E2F6

This gene encodes a member of a family of transcription factors that play a crucial role in the control of the cell cycle. The protein encoded by this gene lacks the transactivation and tumor suppressor protein association domains found in other family members, and contains a modular suppression domain that functions in the inhibition of transcription. It interacts in a complex with chromatin modifying factors. There are pseudogenes for this gene on chromosomes 22 and X. Alternative splicing results in multiple transcript variants. RefSeq, May 2013
E2F is a group of genes that codifies a family of transcription factors (TF) in higher eukaryotes. Three of them are activators: E2F1, 2 and E2F3a.wikipedia

E2F6


ENCODE experiments
Ensemble search
Entrez 1876
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia E2F

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

A549 - Myers - ENCSR000BTC

loading

H1-hESC - Myers - ENCSR000BSI

loading

HeLa-S3 - Farnham - ENCSR000EVK

loading

K562 - Farnham - ENCSR000EWJ

loading

K562 - Myers - ENCSR000BLI

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

A549 - Myers - ENCSR000BTC

1.
81 / 500
1.5e-29
GAGAGCAAGAGGCACATGAGGGAGGAAAA
small heat map img p-value: 0.00
pct_center: 0.47
pct_ratio: 0.51
2.
79 / 500
3.1e-10
GGCGGGGGGCGGGCGGGAGGGGGCGGGGCC
small heat map img p-value: 0.00
pct_center: 0.92
pct_ratio: 0.69
3.
23 / 500
0.000069
TGGTAAGGGCTTCTGGGAACTTGGGTTT
small heat map img p-value: 0.99
pct_center: 0.07
pct_ratio: 0.38
4.
40 / 500
0.018
GCGCAGGCGCA
small heat map img p-value: 0.00
pct_center: 0.44
pct_ratio: 0.75
5.
11 / 500
76
TTATGGCTGCAAAGGATAAAGCTCTTTCT
small heat map img p-value: 0.59
pct_center: 0.08
pct_ratio: 0.50
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Myers - ENCSR000BSI

1.
44 / 500
7.3e-29
TGTTAATTTTTTTTTTAAAAT
small heat map img p-value: 0.64
pct_center: 0.05
pct_ratio: 0.21
2.
109 / 500
2.3e-45
GGGGGCGGAGGCGGCGGGAGGGGGGGGGG
small heat map img p-value: 0.00
pct_center: 0.82
pct_ratio: 0.75
3.
23 / 500
0.0000028
TAGAAAACAAAAATT
small heat map img p-value: 0.01
pct_center: 0.07
pct_ratio: 0.24
4.
9 / 500
7.9
AATAATTTTCATAAAGAAGTC
small heat map img p-value: 0.53
pct_center: 0.02
pct_ratio: 0.29
5.
8 / 500
1.6e+2
CAGCCAATCAGAGAGCGCAG
small heat map img p-value: 0.59
pct_center: 0.11
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Farnham - ENCSR000EVK

1.
287 / 500
9.8e-202
GGGGCGGGAAA
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 0.73
2.
128 / 500
1.0e-32
AGCACGTG
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 1.38
3.
46 / 500
1.2e-12
TGCGCATGCGCGGT
small heat map img p-value: 0.00
pct_center: 0.48
pct_ratio: 0.80
4.
24 / 500
2.5e-7
CTCTGATTGGCTGG
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.77
5.
10 / 500
2.6e+3
TTGTTTTGGT
small heat map img p-value: 0.36
pct_center: 0.02
pct_ratio: 0.19
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Farnham - ENCSR000EWJ

1.
323 / 500
8.1e-202
GGGGCGGGAAG
small heat map img p-value: 0.00
pct_center: 0.49
pct_ratio: 0.75
2.
242 / 500
6.4e-69
GGCACGTGGCC
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 1.61
3.
56 / 500
3.6e-16
CGCGCATGCGCAGA
small heat map img p-value: 0.00
pct_center: 0.37
pct_ratio: 0.87
4.
19 / 500
0.0000013
CGCTCTGATTGGCTG
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.77
5.
22 / 500
1.1
GAGAAGAAAAA
small heat map img p-value: 0.17
pct_center: 0.12
pct_ratio: 0.36
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Myers - ENCSR000BLI

