ESR1

This gene encodes an estrogen receptor, a ligand-activated transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription. The protein localizes to the nucleus where it may form a homodimer or a heterodimer with estrogen receptor 2. Estrogen and its receptors are essential for sexual development and reproductive function, but also play a role in other tissues such as bone. Estrogen receptors are also involved in pathological processes including breast cancer, endometrial cancer, and osteoporosis. Alternative promoter usage and alternative splicing result in dozens of transcript variants, but the full-length nature of many of these variants has not been determined. RefSeq, Mar 2014
Estrogen receptor alpha (ER), also known as NR3A1 (nuclear receptor subfamily 3, group A, member 1), is one of two main types of estrogen receptor, a nuclear receptor that is activated by the sex hormone estrogen. In humans, ER is encoded by the gene ESR1 (EStrogen Receptor 1).wikipedia

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

Ishikawa - Myers - ENCSR000BQR

1.
355 / 500
9.8e-565
AGGTCAGAGTGACCTGG
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 1.47
2.
9 / 500
3.5e-39
TCACAGGATGAGATAGGAGGTCAGCACAA
small heat map img p-value: 0.59
pct_center: 0.09
pct_ratio: 0.58
3.
9 / 500
1.0e-29
CTGATAAAACAGGTTGCAGTAAAGAAGCC
small heat map img p-value: 0.03
pct_center: 0.10
pct_ratio: 0.53
4.
110 / 500
8.2e-28
CACAGCAGGGG
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 0.83
5.
27 / 500
2.8e-10
GGGCAGTGGAGCGTGGCGACC
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.75
MEME output

Ishikawa - Myers - ENCSR000BIY

1.
421 / 500
1.5e-569
AGGTCAGGGTGACCT
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 1.54
2.
124 / 500
1.1e-20
GCTGTGACCTG
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 0.62
3.
8 / 500
3.2e-14
TGCTGATAAAACAGGTTGCAGTAAAGAAGC
small heat map img p-value: 0.99
pct_center: 0.11
pct_ratio: 0.53
4.
155 / 500
4.3e-9
AGGTCA
small heat map img p-value: 0.00
pct_center:
pct_ratio:
5.
19 / 500
0.00039
CACAGCAGGAGATAG
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.76
MEME output

Ishikawa - Myers - ENCSR000BKL

1.
415 / 500
3.7e-541
AGGTCAGGGTGACCT
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 1.32
2.
8 / 500
1.1e-22
TGCTGATAAAACAGGTTGCAGTAAAGAAGC
small heat map img p-value: 0.58
pct_center: 0.10
pct_ratio: 0.54
3.
159 / 500
4.4e-14
AGGTCA
small heat map img p-value: 0.00
pct_center:
pct_ratio:
4.
75 / 500
8.6e-10
CAGCAGGA
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 0.85
5.
10 / 500
3.8e-7
TTAGTCACAGGATGAGAAAGG
small heat map img p-value: 0.02
pct_center: 0.09
pct_ratio: 0.65
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

T47D - Myers - ENCSR000BQD

1.
500 / 500
3.5e-818
AGGTCAGGGTGACCT
small heat map img p-value: 0.00
pct_center: 0.52
pct_ratio: 3.11
2.
6 / 500
1.8e-8
AGGATGAGATAGGAGGTCGGCACAAGATAC
small heat map img p-value: 1.00
pct_center: 0.10
pct_ratio: 0.47
3.
44 / 500
0.000077
CCTGAAAAAACAGGA
small heat map img p-value: 0.02
pct_center: 0.20
pct_ratio: 0.63
4.
11 / 500
0.00039
GGGTGTGTGACTTAACCCTTG
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.71
5.
6 / 500
0.0024
GATAGTGCCACTGCACTCCAGCCTGGGTGA
small heat map img p-value: 1.00
pct_center: 0.11
pct_ratio: 0.35
MEME output

