19

small heat map img

GM12878
Bernstein
H2AFZ
ENCSR000AOV
r=0.15

small heat map img

GM12878
Bernstein
H4K20me1
ENCSR000AKI
r=0.15

small heat map img

GM12878
Bernstein
H3K4me3
ENCSR000AKA
r=0.15

small heat map img

GM12878
Bernstein
H3K4me1
ENCSR000AKF
r=0.08

small heat map img

GM12878
Bernstein
H3K9me3
ENCSR000AOX
r=0.06

small heat map img

GM12878
Bernstein
H3K4me3
ENCSR000DRY
r=0.06

small heat map img

GM12878
Bernstein
H3K9ac
ENCSR000AKH
r=0.06

small heat map img

GM12878
Bernstein
H3K27ac
ENCSR000AKC
r=0.02

small heat map img

GM12878
Bernstein
H3K36me3
ENCSR000DRW
r=-0.03

small heat map img

GM12878
Bernstein
H3K79me2
ENCSR000AOW
r=-0.10

small heat map img

GM12878
Bernstein
H3K36me3
ENCSR000AKE
r=-0.13

small heat map img
2,472 peaks (download )

H1-hESC - Bernstein - ENCSR000ASY

H1-hESC
Bernstein
EZH2
ENCSR000ASY
r=1.00

small heat map img

H1-hESC
Bernstein
H3K27me3
ENCSR000ALU
r=0.57

small heat map img

H1-hESC
Bernstein
H4K20me1
ENCSR000AMH
r=0.37

small heat map img

H1-hESC
Bernstein
H3K4me1
ENCSR000ANA
r=0.26

small heat map img

H1-hESC
Bernstein
H3K4me2
ENCSR000ANC
r=0.14

small heat map img

H1-hESC
Bernstein
H3K9me3
ENCSR000APZ
r=0.11

small heat map img

H1-hESC
Bernstein
H3K4me3
ENCSR000AMG
r=0.08

small heat map img

H1-hESC
Bernstein
H2AFZ
ENCSR000APX
r=0.05

small heat map img

H1-hESC
Bernstein
H3K9ac
ENCSR000AND
r=-0.01

small heat map img

H1-hESC
Bernstein
H3K36me3
ENCSR000ANB
r=-0.07

small heat map img

H1-hESC
Bernstein
H3K27ac
ENCSR000ANP
r=-0.07

small heat map img

H1-hESC
Bernstein
H3K79me2
ENCSR000APY
r=-0.08

small heat map img
6,370 peaks (download )

HeLa-S3 - Bernstein - ENCSR000ATC

HeLa-S3
Bernstein
EZH2
ENCSR000ATC
r=1.00

small heat map img

HeLa-S3
Bernstein
H3K27me3
ENCSR000APB
r=0.32

small heat map img

HeLa-S3
Bernstein
H3K27me3
ENCSR000DTY
r=0.14

small heat map img

HeLa-S3
Bernstein
H3K4me3
ENCSR000AOF
r=0.13

small heat map img

HeLa-S3
Bernstein
H3K9ac
ENCSR000AOH
r=0.13

small heat map img

HeLa-S3
Bernstein
H2AFZ
ENCSR000AQN
r=0.11

small heat map img

HeLa-S3
Bernstein
H3K9me3
ENCSR000AQO
r=0.10

small heat map img

HeLa-S3
Bernstein
H4K20me1
ENCSR000AOI
r=0.10

small heat map img

HeLa-S3
Bernstein
H3K27ac
ENCSR000AOC
r=0.09

small heat map img

HeLa-S3
Bernstein
H3K4me2
ENCSR000AOE
r=0.08

small heat map img

HeLa-S3
Bernstein
H3K4me3
ENCSR000DUA
r=0.06

small heat map img

HeLa-S3
Bernstein
H3K4me1
ENCSR000APW
r=0.06

small heat map img

HeLa-S3
Bernstein
H3K36me3
ENCSR000DTZ
r=0.06

small heat map img

HeLa-S3
Bernstein
H3K79me2
ENCSR000AOG
r=0.05

small heat map img

HeLa-S3
Bernstein
H3K36me3
ENCSR000AOD
r=0.03

small heat map img
1,818 peaks (download )

HepG2 - Bernstein - ENCSR000ARI

HepG2
Bernstein
EZH2
ENCSR000ARI
r=1.00

small heat map img

HepG2
Bernstein
H3K27me3
ENCSR000AOL
r=0.35

small heat map img

HepG2
Bernstein
H3K4me3
ENCSR000AMP
r=0.22

small heat map img

HepG2
Bernstein
H3K4me2
ENCSR000AMC
r=0.21

small heat map img

HepG2
Bernstein
H3K27me3
ENCSR000DUE
r=0.21

small heat map img

HepG2
Bernstein
H4K20me1
ENCSR000AMQ
r=0.18

small heat map img

HepG2
Bernstein
H3K4me3
ENCSR000DUF
r=0.15

small heat map img

HepG2
Bernstein
H3K4me1
ENCSR000APV
r=0.15

small heat map img

HepG2
Bernstein
H3K9ac
ENCSR000AMD
r=0.06

small heat map img

HepG2
Bernstein
H2AFZ
ENCSR000AOK
r=0.05

small heat map img

HepG2
Bernstein
H3K36me3
ENCSR000DUD
r=0.04

small heat map img

HepG2
Bernstein
H3K9me3
ENCSR000ATD
r=0.01

small heat map img

HepG2
Bernstein
H3K27ac
ENCSR000AMO
r=-0.02

small heat map img

HepG2
Bernstein
H3K79me2
ENCSR000AOM
r=-0.03

small heat map img

HepG2
Bernstein
H3K36me3
ENCSR000AMB
r=-0.03

small heat map img
3,286 peaks (download )

K562 - Bernstein - ENCSR000AQE

K562
Bernstein
EZH2
ENCSR000AQE
r=1.00

small heat map img

K562
Bernstein
H3K27me3
ENCSR000EWB
r=0.36

small heat map img

K562
Bernstein
H3K27me3
ENCSR000AKQ
r=0.36

small heat map img

K562
Bernstein
H4K20me1
ENCSR000AKX
r=0.32

small heat map img

K562
Bernstein
H3K9ac
ENCSR000EVZ
r=0.26

small heat map img

K562
Bernstein
H3K27me3
ENCSR000DWC
r=0.26

small heat map img

K562
Bernstein
H3K9me1
ENCSR000AKW
r=0.26

small heat map img

K562
Bernstein
H3K9me3
ENCSR000APE
r=0.23

small heat map img

K562
Bernstein
H3K4me3
ENCSR000AKU
r=0.21

small heat map img

K562
Bernstein
H3K4me1
ENCSR000EWC
r=0.21

small heat map img

K562
Bernstein
H2AFZ
ENCSR000APC
r=0.20

small heat map img

K562
Bernstein
H3K4me2
ENCSR000AKT
r=0.19

small heat map img

K562
Bernstein
H3K4me3
ENCSR000DWD
r=0.18

small heat map img

K562
Bernstein
H3K36me3
ENCSR000DWB
r=0.17

small heat map img

K562
Bernstein
H3K9ac
ENCSR000AKV
r=0.16

small heat map img

K562
Bernstein
H3K4me3
ENCSR000EWA
r=0.15

small heat map img

K562
Bernstein
H3K27ac
ENCSR000AKP
r=0.12

small heat map img

K562
Bernstein
H3K4me1
ENCSR000AKS
r=0.11

small heat map img

K562
Bernstein
H3K36me3
ENCSR000AKR
r=0.09

small heat map img

K562
Bernstein
H3K79me2
ENCSR000APD
r=0.04

small heat map img
1,685 peaks (download )

astrocyte - Bernstein - ENCSR000ARR

astrocyte
Bernstein
EZH2
ENCSR000ARR
r=1.00

small heat map img

astrocyte
Bernstein
H3K27me3
ENCSR000AOR
r=0.37

small heat map img

astrocyte
Bernstein
H4K20me1
ENCSR000ARU
r=0.19

small heat map img

astrocyte
Bernstein
H3K4me1
ENCSR000AOT
r=0.16

small heat map img

astrocyte
Bernstein
H3K9me3
ENCSR000AQR
r=0.15

small heat map img

astrocyte
Bernstein
H2AFZ
ENCSR000AQP
r=0.15

small heat map img

astrocyte
Bernstein
H3K4me2
ENCSR000ARS
r=0.12

small heat map img

astrocyte
Bernstein
H3K4me3
ENCSR000AOU
r=0.09

small heat map img

astrocyte
Bernstein
H3K9ac
ENCSR000ART
r=-0.00

small heat map img

astrocyte
Bernstein
H3K27ac
ENCSR000AOQ
r=-0.04

small heat map img

astrocyte
Bernstein
H3K79me2
ENCSR000AQQ
r=-0.06

small heat map img

astrocyte
Bernstein
H3K36me3
ENCSR000AOS
r=-0.09

small heat map img
6,493 peaks (download )