1.
371 / 500
8.0e-244
GGGGCGGGAAG
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 0.82
2.
150 / 500
1.9e-53
GCGCACGTGGC
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 1.71
3.
23 / 500
3.3e-13
CGCGCTGATTGGCTG
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.76
4.
42 / 500
5.4e-10
GCGCATGCGCA
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.89
5.
22 / 500
1.7e+2
AGAGAAGAGCT
small heat map img p-value: 0.86
pct_center: 0.09
pct_ratio: 0.42
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at E2F6 peaks

A549 - Myers - ENCSR000BTC

A549
Myers
E2F6
ENCSR000BTC
r=1.00

small heat map img

A549
Myers
H2AFZ
ENCSR000AUG
r=0.39

small heat map img

A549
Myers
H2AFZ
ENCSR000AUH
r=0.38

small heat map img

A549
Myers
H3K4me3
ENCSR000ASH
r=0.35

small heat map img

A549
Myers
H3K4me3
ENCSR000AST
r=0.34

small heat map img

A549
Myers
H3K4me2
ENCSR000AVI
r=0.33

small heat map img

A549
Myers
H3K27ac
ENCSR000AVF
r=0.33

small heat map img

A549
Myers
H3K9ac
ENCSR000ASV
r=0.33

small heat map img

A549
Myers
H3K4me3
ENCSR000DPD
r=0.33

small heat map img

A549
Myers
H3K4me2
ENCSR000ATO
r=0.32

small heat map img

A549
Myers
H3K27ac
ENCSR000AUI
r=0.30

small heat map img

A549
Myers
H3K4me1
ENCSR000AUM
r=0.13

small heat map img

A549
Myers
H3K4me1
ENCSR000AVH
r=0.13

small heat map img

A549
Myers
H3K79me2
ENCSR000ATP
r=0.07

small heat map img

A549
Myers
H3K79me2
ENCSR000ASU
r=0.07

small heat map img

A549
Myers
H3K9me3
ENCSR000AUN
r=0.06

small heat map img

A549
Myers
H3K27me3
ENCSR000AUK
r=0.01

small heat map img

A549
Myers
H3K36me3
ENCSR000AUL
r=-0.02

small heat map img

A549
Myers
H3K36me3
ENCSR000AVG
r=-0.02

small heat map img

A549
Myers
H4K20me1
ENCSR000AUO
r=-0.02

small heat map img

A549
Myers
H3K27me3
ENCSR000AUJ
r=-0.03

small heat map img
6,791 peaks (download )

H1-hESC - Myers - ENCSR000BSI

H1-hESC
Myers
E2F6
ENCSR000BSI
r=1.00

small heat map img

H1-hESC
Myers
H3K4me2
ENCSR000ANC
r=0.33

small heat map img

H1-hESC
Myers
H3K4me3
ENCSR000AMG
r=0.30

small heat map img

H1-hESC
Myers
H2AFZ
ENCSR000APX
r=0.28

small heat map img

H1-hESC
Myers
H3K9ac
ENCSR000AND
r=0.27

small heat map img

H1-hESC
Myers
H3K4me1
ENCSR000ANA
r=0.21

small heat map img

H1-hESC
Myers
H3K27ac
ENCSR000ANP
r=0.20

small heat map img

H1-hESC
Myers
H3K27me3
ENCSR000ALU
r=0.16

small heat map img

H1-hESC
Myers
H4K20me1
ENCSR000AMH
r=0.06

small heat map img

H1-hESC
Myers
H3K79me2
ENCSR000APY
r=0.01

small heat map img

H1-hESC
Myers
H3K9me3
ENCSR000APZ
r=0.00

small heat map img

H1-hESC
Myers
H3K36me3
ENCSR000ANB
r=-0.05

small heat map img
10,000 randomly-selected peaks from a total of 12,733 (download )