T47D - Myers - ENCSR000BJS

1.
500 / 500
1.0e-771
AGGTCAGGGTGACCT
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 2.42
2.
8 / 500
2.8e-17
AGGCCATGCCGGACAAGGGTTAAGTCACAC
small heat map img p-value: 0.00
pct_center: 0.08
pct_ratio: 0.73
3.
37 / 500
7.8e-7
CCAGCCTGGGGCTGA
small heat map img p-value: 0.03
pct_center: 0.21
pct_ratio: 0.60
4.
8 / 500
0.036
GCTGAAAAAACAGAATGCAGTAAACAAGC
small heat map img p-value: 0.02
pct_center: 0.09
pct_ratio: 0.58
5.
30 / 500
0.056
AAACCCAGAAGGAAAGAATGC
small heat map img p-value: 0.01
pct_center: 0.17
pct_ratio: 0.55
MEME output

T47D - Myers - ENCSR000BKN

1.
500 / 500
1.0e-771
AGGTCAGGGTGACCT
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 2.43
2.
8 / 500
2.8e-17
AGGCCATGCCGGACAAGGGTTAAGTCACAC
small heat map img p-value: 0.00
pct_center: 0.08
pct_ratio: 0.74
3.
37 / 500
7.8e-7
CCAGCCTGGGGCTGA
small heat map img p-value: 0.02
pct_center: 0.21
pct_ratio: 0.60
4.
8 / 500
0.036
GCTGAAAAAACAGAATGCAGTAAACAAGC
small heat map img p-value: 0.05
pct_center: 0.09
pct_ratio: 0.58
5.
30 / 500
0.056
AAACCCAGAAGGAAAGAATGC
small heat map img p-value: 0.01
pct_center: 0.17
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at ESR1 peaks

Ishikawa - Myers - ENCSR000BIY

Ishikawa
Myers
ESR1
ENCSR000BIY
r=1.00

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BKL
r=0.76

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BQR
r=0.57

small heat map img
10,000 randomly-selected peaks from a total of 16,091 (download )

Ishikawa - Myers - ENCSR000BKL

Ishikawa
Myers
ESR1
ENCSR000BKL
r=1.00

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BIY
r=0.78

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BQR
r=0.59

small heat map img
10,000 randomly-selected peaks from a total of 11,452 (download )

Ishikawa - Myers - ENCSR000BQR

Ishikawa
Myers
ESR1
ENCSR000BQR
r=1.00

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BKL
r=0.70

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BIY
r=0.69

small heat map img
4,260 peaks (download )

T47D - Myers - ENCSR000BJS

T47D
Myers
ESR1
ENCSR000BJS
r=1.00

small heat map img

T47D
Myers
ESR1
ENCSR000BKN
r=0.90

small heat map img

T47D
Myers
ESR1
ENCSR000BQD
r=0.69

small heat map img
10,000 randomly-selected peaks from a total of 10,547 (download )

T47D - Myers - ENCSR000BKN

T47D
Myers
ESR1
ENCSR000BKN
r=1.00

small heat map img

T47D
Myers
ESR1
ENCSR000BJS
r=0.90

small heat map img

T47D
Myers
ESR1
ENCSR000BQD
r=0.66

small heat map img
10,000 randomly-selected peaks from a total of 10,505 (download )

T47D - Myers - ENCSR000BQD

T47D
Myers
ESR1
ENCSR000BQD
r=1.00

small heat map img

T47D
Myers
ESR1
ENCSR000BJS
r=0.79

small heat map img

T47D
Myers
ESR1
ENCSR000BKN
r=0.76

small heat map img
3,902 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at ESR1 peaks