endothelial cell of umbilical vein - Bernstein - ENCSR000ATA

endothelial cell of umbilical vein
Bernstein
EZH2
ENCSR000ATA
r=1.00

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K27me3
ENCSR000AKK
r=0.49

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K27me3
ENCSR000DVO
r=0.43

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K4me1
ENCSR000AKL
r=0.22

small heat map img

endothelial cell of umbilical vein
Bernstein
H4K20me1
ENCSR000ALF
r=0.15

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K9me3
ENCSR000ATB
r=0.13

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K4me2
ENCSR000AKM
r=0.13

small heat map img

endothelial cell of umbilical vein
Bernstein
H2AFZ
ENCSR000ASC
r=0.12

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K4me3
ENCSR000AKN
r=0.10

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K9me1
ENCSR000ALE
r=0.10

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K4me3
ENCSR000DVN
r=0.06

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K36me3
ENCSR000DVM
r=0.02

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K9ac
ENCSR000ALD
r=0.02

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K27ac
ENCSR000ALB
r=-0.04

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K36me3
ENCSR000ALC
r=-0.06

small heat map img

endothelial cell of umbilical vein
Bernstein
H3K79me2
ENCSR000ASD
r=-0.07

small heat map img
6,234 peaks (download )

fibroblast of dermis - Bernstein - ENCSR000ASE

fibroblast of dermis
Bernstein
EZH2
ENCSR000ASE
r=1.00

small heat map img

fibroblast of dermis
Bernstein
H3K27me3
ENCSR000APO
r=0.38

small heat map img

fibroblast of dermis
Bernstein
H3K4me2
ENCSR000APQ
r=0.18

small heat map img

fibroblast of dermis
Bernstein
H4K20me1
ENCSR000ARJ
r=0.17

small heat map img

fibroblast of dermis
Bernstein
H3K4me1
ENCSR000ARV
r=0.17

small heat map img

fibroblast of dermis
Bernstein
H3K9me3
ENCSR000ARX
r=0.12

small heat map img

fibroblast of dermis
Bernstein
H2AFZ
ENCSR000ATG
r=0.11

small heat map img

fibroblast of dermis
Bernstein
H3K4me3
ENCSR000APR
r=0.10

small heat map img

fibroblast of dermis
Bernstein
H3K9ac
ENCSR000APS
r=-0.01

small heat map img

fibroblast of dermis
Bernstein
H3K27ac
ENCSR000APN
r=-0.04

small heat map img

fibroblast of dermis
Bernstein
H3K79me2
ENCSR000ARW
r=-0.04

small heat map img

fibroblast of dermis
Bernstein
H3K36me3
ENCSR000APP
r=-0.06

small heat map img
5,739 peaks (download )

fibroblast of lung - Bernstein - ENCSR000ARO

fibroblast of lung
Bernstein
EZH2
ENCSR000ARO
r=1.00

small heat map img

fibroblast of lung
Bernstein
H3K27me3
ENCSR000AMS
r=0.43

small heat map img

fibroblast of lung
Bernstein
H3K27me3
ENCSR000DPK
r=0.37

small heat map img

fibroblast of lung
Bernstein
H3K9me3
ENCSR000DPJ
r=0.20

small heat map img

fibroblast of lung
Bernstein
H3K4me1
ENCSR000AMU
r=0.14

small heat map img

fibroblast of lung
Bernstein
H3K4me2
ENCSR000AMV
r=0.14

small heat map img

fibroblast of lung
Bernstein
H3K4me3
ENCSR000AMW
r=0.10

small heat map img

fibroblast of lung
Bernstein
H4K20me1
ENCSR000AMY
r=0.08

small heat map img

fibroblast of lung
Bernstein
H2AFZ
ENCSR000ARP
r=0.08

small heat map img

fibroblast of lung
Bernstein
H3K9me3
ENCSR000ARQ
r=0.07

small heat map img

fibroblast of lung
Bernstein
H3K4me3
ENCSR000DWZ
r=0.06

small heat map img

fibroblast of lung
Bernstein
H3K9ac
ENCSR000AMX
r=0.05

small heat map img

fibroblast of lung
Bernstein
H3K4me3
ENCSR000DPO
r=0.04

small heat map img

fibroblast of lung
Bernstein
H3K4me3
ENCSR000DVC
r=0.03

small heat map img

fibroblast of lung
Bernstein
H3K36me3
ENCSR000AMT
r=0.01

small heat map img

fibroblast of lung
Bernstein
H3K27ac
ENCSR000DPL
r=0.01

small heat map img

fibroblast of lung
Bernstein
H3K27ac
ENCSR000AMR
r=-0.04

small heat map img

fibroblast of lung
Bernstein
H3K79me2
ENCSR000ASF
r=-0.04

small heat map img
7,030 peaks (download )

keratinocyte - Bernstein - ENCSR000ARK

keratinocyte
Bernstein
EZH2
ENCSR000ARK
r=1.00

small heat map img

keratinocyte
Bernstein
H3K27me3
ENCSR000ALL
r=0.45

small heat map img

keratinocyte
Bernstein
H3K27me3
ENCSR000DWU
r=0.22

small heat map img

keratinocyte
Bernstein
H3K4me3
ENCSR000ALO
r=0.21

small heat map img

keratinocyte
Bernstein
H3K4me1
ENCSR000ALI
r=0.19

small heat map img

keratinocyte
Bernstein
H3K4me2
ENCSR000ALN
r=0.19

small heat map img

keratinocyte
Bernstein
H4K20me1
ENCSR000ALR
r=0.15

small heat map img

keratinocyte
Bernstein
H2AFZ
ENCSR000ARL
r=0.12

small heat map img

keratinocyte
Bernstein
H3K9me3
ENCSR000ARN
r=0.09

small heat map img

keratinocyte
Bernstein
H3K4me3
ENCSR000DWV
r=0.07

small heat map img

keratinocyte
Bernstein
H3K9ac
ENCSR000ALP
r=0.04

small heat map img

keratinocyte
Bernstein
H3K9me1
ENCSR000ALQ
r=0.04

small heat map img

keratinocyte
Bernstein
H3K27ac
ENCSR000ALK
r=-0.04

small heat map img

keratinocyte
Bernstein
H3K36me3
ENCSR000ALM
r=-0.04

small heat map img

keratinocyte
Bernstein
H3K79me2
ENCSR000ARM
r=-0.05

small heat map img

keratinocyte
Bernstein
H3K36me3
ENCSR000DWW
r=-0.05

small heat map img
7,978 peaks (download )

mammary epithelial cell - Bernstein - ENCSR000ARE

mammary epithelial cell
Bernstein
EZH2
ENCSR000ARE
r=1.00

small heat map img

mammary epithelial cell
Bernstein
H3K27me3
ENCSR000ALX
r=0.42

small heat map img

mammary epithelial cell
Bernstein
H3K4me1
ENCSR000AMJ
r=0.22

small heat map img

mammary epithelial cell
Bernstein
H3K27me3
ENCSR000DUT
r=0.21

small heat map img

mammary epithelial cell
Bernstein
H3K4me2
ENCSR000AMK
r=0.17

small heat map img

mammary epithelial cell
Bernstein
H2AFZ
ENCSR000ARF
r=0.15

small heat map img

mammary epithelial cell
Bernstein
H4K20me1
ENCSR000AMM
r=0.15

small heat map img

mammary epithelial cell
Bernstein
H3K4me3
ENCSR000AML
r=0.13

small heat map img

mammary epithelial cell
Bernstein
H3K9me3
ENCSR000ARG
r=0.12

small heat map img

mammary epithelial cell
Bernstein
H3K4me3
ENCSR000DUQ
r=0.09

small heat map img

mammary epithelial cell
Bernstein
H3K9ac
ENCSR000ALZ
r=-0.03

small heat map img

mammary epithelial cell
Bernstein
H3K27ac
ENCSR000ALW
r=-0.04

small heat map img

mammary epithelial cell
Bernstein
H3K79me2
ENCSR000ASB
r=-0.05

small heat map img

mammary epithelial cell
Bernstein
H3K36me3
ENCSR000ALY
r=-0.06

small heat map img
4,626 peaks (download )