HeLa-S3 - Farnham - ENCSR000EVK

HeLa-S3
Farnham
E2F6
ENCSR000EVK
r=1.00

small heat map img

HeLa-S3
Farnham
H3K4me3
ENCSR000AOF
r=0.49

small heat map img

HeLa-S3
Farnham
H2AFZ
ENCSR000AQN
r=0.49

small heat map img

HeLa-S3
Farnham
H3K9ac
ENCSR000AOH
r=0.48

small heat map img

HeLa-S3
Farnham
H3K4me3
ENCSR000DUA
r=0.46

small heat map img

HeLa-S3
Farnham
H3K27ac
ENCSR000AOC
r=0.44

small heat map img

HeLa-S3
Farnham
H3K4me2
ENCSR000AOE
r=0.39

small heat map img

HeLa-S3
Farnham
H3K4me1
ENCSR000APW
r=0.13

small heat map img

HeLa-S3
Farnham
H3K79me2
ENCSR000AOG
r=0.09

small heat map img

HeLa-S3
Farnham
H3K27me3
ENCSR000DTY
r=0.06

small heat map img

HeLa-S3
Farnham
H3K9me3
ENCSR000AQO
r=-0.03

small heat map img

HeLa-S3
Farnham
H4K20me1
ENCSR000AOI
r=-0.05

small heat map img

HeLa-S3
Farnham
H3K36me3
ENCSR000DTZ
r=-0.06

small heat map img

HeLa-S3
Farnham
H3K27me3
ENCSR000APB
r=-0.06

small heat map img

HeLa-S3
Farnham
H3K36me3
ENCSR000AOD
r=-0.17

small heat map img
4,775 peaks (download )

K562 - Farnham - ENCSR000EWJ

K562
Farnham
E2F6
ENCSR000EWJ
r=1.00

small heat map img

K562
Farnham
E2F6
ENCSR000BLI
r=0.63

small heat map img

K562
Farnham
H2AFZ
ENCSR000APC
r=0.41

small heat map img

K562
Farnham
H3K9ac
ENCSR000EVZ
r=0.41

small heat map img

K562
Farnham
H3K4me2
ENCSR000AKT
r=0.40

small heat map img

K562
Farnham
H3K4me3
ENCSR000AKU
r=0.40

small heat map img

K562
Farnham
H3K9ac
ENCSR000AKV
r=0.39

small heat map img

K562
Farnham
H3K4me3
ENCSR000DWD
r=0.38

small heat map img

K562
Farnham
H3K27ac
ENCSR000AKP
r=0.36

small heat map img

K562
Farnham
H3K4me3
ENCSR000EWA
r=0.36

small heat map img

K562
Farnham
H3K4me1
ENCSR000EWC
r=0.25

small heat map img

K562
Farnham
H3K79me2
ENCSR000APD
r=0.16

small heat map img

K562
Farnham
H3K4me1
ENCSR000AKS
r=0.13

small heat map img

K562
Farnham
H4K20me1
ENCSR000AKX
r=0.07

small heat map img

K562
Farnham
H3K9me1
ENCSR000AKW
r=0.06

small heat map img

K562
Farnham
H3K9me3
ENCSR000APE
r=0.05

small heat map img

K562
Farnham
H3K27me3
ENCSR000DWC
r=0.01

small heat map img

K562
Farnham
H3K27me3
ENCSR000AKQ
r=0.01

small heat map img

K562
Farnham
H3K36me3
ENCSR000AKR
r=-0.02

small heat map img

K562
Farnham
H3K36me3
ENCSR000DWB
r=-0.03

small heat map img

K562
Farnham
H3K27me3
ENCSR000EWB
r=-0.05

small heat map img
10,000 randomly-selected peaks from a total of 16,312 (download )