Ishikawa - Myers - ENCSR000BIY

Ishikawa
Myers
ESR1
ENCSR000BIY
r=1.00

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BKL
r=0.76

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BQR
r=0.57

small heat map img

Ishikawa
Myers
EP300
ENCSR000BUE
r=0.52

small heat map img

Ishikawa
Myers
TCF12
ENCSR000BUV
r=0.49

small heat map img

Ishikawa
Myers
NFIC
ENCSR000BUT
r=0.47

small heat map img

Ishikawa
Myers
TEAD4
ENCSR000BSW
r=0.47

small heat map img

Ishikawa
Myers
FOXM1
ENCSR000BUS
r=0.45

small heat map img

Ishikawa
Myers
CEBPB
ENCSR000BTT
r=0.39

small heat map img

Ishikawa
Myers
NR3C1
ENCSR000BJC
r=0.39

small heat map img

Ishikawa
Myers
MAX
ENCSR000BTY
r=0.39

small heat map img

Ishikawa
Myers
RAD21
ENCSR000BTU
r=0.38

small heat map img

Ishikawa
Myers
SRF
ENCSR000BTD
r=0.37

small heat map img

Ishikawa
Myers
YY1
ENCSR000BSY
r=0.36

small heat map img

Ishikawa
Myers
USF1
ENCSR000BSX
r=0.34

small heat map img

Ishikawa
Myers
EGR1
ENCSR000BSQ
r=0.28

small heat map img

Ishikawa
Myers
ZBTB7A
ENCSR000BSZ
r=0.26

small heat map img

Ishikawa
Myers
TAF1
ENCSR000BTO
r=0.25

small heat map img

Ishikawa
Myers
CREB1
ENCSR000BUR
r=0.24

small heat map img

Ishikawa
Myers
REST
ENCSR000BUU
r=0.19

small heat map img

Ishikawa
Myers
FOXA1
ENCSR000BKW
r=0.15

small heat map img

Ishikawa
Myers
POLR2A
ENCSR000BKI
r=0.13

small heat map img

Ishikawa
Myers
CTCF
ENCSR000BQE
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 16,091 (download )

Ishikawa - Myers - ENCSR000BKL

Ishikawa
Myers
ESR1
ENCSR000BKL
r=1.00

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BIY
r=0.78

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BQR
r=0.59

small heat map img

Ishikawa
Myers
EP300
ENCSR000BUE
r=0.45

small heat map img

Ishikawa
Myers
TCF12
ENCSR000BUV
r=0.42

small heat map img

Ishikawa
Myers
TEAD4
ENCSR000BSW
r=0.41

small heat map img

Ishikawa
Myers
FOXM1
ENCSR000BUS
r=0.41

small heat map img

Ishikawa
Myers
NFIC
ENCSR000BUT
r=0.41

small heat map img

Ishikawa
Myers
NR3C1
ENCSR000BJC
r=0.35

small heat map img

Ishikawa
Myers
CEBPB
ENCSR000BTT
r=0.35

small heat map img

Ishikawa
Myers
RAD21
ENCSR000BTU
r=0.33

small heat map img

Ishikawa
Myers
MAX
ENCSR000BTY
r=0.33

small heat map img

Ishikawa
Myers
SRF
ENCSR000BTD
r=0.32

small heat map img

Ishikawa
Myers
YY1
ENCSR000BSY
r=0.31

small heat map img

Ishikawa
Myers
USF1
ENCSR000BSX
r=0.27

small heat map img

Ishikawa
Myers
EGR1
ENCSR000BSQ
r=0.23

small heat map img

Ishikawa
Myers
CREB1
ENCSR000BUR
r=0.22

small heat map img

Ishikawa
Myers
ZBTB7A
ENCSR000BSZ
r=0.21

small heat map img

Ishikawa
Myers
TAF1
ENCSR000BTO
r=0.21

small heat map img

Ishikawa
Myers
REST
ENCSR000BUU
r=0.16

small heat map img

Ishikawa
Myers
FOXA1
ENCSR000BKW
r=0.16

small heat map img

Ishikawa
Myers
POLR2A
ENCSR000BKI
r=0.10

small heat map img

Ishikawa
Myers
CTCF
ENCSR000BQE
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 11,452 (download )