myotube - Bernstein - ENCSR000ASZ

myotube
Bernstein
EZH2
ENCSR000ASZ
r=1.00

small heat map img

myotube
Bernstein
H3K27me3
ENCSR000ATI
r=0.28

small heat map img

myotube
Bernstein
H2AFZ
ENCSR000ANU
r=0.18

small heat map img

myotube
Bernstein
H3K4me2
ENCSR000ANY
r=0.17

small heat map img

myotube
Bernstein
H3K4me3
ENCSR000ANZ
r=0.15

small heat map img

myotube
Bernstein
H3K4me1
ENCSR000ANX
r=0.09

small heat map img

myotube
Bernstein
H3K9me3
ENCSR000AQM
r=0.04

small heat map img

myotube
Bernstein
H3K9ac
ENCSR000AOY
r=0.01

small heat map img

myotube
Bernstein
H3K27ac
ENCSR000ANV
r=-0.03

small heat map img

myotube
Bernstein
H3K36me3
ENCSR000ANW
r=-0.04

small heat map img

myotube
Bernstein
H4K20me1
ENCSR000AOZ
r=-0.04

small heat map img

myotube
Bernstein
H3K79me2
ENCSR000AON
r=-0.05

small heat map img
2,700 peaks (download )

skeletal muscle myoblast - Bernstein - ENCSR000ARH

skeletal muscle myoblast
Bernstein
EZH2
ENCSR000ARH
r=1.00

small heat map img

skeletal muscle myoblast
Bernstein
H3K27me3
ENCSR000ANG
r=0.33

small heat map img

skeletal muscle myoblast
Bernstein
H2AFZ
ENCSR000APA
r=0.19

small heat map img

skeletal muscle myoblast
Bernstein
H3K4me2
ENCSR000ANJ
r=0.17

small heat map img

skeletal muscle myoblast
Bernstein
H3K4me3
ENCSR000ANK
r=0.15

small heat map img

skeletal muscle myoblast
Bernstein
H3K4me1
ENCSR000ANI
r=0.14

small heat map img

skeletal muscle myoblast
Bernstein
H3K9me3
ENCSR000ANR
r=0.12

small heat map img

skeletal muscle myoblast
Bernstein
H4K20me1
ENCSR000ANM
r=0.08

small heat map img

skeletal muscle myoblast
Bernstein
H3K27ac
ENCSR000ANF
r=0.02

small heat map img

skeletal muscle myoblast
Bernstein
H3K9ac
ENCSR000ANL
r=0.01

small heat map img

skeletal muscle myoblast
Bernstein
H3K36me3
ENCSR000ANH
r=-0.08

small heat map img

skeletal muscle myoblast
Bernstein
H3K79me2
ENCSR000ANQ
r=-0.08

small heat map img
1,540 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at EZH2 peaks

B cell - Bernstein - ENCSR000AUZ

B cell
Bernstein
EZH2
ENCSR000AUZ
r=1.00

small heat map img

B cell
Bernstein
CTCF
ENCSR000AUV
r=0.25

small heat map img
10,000 randomly-selected peaks from a total of 12,970 (download )

DND-41 - Bernstein - ENCSR000ASW

DND-41
Bernstein
EZH2
ENCSR000ASW
r=1.00

small heat map img

DND-41
Bernstein
CTCF
ENCSR000AQU
r=0.03

small heat map img
1,732 peaks (download )