K562 - Myers - ENCSR000BLI

K562
Myers
E2F6
ENCSR000BLI
r=1.00

small heat map img

K562
Myers
E2F6
ENCSR000EWJ
r=0.61

small heat map img

K562
Myers
H2AFZ
ENCSR000APC
r=0.23

small heat map img

K562
Myers
H3K9ac
ENCSR000EVZ
r=0.23

small heat map img

K562
Myers
H3K4me3
ENCSR000AKU
r=0.22

small heat map img

K562
Myers
H3K9ac
ENCSR000AKV
r=0.22

small heat map img

K562
Myers
H3K4me2
ENCSR000AKT
r=0.22

small heat map img

K562
Myers
H3K4me3
ENCSR000DWD
r=0.21

small heat map img

K562
Myers
H3K4me3
ENCSR000EWA
r=0.20

small heat map img

K562
Myers
H3K27ac
ENCSR000AKP
r=0.20

small heat map img

K562
Myers
H3K4me1
ENCSR000EWC
r=0.14

small heat map img

K562
Myers
H3K79me2
ENCSR000APD
r=0.10

small heat map img

K562
Myers
H3K4me1
ENCSR000AKS
r=0.08

small heat map img

K562
Myers
H3K9me3
ENCSR000APE
r=0.03

small heat map img

K562
Myers
H4K20me1
ENCSR000AKX
r=0.03

small heat map img

K562
Myers
H3K9me1
ENCSR000AKW
r=0.03

small heat map img

K562
Myers
H3K36me3
ENCSR000AKR
r=0.01

small heat map img

K562
Myers
H3K27me3
ENCSR000DWC
r=-0.01

small heat map img

K562
Myers
H3K36me3
ENCSR000DWB
r=-0.01

small heat map img

K562
Myers
H3K27me3
ENCSR000AKQ
r=-0.02

small heat map img

K562
Myers
H3K27me3
ENCSR000EWB
r=-0.06

small heat map img
10,000 randomly-selected peaks from a total of 24,570 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at E2F6 peaks