Ishikawa - Myers - ENCSR000BQR

Ishikawa
Myers
ESR1
ENCSR000BQR
r=1.00

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BKL
r=0.70

small heat map img

Ishikawa
Myers
ESR1
ENCSR000BIY
r=0.69

small heat map img

Ishikawa
Myers
EP300
ENCSR000BUE
r=0.55

small heat map img

Ishikawa
Myers
TEAD4
ENCSR000BSW
r=0.53

small heat map img

Ishikawa
Myers
FOXM1
ENCSR000BUS
r=0.51

small heat map img

Ishikawa
Myers
NFIC
ENCSR000BUT
r=0.51

small heat map img

Ishikawa
Myers
TCF12
ENCSR000BUV
r=0.50

small heat map img

Ishikawa
Myers
NR3C1
ENCSR000BJC
r=0.45

small heat map img

Ishikawa
Myers
CEBPB
ENCSR000BTT
r=0.44

small heat map img

Ishikawa
Myers
RAD21
ENCSR000BTU
r=0.40

small heat map img

Ishikawa
Myers
SRF
ENCSR000BTD
r=0.39

small heat map img

Ishikawa
Myers
MAX
ENCSR000BTY
r=0.38

small heat map img

Ishikawa
Myers
YY1
ENCSR000BSY
r=0.37

small heat map img

Ishikawa
Myers
USF1
ENCSR000BSX
r=0.33

small heat map img

Ishikawa
Myers
EGR1
ENCSR000BSQ
r=0.27

small heat map img

Ishikawa
Myers
CREB1
ENCSR000BUR
r=0.27

small heat map img

Ishikawa
Myers
TAF1
ENCSR000BTO
r=0.23

small heat map img

Ishikawa
Myers
ZBTB7A
ENCSR000BSZ
r=0.23

small heat map img

Ishikawa
Myers
FOXA1
ENCSR000BKW
r=0.22

small heat map img

Ishikawa
Myers
REST
ENCSR000BUU
r=0.19

small heat map img

Ishikawa
Myers
POLR2A
ENCSR000BKI
r=0.12

small heat map img

Ishikawa
Myers
CTCF
ENCSR000BQE
r=0.02

small heat map img
4,260 peaks (download )

T47D - Myers - ENCSR000BJS

T47D
Myers
ESR1
ENCSR000BJS
r=1.00

small heat map img

T47D
Myers
ESR1
ENCSR000BKN
r=0.90

small heat map img

T47D
Myers
ESR1
ENCSR000BQD
r=0.69

small heat map img

T47D
Myers
EP300
ENCSR000BLM
r=0.53

small heat map img

T47D
Myers
GATA3
ENCSR000BMX
r=0.53

small heat map img

T47D
Myers
FOXA1
ENCSR000BKY
r=0.45

small heat map img

T47D
Myers
JUND
ENCSR000BVO
r=0.43

small heat map img

T47D
Myers
CTCF
ENCSR000BNO
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 10,547 (download )

T47D - Myers - ENCSR000BKN

T47D
Myers
ESR1
ENCSR000BKN
r=1.00

small heat map img

T47D
Myers
ESR1
ENCSR000BJS
r=0.90

small heat map img

T47D
Myers
ESR1
ENCSR000BQD
r=0.66

small heat map img

T47D
Myers
GATA3
ENCSR000BMX
r=0.48

small heat map img

T47D
Myers
EP300
ENCSR000BLM
r=0.47

small heat map img

T47D
Myers
FOXA1
ENCSR000BKY
r=0.41

small heat map img

T47D
Myers
JUND
ENCSR000BVO
r=0.38

small heat map img

T47D
Myers
CTCF
ENCSR000BNO
r=0.00

small heat map img
10,000 randomly-selected peaks from a total of 10,505 (download )

T47D - Myers - ENCSR000BQD

T47D
Myers
ESR1
ENCSR000BQD
r=1.00

small heat map img

T47D
Myers
ESR1
ENCSR000BJS
r=0.79

small heat map img

T47D
Myers
ESR1
ENCSR000BKN
r=0.76

small heat map img

T47D
Myers
GATA3
ENCSR000BMX
r=0.54

small heat map img

T47D
Myers
EP300
ENCSR000BLM
r=0.52

small heat map img

T47D
Myers
FOXA1
ENCSR000BKY
r=0.45

small heat map img

T47D
Myers
JUND
ENCSR000BVO
r=0.42

small heat map img

T47D
Myers
CTCF
ENCSR000BNO
r=0.02

small heat map img
3,902 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help