GM12878 - Bernstein - ENCSR000ARD

GM12878
Bernstein
EZH2
ENCSR000ARD
r=1.00

small heat map img

GM12878
Bernstein
RUNX3
ENCSR000BRI
r=0.18

small heat map img

GM12878
Bernstein
BCL11A
ENCSR000BHA
r=0.17

small heat map img

GM12878
Bernstein
SP1
ENCSR000BHK
r=0.17

small heat map img

GM12878
Bernstein
JUND
ENCSR000DYS
r=0.17

small heat map img

GM12878
Bernstein
BRCA1
ENCSR000DZS
r=0.17

small heat map img

GM12878
Bernstein
BATF
ENCSR000BGT
r=0.17

small heat map img

GM12878
Bernstein
MAFK
ENCSR000DYV
r=0.16

small heat map img

GM12878
Bernstein
PAX5
ENCSR000BHJ
r=0.16

small heat map img

GM12878
Bernstein
IRF4
ENCSR000BGY
r=0.16

small heat map img

GM12878
Bernstein
EP300
ENCSR000DZD
r=0.15

small heat map img

GM12878
Bernstein
EP300
ENCSR000DZG
r=0.15

small heat map img

GM12878
Bernstein
STAT1
ENCSR000DZM
r=0.15

small heat map img

GM12878
Bernstein
RFX5
ENCSR000DZW
r=0.15

small heat map img

GM12878
Bernstein
ELK1
ENCSR000DZB
r=0.15

small heat map img

GM12878
Bernstein
IRF3
ENCSR000DZX
r=0.15

small heat map img

GM12878
Bernstein
NFE2
ENCSR000DZY
r=0.15

small heat map img

GM12878
Bernstein
EP300
ENCSR000BHB
r=0.14

small heat map img

GM12878
Bernstein
BHLHE40
ENCSR000DZJ
r=0.14

small heat map img

GM12878
Bernstein
NFATC1
ENCSR000BQL
r=0.14

small heat map img

GM12878
Bernstein
TBL1XR1
ENCSR000DYZ
r=0.14

small heat map img

GM12878
Bernstein
E2F4
ENCSR000DYY
r=0.14

small heat map img

GM12878
Bernstein
ATF2
ENCSR000BQK
r=0.14

small heat map img

GM12878
Bernstein
RELA
ENCSR000EAG
r=0.14

small heat map img

GM12878
Bernstein
RAD21
ENCSR000EAC
r=0.14

small heat map img

GM12878
Bernstein
SMC3
ENCSR000DZP
r=0.13

small heat map img

GM12878
Bernstein
FOXM1
ENCSR000BRU
r=0.13

small heat map img

GM12878
Bernstein
CREB1
ENCSR000BUF
r=0.13

small heat map img

GM12878
Bernstein
MEF2A
ENCSR000BKB
r=0.13

small heat map img

GM12878
Bernstein
JUND
ENCSR000EYV
r=0.13

small heat map img

GM12878
Bernstein
CUX1
ENCSR000DYR
r=0.13

small heat map img

GM12878
Bernstein
STAT3
ENCSR000DZV
r=0.13

small heat map img

GM12878
Bernstein
MYC
ENCSR000DKU
r=0.13

small heat map img

GM12878
Bernstein
PAX5
ENCSR000BHD
r=0.12

small heat map img

GM12878
Bernstein
ESRRA
ENCSR000DYQ
r=0.12

small heat map img

GM12878
Bernstein
WRNIP1
ENCSR000EAA
r=0.12

small heat map img

GM12878
Bernstein
SREBF2
ENCSR000DYT
r=0.12

small heat map img

GM12878
Bernstein
FOS
ENCSR000EYZ
r=0.12

small heat map img

GM12878
Bernstein
KAT2A
ENCSR000DNO
r=0.12

small heat map img

GM12878
Bernstein
POU2F2
ENCSR000BGP
r=0.12

small heat map img

GM12878
Bernstein
TCF12
ENCSR000BGZ
r=0.12

small heat map img

GM12878
Bernstein
SREBF1
ENCSR000DYU
r=0.12

small heat map img

GM12878
Bernstein
STAT5A
ENCSR000BQZ
r=0.12

small heat map img

GM12878
Bernstein
RCOR1
ENCSR000DZC
r=0.12

small heat map img

GM12878
Bernstein
SUPT20H
ENCSR000DNP
r=0.12

small heat map img

GM12878
Bernstein
SRF
ENCSR000BMI
r=0.12

small heat map img

GM12878
Bernstein
NFIC
ENCSR000BRN
r=0.11

small heat map img

GM12878
Bernstein
MTA3
ENCSR000BRH
r=0.11

small heat map img

GM12878
Bernstein
BCL3
ENCSR000BNQ
r=0.11

small heat map img

GM12878
Bernstein
USF2
ENCSR000DZU
r=0.11

small heat map img

GM12878
Bernstein
NR2C2
ENCSR000EUL
r=0.11

small heat map img

GM12878
Bernstein
PML
ENCSR000BQM
r=0.11

small heat map img

GM12878
Bernstein
EBF1
ENCSR000BGU
r=0.11

small heat map img

GM12878
Bernstein
ZNF274
ENCSR000EUK
r=0.11

small heat map img

GM12878
Bernstein
MXI1
ENCSR000DZI
r=0.11

small heat map img

GM12878
Bernstein
MAX
ENCSR000DZF
r=0.11

small heat map img

GM12878
Bernstein
SPI1
ENCSR000BGQ
r=0.10

small heat map img

GM12878
Bernstein
CEBPB
ENCSR000BRX
r=0.10

small heat map img

GM12878
Bernstein
NRF1
ENCSR000DZO
r=0.10

small heat map img

GM12878
Bernstein
EBF1
ENCSR000DZQ
r=0.10

small heat map img

GM12878
Bernstein
TCF3
ENCSR000BQT
r=0.10

small heat map img

GM12878
Bernstein
ETS1
ENCSR000BKA
r=0.10

small heat map img

GM12878
Bernstein
ZBTB33
ENCSR000BHC
r=0.10

small heat map img

GM12878
Bernstein
NFYA
ENCSR000DNN
r=0.09

small heat map img

GM12878
Bernstein
ZNF384
ENCSR000DYP
r=0.09

small heat map img

GM12878
Bernstein
IKZF1
ENCSR000EUJ
r=0.09

small heat map img

GM12878
Bernstein
TBP
ENCSR000DZZ
r=0.08

small heat map img

GM12878
Bernstein
PBX3
ENCSR000BGR
r=0.08

small heat map img

GM12878
Bernstein
CTCF
ENCSR000AKB
r=0.07

small heat map img

GM12878
Bernstein
SIN3A
ENCSR000DYX
r=0.07

small heat map img

GM12878
Bernstein
ELF1
ENCSR000BMB
r=0.07

small heat map img

GM12878
Bernstein
RXRA
ENCSR000BJD
r=0.07

small heat map img

GM12878
Bernstein
YY1
ENCSR000EUM
r=0.07

small heat map img

GM12878
Bernstein
ZZZ3
ENCSR000DNQ
r=0.07

small heat map img

GM12878
Bernstein
MEF2C
ENCSR000BNG
r=0.07

small heat map img

GM12878
Bernstein
CHD1
ENCSR000DZE
r=0.07

small heat map img

GM12878
Bernstein
ZNF143
ENCSR000DZL
r=0.07

small heat map img

GM12878
Bernstein
SIX5
ENCSR000BJE
r=0.06

small heat map img

GM12878
Bernstein
CTCF
ENCSR000DRZ
r=0.06

small heat map img

GM12878
Bernstein
CTCF
ENCSR000DKV
r=0.06

small heat map img

GM12878
Bernstein
RAD21
ENCSR000BMY
r=0.06

small heat map img

GM12878
Bernstein
EGR1
ENCSR000BMQ
r=0.05

small heat map img

GM12878
Bernstein
CTCF
ENCSR000DZN
r=0.05

small heat map img

GM12878
Bernstein
POLR2A
ENCSR000EYW
r=0.05

small heat map img

GM12878
Bernstein
YY1
ENCSR000BNP
r=0.04

small heat map img

GM12878
Bernstein
POLR2A
ENCSR000EAD
r=0.04

small heat map img

GM12878
Bernstein
TAF1
ENCSR000BGS
r=0.04

small heat map img

GM12878
Bernstein
NFYB
ENCSR000DNM
r=0.04

small heat map img

GM12878
Bernstein
POLR3G
ENCSR000EYU
r=0.04

small heat map img

GM12878
Bernstein
SRF
ENCSR000BGE
r=0.04

small heat map img

GM12878
Bernstein
ATF3
ENCSR000BJY
r=0.04

small heat map img

GM12878
Bernstein
REST
ENCSR000BQS
r=0.03

small heat map img

GM12878
Bernstein
EGR1
ENCSR000BRG
r=0.02

small heat map img

GM12878
Bernstein
ZEB1
ENCSR000BND
r=0.02

small heat map img

GM12878
Bernstein
POLR2A
ENCSR000BGD
r=0.02

small heat map img

GM12878
Bernstein
GABPA
ENCSR000BGC
r=0.02

small heat map img

GM12878
Bernstein
REST
ENCSR000BGF
r=0.01

small heat map img

GM12878
Bernstein
USF1
ENCSR000BGI
r=0.01

small heat map img

GM12878
Bernstein
POLR2A
ENCSR000DKT
r=-0.01

small heat map img
2,472 peaks (download )