A549 - Myers - ENCSR000BTC

A549
Myers
E2F6
ENCSR000BTC
r=1.00

small heat map img

A549
Myers
MAX
ENCSR000BTJ
r=0.77

small heat map img

A549
Myers
MAX
ENCSR000DYG
r=0.73

small heat map img

A549
Myers
MYC
ENCSR000DYC
r=0.56

small heat map img

A549
Myers
SP1
ENCSR000BPE
r=0.46

small heat map img

A549
Myers
BHLHE40
ENCSR000DYJ
r=0.44

small heat map img

A549
Myers
CREB1
ENCSR000BRB
r=0.42

small heat map img

A549
Myers
POLR2A
ENCSR000DMZ
r=0.41

small heat map img

A549
Myers
PBX3
ENCSR000BTN
r=0.40

small heat map img

A549
Myers
TEAD4
ENCSR000BUD
r=0.40

small heat map img

A549
Myers
POLR2A
ENCSR000BHI
r=0.39

small heat map img

A549
Myers
GATA3
ENCSR000BTI
r=0.39

small heat map img

A549
Myers
POLR2A
ENCSR000BHH
r=0.38

small heat map img

A549
Myers
TAF1
ENCSR000BPF
r=0.38

small heat map img

A549
Myers
RAD21
ENCSR000DYE
r=0.36

small heat map img

A549
Myers
YY1
ENCSR000BPM
r=0.35

small heat map img

A549
Myers
CEBPB
ENCSR000BUB
r=0.34

small heat map img

A549
Myers
USF1
ENCSR000BHX
r=0.34

small heat map img

A549
Myers
REST
ENCSR000BQP
r=0.33

small heat map img

A549
Myers
RAD21
ENCSR000BUC
r=0.33

small heat map img

A549
Myers
SIN3A
ENCSR000BRM
r=0.32

small heat map img

A549
Myers
ETS1
ENCSR000BPU
r=0.31

small heat map img

A549
Myers
USF1
ENCSR000BJB
r=0.30

small heat map img

A549
Myers
NR3C1
ENCSR000BJR
r=0.30

small heat map img

A549
Myers
CTCF
ENCSR000DYD
r=0.30

small heat map img

A549
Myers
USF1
ENCSR000BPV
r=0.29

small heat map img

A549
Myers
GABPA
ENCSR000BPY
r=0.28

small heat map img

A549
Myers
SIX5
ENCSR000BRL
r=0.28

small heat map img

A549
Myers
TCF12
ENCSR000BQQ
r=0.28

small heat map img

A549
Myers
ZBTB33
ENCSR000BPZ
r=0.28

small heat map img

A549
Myers
CEBPB
ENCSR000DYI
r=0.27

small heat map img

A549
Myers
FOXA2
ENCSR000BRE
r=0.27

small heat map img

A549
Myers
ELF1
ENCSR000BPT
r=0.25

small heat map img

A549
Myers
CTCF
ENCSR000DNA
r=0.25

small heat map img

A549
Myers
FOSL2
ENCSR000BQO
r=0.24

small heat map img

A549
Myers
CTCF
ENCSR000AUF
r=0.22

small heat map img

A549
Myers
ATF3
ENCSR000BPS
r=0.22

small heat map img

A549
Myers
EP300
ENCSR000BPW
r=0.21

small heat map img

A549
Myers
JUND
ENCSR000BRF
r=0.21

small heat map img

A549
Myers
CTCF
ENCSR000AUE
r=0.20

small heat map img

A549
Myers
BCL3
ENCSR000BQH
r=0.20

small heat map img

A549
Myers
CTCF
ENCSR000BHV
r=0.18

small heat map img

A549
Myers
NR3C1
ENCSR000BHF
r=0.17

small heat map img

A549
Myers
CTCF
ENCSR000BHW
r=0.17

small heat map img

A549
Myers
CTCF
ENCSR000DPF
r=0.16

small heat map img

A549
Myers
NR3C1
ENCSR000BHE
r=0.10

small heat map img

A549
Myers
FOXA1
ENCSR000BPX
r=0.08

small heat map img

A549
Myers
NR3C1
ENCSR000BHG
r=0.08

small heat map img
6,791 peaks (download )