H1-hESC - Bernstein - ENCSR000ASY

H1-hESC
Bernstein
EZH2
ENCSR000ASY
r=1.00

small heat map img

H1-hESC
Bernstein
SUZ12
ENCSR000ATS
r=0.84

small heat map img

H1-hESC
Bernstein
SUZ12
ENCSR000EUQ
r=0.77

small heat map img

H1-hESC
Bernstein
CTBP2
ENCSR000EUO
r=0.46

small heat map img

H1-hESC
Bernstein
CHD1
ENCSR000AQK
r=0.34

small heat map img

H1-hESC
Bernstein
KDM5B
ENCSR000AUR
r=0.26

small heat map img

H1-hESC
Bernstein
CHD7
ENCSR000AVA
r=0.23

small heat map img

H1-hESC
Bernstein
HDAC6
ENCSR000ATQ
r=0.13

small heat map img

H1-hESC
Bernstein
CHD1
ENCSR000EBU
r=0.12

small heat map img

H1-hESC
Bernstein
EP300
ENCSR000AUQ
r=0.11

small heat map img

H1-hESC
Bernstein
MYC
ENCSR000DLI
r=0.11

small heat map img

H1-hESC
Bernstein
SIRT6
ENCSR000AUS
r=0.09

small heat map img

H1-hESC
Bernstein
BACH1
ENCSR000EBQ
r=0.09

small heat map img

H1-hESC
Bernstein
KDM5A
ENCSR000AQL
r=0.07

small heat map img

H1-hESC
Bernstein
GABPA
ENCSR000BIW
r=0.06

small heat map img

H1-hESC
Bernstein
TCF12
ENCSR000BIT
r=0.05

small heat map img

H1-hESC
Bernstein
RBBP5
ENCSR000AQC
r=0.04

small heat map img

H1-hESC
Bernstein
USF2
ENCSR000ECD
r=0.04

small heat map img

H1-hESC
Bernstein
ZNF274
ENCSR000EUN
r=0.04

small heat map img

H1-hESC
Bernstein
RFX5
ENCSR000ECF
r=0.04

small heat map img

H1-hESC
Bernstein
CREB1
ENCSR000BSN
r=0.04

small heat map img

H1-hESC
Bernstein
BRCA1
ENCSR000EBX
r=0.03

small heat map img

H1-hESC
Bernstein
TEAD4
ENCSR000BRY
r=0.03

small heat map img

H1-hESC
Bernstein
HDAC2
ENCSR000AVB
r=0.03

small heat map img

H1-hESC
Bernstein
CEBPB
ENCSR000EBV
r=0.03

small heat map img

H1-hESC
Bernstein
JUN
ENCSR000ECA
r=0.02

small heat map img

H1-hESC
Bernstein
ZNF143
ENCSR000EBW
r=0.02

small heat map img

H1-hESC
Bernstein
MAX
ENCSR000BSJ
r=0.01

small heat map img

H1-hESC
Bernstein
E2F6
ENCSR000BSI
r=0.01

small heat map img

H1-hESC
Bernstein
YY1
ENCSR000BKD
r=0.01

small heat map img

H1-hESC
Bernstein
CTCF
ENCSR000DLK
r=0.01

small heat map img

H1-hESC
Bernstein
MXI1
ENCSR000EBR
r=0.00

small heat map img

H1-hESC
Bernstein
MYC
ENCSR000EBY
r=0.00

small heat map img

H1-hESC
Bernstein
NRF1
ENCSR000ECC
r=0.00

small heat map img

H1-hESC
Bernstein
TBP
ENCSR000ECB
r=-0.00

small heat map img

H1-hESC
Bernstein
EGR1
ENCSR000BJA
r=-0.00

small heat map img

H1-hESC
Bernstein
JUND
ENCSR000EBZ
r=-0.00

small heat map img

H1-hESC
Bernstein
BCL11A
ENCSR000BIP
r=-0.00

small heat map img

H1-hESC
Bernstein
RXRA
ENCSR000BJW
r=-0.00

small heat map img

H1-hESC
Bernstein
BCL11A
ENCSR000BMJ
r=-0.00

small heat map img

H1-hESC
Bernstein
FOSL1
ENCSR000BNS
r=-0.01

small heat map img

H1-hESC
Bernstein
SP4
ENCSR000BQV
r=-0.01

small heat map img

H1-hESC
Bernstein
SP1
ENCSR000BIR
r=-0.01

small heat map img

H1-hESC
Bernstein
ATF2
ENCSR000BQU
r=-0.01

small heat map img

H1-hESC
Bernstein
ATF3
ENCSR000BKC
r=-0.01

small heat map img

H1-hESC
Bernstein
NANOG
ENCSR000BMT
r=-0.01

small heat map img

H1-hESC
Bernstein
SIX5
ENCSR000BIQ
r=-0.01

small heat map img

H1-hESC
Bernstein
USF1
ENCSR000BIU
r=-0.01

small heat map img

H1-hESC
Bernstein
TAF7
ENCSR000BLU
r=-0.01

small heat map img

H1-hESC
Bernstein
SRF
ENCSR000BIV
r=-0.01

small heat map img

H1-hESC
Bernstein
MAX
ENCSR000EUP
r=-0.01

small heat map img

H1-hESC
Bernstein
RAD21
ENCSR000ECE
r=-0.01

small heat map img

H1-hESC
Bernstein
JUND
ENCSR000BKP
r=-0.01

small heat map img

H1-hESC
Bernstein
EP300
ENCSR000BKK
r=-0.02

small heat map img

H1-hESC
Bernstein
HDAC2
ENCSR000BNR
r=-0.02

small heat map img

H1-hESC
Bernstein
SP2
ENCSR000BQG
r=-0.02

small heat map img

H1-hESC
Bernstein
CTCF
ENCSR000AMF
r=-0.02

small heat map img

H1-hESC
Bernstein
MAFK
ENCSR000EBS
r=-0.03

small heat map img

H1-hESC
Bernstein
PHF8
ENCSR000ATK
r=-0.03

small heat map img

H1-hESC
Bernstein
REST
ENCSR000BHM
r=-0.03

small heat map img

H1-hESC
Bernstein
SIN3A
ENCSR000BIS
r=-0.04

small heat map img

H1-hESC
Bernstein
SAP30
ENCSR000ATR
r=-0.04

small heat map img

H1-hESC
Bernstein
CTCF
ENCSR000BNH
r=-0.05

small heat map img

H1-hESC
Bernstein
RAD21
ENCSR000BLD
r=-0.05

small heat map img

H1-hESC
Bernstein
KDM4A
ENCSR000AVC
r=-0.07

small heat map img

H1-hESC
Bernstein
TAF1
ENCSR000BHO
r=-0.07

small heat map img

H1-hESC
Bernstein
SIN3A
ENCSR000EBO
r=-0.08

small heat map img

H1-hESC
Bernstein
POLR2A
ENCSR000BHN
r=-0.08

small heat map img

H1-hESC
Bernstein
POLR2A
ENCSR000DLJ
r=-0.16

small heat map img
6,370 peaks (download )

HeLa-S3 - Bernstein - ENCSR000ATC

HeLa-S3
Bernstein
EZH2
ENCSR000ATC
r=1.00

small heat map img

HeLa-S3
Bernstein
ZNF274
ENCSR000EVG
r=0.37

small heat map img

HeLa-S3
Bernstein
TCF7L2
ENCSR000EVE
r=0.33

small heat map img

HeLa-S3
Bernstein
NR2C2
ENCSR000EVN
r=0.29

small heat map img

HeLa-S3
Bernstein
ELK1
ENCSR000ECI
r=0.27

small heat map img

HeLa-S3
Bernstein
E2F1
ENCSR000EVJ
r=0.25

small heat map img

HeLa-S3
Bernstein
E2F4
ENCSR000EVL
r=0.25

small heat map img

HeLa-S3
Bernstein
ZKSCAN1
ENCSR000ECJ
r=0.25

small heat map img

HeLa-S3
Bernstein
ZNF143
ENCSR000ECO
r=0.25

small heat map img

HeLa-S3
Bernstein
SMARCC1
ENCSR000EDM
r=0.24

small heat map img

HeLa-S3
Bernstein
CTCF
ENCSR000AOA
r=0.23

small heat map img

HeLa-S3
Bernstein
SMARCC2
ENCSR000EDL
r=0.23

small heat map img

HeLa-S3
Bernstein
RCOR1
ENCSR000ECM
r=0.22

small heat map img

HeLa-S3
Bernstein
USF2
ENCSR000ECW
r=0.22

small heat map img

HeLa-S3
Bernstein
MAX
ENCSR000ECN
r=0.22

small heat map img

HeLa-S3
Bernstein
E2F6
ENCSR000EVK
r=0.22

small heat map img

HeLa-S3
Bernstein
SMC3
ENCSR000ECS
r=0.21

small heat map img

HeLa-S3
Bernstein
MAFK
ENCSR000ECK
r=0.21

small heat map img

HeLa-S3
Bernstein
SMARCB1
ENCSR000EDK
r=0.20

small heat map img

HeLa-S3
Bernstein
MXI1
ENCSR000ECU
r=0.19

small heat map img

HeLa-S3
Bernstein
ELK4
ENCSR000EVI
r=0.18

small heat map img

HeLa-S3
Bernstein
STAT1
ENCSR000EZK
r=0.18

small heat map img

HeLa-S3
Bernstein
TCF7L2
ENCSR000EVF
r=0.18

small heat map img

HeLa-S3
Bernstein
BRF2
ENCSR000DNV
r=0.17

small heat map img

HeLa-S3
Bernstein
HCFC1
ENCSR000ECH
r=0.17

small heat map img

HeLa-S3
Bernstein
MAX
ENCSR000EZF
r=0.17

small heat map img

HeLa-S3
Bernstein
IRF3
ENCSR000EDF
r=0.14

small heat map img

HeLa-S3
Bernstein
MYC
ENCSR000EZD
r=0.14

small heat map img

HeLa-S3
Bernstein
CEBPB
ENCSR000EDA
r=0.13

small heat map img

HeLa-S3
Bernstein
FOS
ENCSR000EZE
r=0.13

small heat map img

HeLa-S3
Bernstein
BRCA1
ENCSR000EDB
r=0.12

small heat map img

HeLa-S3
Bernstein
RFX5
ENCSR000ECX
r=0.11

small heat map img

HeLa-S3
Bernstein
PRDM1
ENCSR000ECY
r=0.11

small heat map img

HeLa-S3
Bernstein
BRF1
ENCSR000DNW
r=0.11

small heat map img

HeLa-S3
Bernstein
KAT2A
ENCSR000ECR
r=0.10

small heat map img

HeLa-S3
Bernstein
BDP1
ENCSR000DNX
r=0.10

small heat map img

HeLa-S3
Bernstein
SMARCA4
ENCSR000EZC
r=0.09

small heat map img

HeLa-S3
Bernstein
POLR3A
ENCSR000DNU
r=0.08

small heat map img

HeLa-S3
Bernstein
MYC
ENCSR000DLN
r=0.08

small heat map img

HeLa-S3
Bernstein
STAT3
ENCSR000EDC
r=0.08

small heat map img

HeLa-S3
Bernstein
JUND
ENCSR000EDH
r=0.07

small heat map img

HeLa-S3
Bernstein
JUN
ENCSR000EDG
r=0.07

small heat map img

HeLa-S3
Bernstein
RAD21
ENCSR000EDE
r=0.07

small heat map img

HeLa-S3
Bernstein
EP300
ENCSR000ECV
r=0.07

small heat map img

HeLa-S3
Bernstein
SUPT20H
ENCSR000ECQ
r=0.07

small heat map img

HeLa-S3
Bernstein
TBP
ENCSR000EDD
r=0.07

small heat map img

HeLa-S3
Bernstein
NFYB
ENCSR000DNR
r=0.07

small heat map img

HeLa-S3
Bernstein
CTCF
ENCSR000DUB
r=0.06

small heat map img

HeLa-S3
Bernstein
NRF1
ENCSR000EDJ
r=0.06

small heat map img

HeLa-S3
Bernstein
NFYA
ENCSR000DNS
r=0.06

small heat map img

HeLa-S3
Bernstein
CTCF
ENCSR000DLO
r=0.06

small heat map img

HeLa-S3
Bernstein
GTF3C2
ENCSR000DNY
r=0.05

small heat map img

HeLa-S3
Bernstein
GABPA
ENCSR000BHS
r=0.05

small heat map img

HeLa-S3
Bernstein
POLR2A
ENCSR000DLM
r=0.05

small heat map img

HeLa-S3
Bernstein
POLR2A
ENCSR000EZL
r=0.04

small heat map img

HeLa-S3
Bernstein
TAF1
ENCSR000BHT
r=0.02

small heat map img

HeLa-S3
Bernstein
REST
ENCSR000BMN
r=0.01

small heat map img

HeLa-S3
Bernstein
POLR2A
ENCSR000BGO
r=-0.01

small heat map img

HeLa-S3
Bernstein
ZZZ3
ENCSR000DNT
r=-0.03

small heat map img
1,818 peaks (download )