H1-hESC - Myers - ENCSR000BSI

H1-hESC
Myers
E2F6
ENCSR000BSI
r=1.00

small heat map img

H1-hESC
Myers
MAX
ENCSR000BSJ
r=0.81

small heat map img

H1-hESC
Myers
MAX
ENCSR000EUP
r=0.64

small heat map img

H1-hESC
Myers
MYC
ENCSR000EBY
r=0.47

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000AVB
r=0.46

small heat map img

H1-hESC
Myers
MXI1
ENCSR000EBR
r=0.44

small heat map img

H1-hESC
Myers
RBBP5
ENCSR000AQC
r=0.42

small heat map img

H1-hESC
Myers
CTBP2
ENCSR000EUO
r=0.41

small heat map img

H1-hESC
Myers
USF2
ENCSR000ECD
r=0.41

small heat map img

H1-hESC
Myers
KDM4A
ENCSR000AVC
r=0.40

small heat map img

H1-hESC
Myers
CREB1
ENCSR000BSN
r=0.40

small heat map img

H1-hESC
Myers
EP300
ENCSR000AUQ
r=0.39

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000EBO
r=0.38

small heat map img

H1-hESC
Myers
JUND
ENCSR000EBZ
r=0.36

small heat map img

H1-hESC
Myers
CHD7
ENCSR000AVA
r=0.36

small heat map img

H1-hESC
Myers
BACH1
ENCSR000EBQ
r=0.35

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000DLJ
r=0.34

small heat map img

H1-hESC
Myers
TEAD4
ENCSR000BRY
r=0.33

small heat map img

H1-hESC
Myers
ZNF143
ENCSR000EBW
r=0.33

small heat map img

H1-hESC
Myers
TBP
ENCSR000ECB
r=0.32

small heat map img

H1-hESC
Myers
PHF8
ENCSR000ATK
r=0.31

small heat map img

H1-hESC
Myers
RAD21
ENCSR000ECE
r=0.30

small heat map img

H1-hESC
Myers
CEBPB
ENCSR000EBV
r=0.30

small heat map img

H1-hESC
Myers
CTCF
ENCSR000DLK
r=0.29

small heat map img

H1-hESC
Myers
BRCA1
ENCSR000EBX
r=0.29

small heat map img

H1-hESC
Myers
USF1
ENCSR000BIU
r=0.29

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000ATS
r=0.29

small heat map img

H1-hESC
Myers
NRF1
ENCSR000ECC
r=0.28

small heat map img

H1-hESC
Myers
TAF1
ENCSR000BHO
r=0.28

small heat map img

H1-hESC
Myers
SIRT6
ENCSR000AUS
r=0.27

small heat map img

H1-hESC
Myers
HDAC6
ENCSR000ATQ
r=0.27

small heat map img

H1-hESC
Myers
GABPA
ENCSR000BIW
r=0.26

small heat map img

H1-hESC
Myers
YY1
ENCSR000BKD
r=0.26

small heat map img

H1-hESC
Myers
JUN
ENCSR000ECA
r=0.25

small heat map img

H1-hESC
Myers
CTCF
ENCSR000AMF
r=0.25

small heat map img

H1-hESC
Myers
POLR2A
ENCSR000BHN
r=0.23

small heat map img

H1-hESC
Myers
MYC
ENCSR000DLI
r=0.22

small heat map img

H1-hESC
Myers
KDM5B
ENCSR000AUR
r=0.22

small heat map img

H1-hESC
Myers
SP1
ENCSR000BIR
r=0.21

small heat map img

H1-hESC
Myers
MAFK
ENCSR000EBS
r=0.21

small heat map img

H1-hESC
Myers
CTCF
ENCSR000BNH
r=0.20

small heat map img

H1-hESC
Myers
RFX5
ENCSR000ECF
r=0.19

small heat map img

H1-hESC
Myers
RAD21
ENCSR000BLD
r=0.19

small heat map img

H1-hESC
Myers
SUZ12
ENCSR000EUQ
r=0.18

small heat map img

H1-hESC
Myers
CHD1
ENCSR000EBU
r=0.18

small heat map img

H1-hESC
Myers
EZH2
ENCSR000ASY
r=0.18

small heat map img

H1-hESC
Myers
SAP30
ENCSR000ATR
r=0.17

small heat map img

H1-hESC
Myers
KDM5A
ENCSR000AQL
r=0.17

small heat map img

H1-hESC
Myers
SIN3A
ENCSR000BIS
r=0.16

small heat map img

H1-hESC
Myers
ATF2
ENCSR000BQU
r=0.16

small heat map img

H1-hESC
Myers
SP4
ENCSR000BQV
r=0.15

small heat map img

H1-hESC
Myers
ATF3
ENCSR000BKC
r=0.14

small heat map img

H1-hESC
Myers
CHD1
ENCSR000AQK
r=0.12

small heat map img

H1-hESC
Myers
EGR1
ENCSR000BJA
r=0.12

small heat map img

H1-hESC
Myers
HDAC2
ENCSR000BNR
r=0.12

small heat map img

H1-hESC
Myers
TAF7
ENCSR000BLU
r=0.12

small heat map img

H1-hESC
Myers
JUND
ENCSR000BKP
r=0.12

small heat map img

H1-hESC
Myers
TCF12
ENCSR000BIT
r=0.11

small heat map img

H1-hESC
Myers
SP2
ENCSR000BQG
r=0.10

small heat map img

H1-hESC
Myers
FOSL1
ENCSR000BNS
r=0.10

small heat map img

H1-hESC
Myers
EP300
ENCSR000BKK
r=0.09

small heat map img

H1-hESC
Myers
SRF
ENCSR000BIV
r=0.09

small heat map img

H1-hESC
Myers
SIX5
ENCSR000BIQ
r=0.07

small heat map img

H1-hESC
Myers
REST
ENCSR000BHM
r=0.06

small heat map img

H1-hESC
Myers
NANOG
ENCSR000BMT
r=0.04

small heat map img

H1-hESC
Myers
RXRA
ENCSR000BJW
r=0.04

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BMJ
r=0.04

small heat map img

H1-hESC
Myers
BCL11A
ENCSR000BIP
r=0.02

small heat map img

H1-hESC
Myers
ZNF274
ENCSR000EUN
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 12,733 (download )