HepG2 - Bernstein - ENCSR000ARI

HepG2
Bernstein
EZH2
ENCSR000ARI
r=1.00

small heat map img

HepG2
Bernstein
SREBF1
ENCSR000EEO
r=0.20

small heat map img

HepG2
Bernstein
BRCA1
ENCSR000EDY
r=0.18

small heat map img

HepG2
Bernstein
ZEB1
ENCSR000BVN
r=0.17

small heat map img

HepG2
Bernstein
RCOR1
ENCSR000EDQ
r=0.16

small heat map img

HepG2
Bernstein
NR2F2
ENCSR000BVM
r=0.15

small heat map img

HepG2
Bernstein
RFX5
ENCSR000EEA
r=0.15

small heat map img

HepG2
Bernstein
EP300
ENCSR000EDV
r=0.15

small heat map img

HepG2
Bernstein
MYC
ENCSR000DLR
r=0.14

small heat map img

HepG2
Bernstein
USF2
ENCSR000EEF
r=0.13

small heat map img

HepG2
Bernstein
ESRRA
ENCSR000EEW
r=0.13

small heat map img

HepG2
Bernstein
BHLHE40
ENCSR000EDT
r=0.12

small heat map img

HepG2
Bernstein
MAX
ENCSR000EDS
r=0.12

small heat map img

HepG2
Bernstein
NR2C2
ENCSR000EVS
r=0.12

small heat map img

HepG2
Bernstein
MAFK
ENCSR000EDZ
r=0.11

small heat map img

HepG2
Bernstein
HSF1
ENCSR000EET
r=0.11

small heat map img

HepG2
Bernstein
MXI1
ENCSR000EDU
r=0.11

small heat map img

HepG2
Bernstein
HNF4A
ENCSR000EEU
r=0.11

small heat map img

HepG2
Bernstein
MAX
ENCSR000BTM
r=0.11

small heat map img

HepG2
Bernstein
ARID3A
ENCSR000EDP
r=0.10

small heat map img

HepG2
Bernstein
NR3C1
ENCSR000EEV
r=0.10

small heat map img

HepG2
Bernstein
CEBPB
ENCSR000EEX
r=0.09

small heat map img

HepG2
Bernstein
MAFF
ENCSR000EEC
r=0.09

small heat map img

HepG2
Bernstein
CEBPB
ENCSR000EEE
r=0.09

small heat map img

HepG2
Bernstein
MAFK
ENCSR000EEB
r=0.07

small heat map img

HepG2
Bernstein
CTCF
ENCSR000DUG
r=0.07

small heat map img

HepG2
Bernstein
SMC3
ENCSR000EDW
r=0.06

small heat map img

HepG2
Bernstein
CREB1
ENCSR000BVL
r=0.06

small heat map img

HepG2
Bernstein
HDAC2
ENCSR000BMC
r=0.05

small heat map img

HepG2
Bernstein
CTCF
ENCSR000AMA
r=0.05

small heat map img

HepG2
Bernstein
RAD21
ENCSR000EEG
r=0.05

small heat map img

HepG2
Bernstein
IRF3
ENCSR000EEJ
r=0.04

small heat map img

HepG2
Bernstein
CTCF
ENCSR000DLS
r=0.04

small heat map img

HepG2
Bernstein
SREBF2
ENCSR000EZO
r=0.04

small heat map img

HepG2
Bernstein
JUND
ENCSR000EEI
r=0.04

small heat map img

HepG2
Bernstein
ATF3
ENCSR000BKE
r=0.03

small heat map img

HepG2
Bernstein
ZBTB33
ENCSR000BHR
r=0.03

small heat map img

HepG2
Bernstein
SREBF1
ENCSR000EZP
r=0.03

small heat map img

HepG2
Bernstein
NRF1
ENCSR000EEH
r=0.02

small heat map img

HepG2
Bernstein
ZBTB7A
ENCSR000BQA
r=0.02

small heat map img

HepG2
Bernstein
ZBTB33
ENCSR000BNA
r=0.02

small heat map img

HepG2
Bernstein
CEBPB
ENCSR000BQI
r=0.02

small heat map img

HepG2
Bernstein
RAD21
ENCSR000BLS
r=0.02

small heat map img

HepG2
Bernstein
MYBL2
ENCSR000BRO
r=0.02

small heat map img

HepG2
Bernstein
RXRA
ENCSR000BHU
r=0.02

small heat map img

HepG2
Bernstein
FOSL2
ENCSR000BHP
r=0.02

small heat map img

HepG2
Bernstein
SP2
ENCSR000BOU
r=0.02

small heat map img

HepG2
Bernstein
CTCF
ENCSR000BIE
r=0.02

small heat map img

HepG2
Bernstein
NFIC
ENCSR000BQX
r=0.01

small heat map img

HepG2
Bernstein
TCF12
ENCSR000BJG
r=0.01

small heat map img

HepG2
Bernstein
BHLHE40
ENCSR000BID
r=0.01

small heat map img

HepG2
Bernstein
TBP
ENCSR000EEL
r=0.01

small heat map img

HepG2
Bernstein
HNF4G
ENCSR000BNJ
r=0.01

small heat map img

HepG2
Bernstein
TAF1
ENCSR000BJN
r=0.01

small heat map img

HepG2
Bernstein
MBD4
ENCSR000BQW
r=0.01

small heat map img

HepG2
Bernstein
YY1
ENCSR000BNT
r=0.01

small heat map img

HepG2
Bernstein
REST
ENCSR000BJL
r=0.01

small heat map img

HepG2
Bernstein
SRF
ENCSR000BLV
r=0.01

small heat map img

HepG2
Bernstein
GABPA
ENCSR000BJK
r=0.01

small heat map img

HepG2
Bernstein
TEAD4
ENCSR000BRP
r=0.01

small heat map img

HepG2
Bernstein
FOXA2
ENCSR000BNI
r=0.01

small heat map img

HepG2
Bernstein
JUND
ENCSR000BGK
r=0.00

small heat map img

HepG2
Bernstein
USF1
ENCSR000BGM
r=0.00

small heat map img

HepG2
Bernstein
REST
ENCSR000BOT
r=0.00

small heat map img

HepG2
Bernstein
TCF7L2
ENCSR000EVQ
r=0.00

small heat map img

HepG2
Bernstein
FOXA1
ENCSR000BMO
r=0.00

small heat map img

HepG2
Bernstein
POLR2A
ENCSR000EZQ
r=0.00

small heat map img

HepG2
Bernstein
JUN
ENCSR000EEK
r=-0.00

small heat map img

HepG2
Bernstein
ZNF274
ENCSR000EVR
r=-0.00

small heat map img

HepG2
Bernstein
ELF1
ENCSR000BMZ
r=-0.00

small heat map img

HepG2
Bernstein
SIN3A
ENCSR000BGL
r=-0.00

small heat map img

HepG2
Bernstein
FOXA1
ENCSR000BLE
r=-0.00

small heat map img

HepG2
Bernstein
HNF4A
ENCSR000BLF
r=-0.00

small heat map img

HepG2
Bernstein
EP300
ENCSR000BLW
r=-0.01

small heat map img

HepG2
Bernstein
POLR2A
ENCSR000EEM
r=-0.01

small heat map img

HepG2
Bernstein
CEBPD
ENCSR000BQJ
r=-0.01

small heat map img

HepG2
Bernstein
POLR2A
ENCSR000EEP
r=-0.01

small heat map img

HepG2
Bernstein
SP1
ENCSR000BJX
r=-0.02

small heat map img

HepG2
Bernstein
POLR2A
ENCSR000DLQ
r=-0.04

small heat map img

HepG2
Bernstein
POLR2A
ENCSR000BJM
r=-0.04

small heat map img
3,286 peaks (download )