HeLa-S3 - Farnham - ENCSR000EVK

HeLa-S3
Farnham
E2F6
ENCSR000EVK
r=1.00

small heat map img

HeLa-S3
Farnham
MAX
ENCSR000ECN
r=0.74

small heat map img

HeLa-S3
Farnham
MYC
ENCSR000EZD
r=0.67

small heat map img

HeLa-S3
Farnham
MAX
ENCSR000EZF
r=0.67

small heat map img

HeLa-S3
Farnham
E2F4
ENCSR000EVL
r=0.62

small heat map img

HeLa-S3
Farnham
E2F1
ENCSR000EVJ
r=0.59

small heat map img

HeLa-S3
Farnham
MXI1
ENCSR000ECU
r=0.59

small heat map img

HeLa-S3
Farnham
MYC
ENCSR000DLN
r=0.58

small heat map img

HeLa-S3
Farnham
SMARCB1
ENCSR000EDK
r=0.56

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000EZL
r=0.55

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000DLM
r=0.55

small heat map img

HeLa-S3
Farnham
RCOR1
ENCSR000ECM
r=0.53

small heat map img

HeLa-S3
Farnham
ZKSCAN1
ENCSR000ECJ
r=0.52

small heat map img

HeLa-S3
Farnham
ELK1
ENCSR000ECI
r=0.52

small heat map img

HeLa-S3
Farnham
HCFC1
ENCSR000ECH
r=0.50

small heat map img

HeLa-S3
Farnham
SMC3
ENCSR000ECS
r=0.44

small heat map img

HeLa-S3
Farnham
POLR2A
ENCSR000BGO
r=0.43

small heat map img

HeLa-S3
Farnham
MAFK
ENCSR000ECK
r=0.43

small heat map img

HeLa-S3
Farnham
STAT1
ENCSR000EZK
r=0.42

small heat map img

HeLa-S3
Farnham
KAT2A
ENCSR000ECR
r=0.39

small heat map img

HeLa-S3
Farnham
ZNF143
ENCSR000ECO
r=0.38

small heat map img

HeLa-S3
Farnham
BRCA1
ENCSR000EDB
r=0.37

small heat map img

HeLa-S3
Farnham
RFX5
ENCSR000ECX
r=0.37

small heat map img

HeLa-S3
Farnham
ELK4
ENCSR000EVI
r=0.36

small heat map img

HeLa-S3
Farnham
TCF7L2
ENCSR000EVE
r=0.35

small heat map img

HeLa-S3
Farnham
SMARCC1
ENCSR000EDM
r=0.35

small heat map img

HeLa-S3
Farnham
FOS
ENCSR000EZE
r=0.34

small heat map img

HeLa-S3
Farnham
NFYA
ENCSR000DNS
r=0.33

small heat map img

HeLa-S3
Farnham
USF2
ENCSR000ECW
r=0.32

small heat map img

HeLa-S3
Farnham
SMARCC2
ENCSR000EDL
r=0.31

small heat map img

HeLa-S3
Farnham
NRF1
ENCSR000EDJ
r=0.30

small heat map img

HeLa-S3
Farnham
CEBPB
ENCSR000EDA
r=0.27

small heat map img

HeLa-S3
Farnham
NR2C2
ENCSR000EVN
r=0.27

small heat map img

HeLa-S3
Farnham
TBP
ENCSR000EDD
r=0.26

small heat map img

HeLa-S3
Farnham
JUND
ENCSR000EDH
r=0.26

small heat map img

HeLa-S3
Farnham
SMARCA4
ENCSR000EZC
r=0.25

small heat map img

HeLa-S3
Farnham
TAF1
ENCSR000BHT
r=0.25

small heat map img

HeLa-S3
Farnham
NFYB
ENCSR000DNR
r=0.23

small heat map img

HeLa-S3
Farnham
GABPA