K562 - Bernstein - ENCSR000AQE

K562
Bernstein
EZH2
ENCSR000AQE
r=1.00

small heat map img

K562
Bernstein
SUZ12
ENCSR000AUC
r=0.56

small heat map img

K562
Bernstein
SETDB1
ENCSR000AUT
r=0.48

small heat map img

K562
Bernstein
HDAC6
ENCSR000ATJ
r=0.47

small heat map img

K562
Bernstein
EP300
ENCSR000AQB
r=0.47

small heat map img

K562
Bernstein
CBX2
ENCSR000ATU
r=0.45

small heat map img

K562
Bernstein
RNF2
ENCSR000AUA
r=0.44

small heat map img

K562
Bernstein
CBX3
ENCSR000ATV
r=0.44

small heat map img

K562
Bernstein
CHD7
ENCSR000AVD
r=0.44

small heat map img

K562
Bernstein
HDAC1
ENCSR000AQF
r=0.43

small heat map img

K562
Bernstein
HDAC2
ENCSR000AQG
r=0.42

small heat map img

K562
Bernstein
TBL1XR1
ENCSR000EGA
r=0.41

small heat map img

K562
Bernstein
CBX8
ENCSR000ATW
r=0.41

small heat map img

K562
Bernstein
ATF1
ENCSR000DNZ
r=0.40

small heat map img

K562
Bernstein
WHSC1
ENCSR000AVE
r=0.40

small heat map img

K562
Bernstein
CREBBP
ENCSR000ATT
r=0.39

small heat map img

K562
Bernstein
KAT2B
ENCSR000ATZ
r=0.39

small heat map img

K562
Bernstein
BACH1
ENCSR000EGD
r=0.38

small heat map img

K562
Bernstein
MAFK
ENCSR000EGX
r=0.38

small heat map img

K562
Bernstein
UBTF
ENCSR000EFW
r=0.38

small heat map img

K562
Bernstein
SAP30
ENCSR000AQJ
r=0.37

small heat map img

K562
Bernstein
RCOR1
ENCSR000EGC
r=0.36

small heat map img

K562
Bernstein
CHD1
ENCSR000AQD
r=0.36

small heat map img

K562
Bernstein
RFX5
ENCSR000EGO
r=0.36

small heat map img

K562
Bernstein
HCFC1
ENCSR000EFN
r=0.36

small heat map img

K562
Bernstein
ELK1
ENCSR000EFU
r=0.36

small heat map img

K562
Bernstein
USF2
ENCSR000EHG
r=0.35

small heat map img

K562
Bernstein
CUX1
ENCSR000EFO
r=0.35

small heat map img

K562
Bernstein
GATA1
ENCSR000EWM
r=0.35

small heat map img

K562
Bernstein
RBBP5
ENCSR000AQI
r=0.35

small heat map img

K562
Bernstein
SMC3
ENCSR000EGW
r=0.35

small heat map img

K562
Bernstein
UBTF
ENCSR000EFZ
r=0.34

small heat map img

K562
Bernstein
BHLHE40
ENCSR000EGV
r=0.33

small heat map img

K562
Bernstein
SETDB1
ENCSR000EWI
r=0.33

small heat map img

K562
Bernstein
ZNF143
ENCSR000EGP
r=0.33

small heat map img

K562
Bernstein
SIRT6
ENCSR000AUB
r=0.33

small heat map img

K562
Bernstein
MXI1
ENCSR000EGZ
r=0.33

small heat map img

K562
Bernstein
NFE2
ENCSR000FAF
r=0.33

small heat map img

K562
Bernstein
MAFF
ENCSR000EGI
r=0.33

small heat map img

K562
Bernstein
ZNF263
ENCSR000EWN
r=0.32

small heat map img

K562
Bernstein
STAT1
ENCSR000EHJ
r=0.32

small heat map img

K562
Bernstein
MYC
ENCSR000FAZ
r=0.32

small heat map img

K562
Bernstein
NR2C2
ENCSR000EWH
r=0.32

small heat map img

K562
Bernstein
ZNF274
ENCSR000EWE
r=0.31

small heat map img

K562
Bernstein
JUN
ENCSR000EFS
r=0.31

small heat map img

K562
Bernstein
EP300
ENCSR000EGY
r=0.31

small heat map img

K562
Bernstein
MYC
ENCSR000EZV
r=0.31

small heat map img

K562
Bernstein
STAT1
ENCSR000EHK
r=0.31

small heat map img

K562
Bernstein
YY1
ENCSR000EWF
r=0.31

small heat map img

K562
Bernstein
ATF3
ENCSR000DOG
r=0.31

small heat map img

K562
Bernstein
BRF2
ENCSR000DOC
r=0.30

small heat map img

K562
Bernstein
STAT1
ENCSR000FAU
r=0.30

small heat map img

K562
Bernstein
NCOR1
ENCSR000ATY
r=0.30

small heat map img

K562
Bernstein
KDM1A
ENCSR000ATX
r=0.30

small heat map img

K562
Bernstein
STAT2
ENCSR000FAT
r=0.29

small heat map img

K562
Bernstein
SETDB1
ENCSR000EWD
r=0.29

small heat map img

K562
Bernstein
ZNF274
ENCSR000EVX
r=0.29

small heat map img

K562
Bernstein
GATA1
ENCSR000EFT
r=0.29

small heat map img

K562
Bernstein
MYC
ENCSR000EGJ
r=0.28

small heat map img

K562
Bernstein
E2F4
ENCSR000EWL
r=0.28

small heat map img

K562
Bernstein
XRCC4
ENCSR000FAC
r=0.28

small heat map img

K562
Bernstein
MAX
ENCSR000FAE
r=0.28

small heat map img

K562
Bernstein
CREB1
ENCSR000BSO
r=0.28

small heat map img

K562
Bernstein
BDP1
ENCSR000DOK
r=0.28

small heat map img

K562
Bernstein
NFYA
ENCSR000EGR
r=0.28

small heat map img

K562
Bernstein
TBL1XR1
ENCSR000EGB
r=0.28

small heat map img

K562
Bernstein
BRF1
ENCSR000DOJ
r=0.28

small heat map img

K562
Bernstein
ZNF384
ENCSR000EFP
r=0.28

small heat map img

K562
Bernstein
STAT2
ENCSR000FBC
r=0.27

small heat map img

K562
Bernstein
IRF1
ENCSR000EGT
r=0.27

small heat map img

K562
Bernstein
IRF1
ENCSR000EGL
r=0.27

small heat map img

K562
Bernstein
STAT1
ENCSR000FAV
r=0.27

small heat map img

K562
Bernstein
HMGN3
ENCSR000DOB
r=0.27

small heat map img

K562
Bernstein
POLR3A
ENCSR000DOI
r=0.27

small heat map img

K562
Bernstein
JUN
ENCSR000EGH
r=0.27

small heat map img

K562
Bernstein
NRF1
ENCSR000EHH
r=0.27

small heat map img

K562
Bernstein
RAD21
ENCSR000FAD
r=0.27

small heat map img

K562
Bernstein
GATA2
ENCSR000EWG
r=0.26

small heat map img

K562
Bernstein
IRF1
ENCSR000EGU
r=0.26

small heat map img

K562
Bernstein
JUN
ENCSR000EZX
r=0.26

small heat map img

K562
Bernstein
ARID3A
ENCSR000EFY
r=0.26

small heat map img

K562
Bernstein
IRF1
ENCSR000EGK
r=0.25

small heat map img

K562
Bernstein
JUN
ENCSR000FAH
r=0.25

small heat map img

K562
Bernstein
TRIM28
ENCSR000EVY
r=0.25

small heat map img

K562
Bernstein
ZMIZ1
ENCSR000EFQ
r=0.25

small heat map img

K562
Bernstein
MAX
ENCSR000EFV
r=0.25

small heat map img

K562
Bernstein
JUND
ENCSR000EGN
r=0.25

small heat map img

K562
Bernstein
CHD4
ENCSR000ATL
r=0.25

small heat map img

K562
Bernstein
RCOR1
ENCSR000EGG
r=0.24

small heat map img

K562
Bernstein
REST
ENCSR000ATM
r=0.24

small heat map img

K562
Bernstein
MYC
ENCSR000EZU
r=0.24

small heat map img

K562
Bernstein
MYC
ENCSR000FAG
r=0.23

small heat map img

K562
Bernstein
MYC
ENCSR000EGS
r=0.23

small heat map img

K562
Bernstein
SIRT6
ENCSR000DOH
r=0.23

small heat map img

K562
Bernstein
JUN
ENCSR000EZT
r=0.23

small heat map img

K562
Bernstein
KDM5B
ENCSR000AQA
r=0.23

small heat map img

K562
Bernstein
GTF2B
ENCSR000DOE
r=0.22

small heat map img

K562
Bernstein
POLR2A
ENCSR000EHL
r=0.22

small heat map img

K562
Bernstein
SMARCB1
ENCSR000EHN
r=0.22

small heat map img

K562
Bernstein
FOS
ENCSR000FAI
r=0.22

small heat map img

K562
Bernstein
JUN
ENCSR000EZW
r=0.21

small heat map img

K562
Bernstein
CTCF
ENCSR000EGM
r=0.21

small heat map img

K562
Bernstein
E2F6
ENCSR000EWJ
r=0.20

small heat map img

K562
Bernstein
CEBPB
ENCSR000EHE
r=0.20

small heat map img

K562
Bernstein
CEBPD
ENCSR000BVY
r=0.19

small heat map img

K562
Bernstein
TRIM28
ENCSR000BRW
r=0.19

small heat map img

K562
Bernstein
TBP
ENCSR000EHA
r=0.19

small heat map img

K562
Bernstein
SMARCA4
ENCSR000EHO
r=0.19

small heat map img

K562
Bernstein
CTCF
ENCSR000AKO
r=0.18

small heat map img

K562
Bernstein
NR2F2
ENCSR000BRS
r=0.18

small heat map img

K562
Bernstein
ATF3
ENCSR000BNU
r=0.18

small heat map img

K562
Bernstein
EP300
ENCSR000EGE
r=0.18

small heat map img

K562
Bernstein
PHF8
ENCSR000AQH
r=0.18

small heat map img

K562
Bernstein
CCNT2
ENCSR000DOA
r=0.18

small heat map img

K562
Bernstein
CTCF
ENCSR000DWE
r=0.17

small heat map img

K562
Bernstein
POLR3G
ENCSR000EHQ
r=0.17

small heat map img

K562
Bernstein
STAT5A
ENCSR000BRR
r=0.16

small heat map img

K562
Bernstein
PML
ENCSR000BQY
r=0.16

small heat map img

K562
Bernstein
GTF3C2
ENCSR000DOD
r=0.16

small heat map img

K562
Bernstein
REST
ENCSR000BMW
r=0.16

small heat map img

K562
Bernstein
ZBTB33
ENCSR000BKF
r=0.15

small heat map img

K562
Bernstein
CEBPB
ENCSR000BRQ
r=0.15

small heat map img

K562
Bernstein
CBX3
ENCSR000BRT
r=0.15

small heat map img

K562
Bernstein
GATA2
ENCSR000BKM
r=0.15

small heat map img

K562
Bernstein
TEAD4
ENCSR000BRK
r=0.14

small heat map img

K562
Bernstein
MYC
ENCSR000DLZ
r=0.14

small heat map img

K562
Bernstein
ETS1
ENCSR000BKQ
r=0.14

small heat map img

K562
Bernstein
MEF2A
ENCSR000BNV
r=0.14

small heat map img

K562
Bernstein
MAX
ENCSR000BLP
r=0.14

small heat map img

K562
Bernstein
GABPA
ENCSR000BLO
r=0.14

small heat map img

K562
Bernstein
TAL1
ENCSR000EHB
r=0.14

small heat map img

K562
Bernstein
FOSL1
ENCSR000BMV
r=0.14

small heat map img

K562
Bernstein
HDAC2
ENCSR000BMG
r=0.13

small heat map img

K562
Bernstein
SP1
ENCSR000BKO
r=0.13

small heat map img

K562
Bernstein
SIN3A
ENCSR000BLR
r=0.12

small heat map img

K562
Bernstein
CTCF
ENCSR000BPJ
r=0.12

small heat map img

K562
Bernstein
USF1
ENCSR000BKT
r=0.12

small heat map img

K562
Bernstein
SRF
ENCSR000BLK
r=0.12

small heat map img

K562
Bernstein
THAP1
ENCSR000BNN
r=0.11

small heat map img

K562
Bernstein
EGR1
ENCSR000BNE
r=0.11

small heat map img

K562
Bernstein
SPI1
ENCSR000BGW
r=0.11

small heat map img

K562
Bernstein
NFYB
ENCSR000EGQ
r=0.10

small heat map img

K562
Bernstein
CTCFL
ENCSR000BNK
r=0.10

small heat map img

K562
Bernstein
CTCF
ENCSR000DMA
r=0.10

small heat map img

K562
Bernstein
YY1
ENCSR000BKU
r=0.10

small heat map img

K562
Bernstein
SIX5
ENCSR000BNW
r=0.10

small heat map img

K562
Bernstein
POLR2A
ENCSR000FAY
r=0.09

small heat map img

K562
Bernstein
SIX5
ENCSR000BGX
r=0.09

small heat map img

K562
Bernstein
ZBTB7A
ENCSR000BME
r=0.09

small heat map img

K562
Bernstein
TAF1
ENCSR000BKS
r=0.09

small heat map img

K562
Bernstein
RAD21
ENCSR000BKV
r=0.09

small heat map img

K562
Bernstein
POLR2A
ENCSR000FAX
r=0.09

small heat map img

K562
Bernstein
YY1
ENCSR000BMH
r=0.08

small heat map img

K562
Bernstein
SP2
ENCSR000BNL
r=0.08

small heat map img

K562
Bernstein
POLR2A
ENCSR000DLY
r=0.08

small heat map img

K562
Bernstein
POLR2A
ENCSR000BMR
r=0.07

small heat map img

K562
Bernstein
POLR2A
ENCSR000FAJ
r=0.07

small heat map img

K562
Bernstein
TAF7
ENCSR000BNM
r=0.07

small heat map img

K562
Bernstein
ELF1
ENCSR000BMD
r=0.07

small heat map img

K562
Bernstein
POLR2A
ENCSR000EHP
r=0.07

small heat map img

K562
Bernstein
E2F6
ENCSR000BLI
r=0.06

small heat map img

K562
Bernstein
POLR2A
ENCSR000FAW
r=0.05

small heat map img
1,685 peaks (download )

astrocyte - Bernstein - ENCSR000ARR

astrocyte
Bernstein
EZH2
ENCSR000ARR
r=1.00

small heat map img

astrocyte
Bernstein
CTCF
ENCSR000AOO
r=-0.03

small heat map img
6,493 peaks (download )

endothelial cell of umbilical vein - Bernstein - ENCSR000ATA

endothelial cell of umbilical vein
Bernstein
EZH2
ENCSR000ATA
r=1.00

small heat map img

endothelial cell of umbilical vein
Bernstein
MYC
ENCSR000DLU
r=0.10

small heat map img

endothelial cell of umbilical vein
Bernstein
MAX
ENCSR000EEZ
r=0.05

small heat map img

endothelial cell of umbilical vein
Bernstein
GATA2
ENCSR000EVW
r=0.02

small heat map img

endothelial cell of umbilical vein
Bernstein
FOS
ENCSR000EVU
r=0.02

small heat map img

endothelial cell of umbilical vein
Bernstein
CTCF
ENCSR000ALA
r=0.01

small heat map img

endothelial cell of umbilical vein
Bernstein
CTCF
ENCSR000DVP
r=-0.01

small heat map img

endothelial cell of umbilical vein
Bernstein
POLR2A
ENCSR000EFB
r=-0.01

small heat map img

endothelial cell of umbilical vein
Bernstein
JUN
ENCSR000EFA
r=-0.03

small heat map img

endothelial cell of umbilical vein
Bernstein
CTCF
ENCSR000DLW
r=-0.04

small heat map img

endothelial cell of umbilical vein
Bernstein
POLR2A
ENCSR000BQB
r=-0.04

small heat map img

endothelial cell of umbilical vein
Bernstein
POLR2A
ENCSR000DLV
r=-0.11

small heat map img
6,234 peaks (download )

fibroblast of dermis - Bernstein - ENCSR000ASE

fibroblast of dermis
Bernstein
EZH2
ENCSR000ASE
r=1.00

small heat map img

fibroblast of dermis
Bernstein
CTCF
ENCSR000APM
r=-0.03

small heat map img
5,739 peaks (download )

fibroblast of lung - Bernstein - ENCSR000ARO

fibroblast of lung
Bernstein
EZH2
ENCSR000ARO
r=1.00

small heat map img

fibroblast of lung
Bernstein
CTCF
ENCSR000ANO
r=0.01

small heat map img

fibroblast of lung
Bernstein
CTCF
ENCSR000DPM
r=-0.02

small heat map img

fibroblast of lung
Bernstein
CTCF
ENCSR000DWY
r=-0.02

small heat map img

fibroblast of lung
Bernstein
CTCF
ENCSR000DVA
r=-0.03

small heat map img
7,030 peaks (download )

keratinocyte - Bernstein - ENCSR000ARK

keratinocyte
Bernstein
EZH2
ENCSR000ARK
r=1.00

small heat map img

keratinocyte
Bernstein
CTCF
ENCSR000ALJ
r=0.02

small heat map img

keratinocyte
Bernstein
CTCF
ENCSR000DNC
r=-0.01

small heat map img

keratinocyte
Bernstein
CTCF
ENCSR000DWX
r=-0.01

small heat map img
7,978 peaks (download )

mammary epithelial cell - Bernstein - ENCSR000ARE

mammary epithelial cell
Bernstein
EZH2
ENCSR000ARE
r=1.00

small heat map img

mammary epithelial cell
Bernstein
CTCF
ENCSR000ALV
r=-0.01

small heat map img

mammary epithelial cell
Bernstein
CTCF
ENCSR000DUS
r=-0.01

small heat map img
4,626 peaks (download )

myotube - Bernstein - ENCSR000ASZ

myotube
Bernstein
EZH2
ENCSR000ASZ
r=1.00

small heat map img

myotube
Bernstein
CTCF
ENCSR000ANS
r=0.01

small heat map img
2,700 peaks (download )

skeletal muscle myoblast - Bernstein - ENCSR000ARH

skeletal muscle myoblast
Bernstein
EZH2
ENCSR000ARH
r=1.00

small heat map img

skeletal muscle myoblast
Bernstein
CTCF
ENCSR000ANE
r=-0.02

small heat map img
1,540 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Bernstein - ENCSR000ARD

loading

K562 - Bernstein - ENCSR000AQE

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help