ENCSR000BHS
r=0.23

small heat map img

HeLa-S3
Farnham
TCF7L2
ENCSR000EVF
r=0.23

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000DLO
r=0.23

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000DUB
r=0.20

small heat map img

HeLa-S3
Farnham
RAD21
ENCSR000EDE
r=0.20

small heat map img

HeLa-S3
Farnham
JUN
ENCSR000EDG
r=0.17

small heat map img

HeLa-S3
Farnham
ZNF274
ENCSR000EVG
r=0.16

small heat map img

HeLa-S3
Farnham
CTCF
ENCSR000AOA
r=0.15

small heat map img

HeLa-S3
Farnham
PRDM1
ENCSR000ECY
r=0.15

small heat map img

HeLa-S3
Farnham
STAT3
ENCSR000EDC
r=0.14

small heat map img

HeLa-S3
Farnham
IRF3
ENCSR000EDF
r=0.14

small heat map img

HeLa-S3
Farnham
SUPT20H
ENCSR000ECQ
r=0.14

small heat map img

HeLa-S3
Farnham
EP300
ENCSR000ECV
r=0.12

small heat map img

HeLa-S3
Farnham
REST
ENCSR000BMN
r=0.09

small heat map img

HeLa-S3
Farnham
EZH2
ENCSR000ATC
r=0.07

small heat map img

HeLa-S3
Farnham
BRF2
ENCSR000DNV
r=0.00

small heat map img

HeLa-S3
Farnham
POLR3A
ENCSR000DNU
r=-0.01

small heat map img

HeLa-S3
Farnham
GTF3C2
ENCSR000DNY
r=-0.04

small heat map img

HeLa-S3
Farnham
ZZZ3
ENCSR000DNT
r=-0.10

small heat map img

HeLa-S3
Farnham
BDP1
ENCSR000DNX
r=-0.10

small heat map img

HeLa-S3
Farnham
BRF1
ENCSR000DNW
r=-0.20

small heat map img
4,775 peaks (download )

K562 - Farnham - ENCSR000EWJ

K562
Farnham
E2F6
ENCSR000EWJ
r=1.00

small heat map img

K562
Farnham
MAX
ENCSR000EFV
r=0.76

small heat map img

K562
Farnham
MAX
ENCSR000BLP
r=0.71

small heat map img

K562
Farnham
MAX
ENCSR000FAE
r=0.69

small heat map img

K562
Farnham
MYC
ENCSR000EGJ
r=0.67

small heat map img

K562
Farnham
MYC
ENCSR000EGS
r=0.66

small heat map img

K562
Farnham
MYC
ENCSR000FAG
r=0.64

small heat map img

K562
Farnham
E2F4
ENCSR000EWL
r=0.64

small heat map img

K562
Farnham
E2F6
ENCSR000BLI
r=0.63

small heat map img

K562
Farnham
MYC
ENCSR000DLZ
r=0.63

small heat map img

K562
Farnham
MYC
ENCSR000EZU
r=0.63

small heat map img

K562
Farnham
MYC
ENCSR000EZV
r=0.61

small heat map img

K562
Farnham
MYC
ENCSR000FAZ
r=0.61

small heat map img

K562
Farnham
SETDB1
ENCSR000EWI
r=0.60

small heat map img

K562
Farnham
HMGN3
ENCSR000DOB
r=0.58

small heat map img

K562
Farnham
JUN
ENCSR000EFS
r=0.55

small heat map img

K562
Farnham
CCNT2
ENCSR000DOA
r=0.55

small heat map img

K562
Farnham
BHLHE40
ENCSR000EGV
r=0.53

small heat map img

K562
Farnham
CBX3
ENCSR000BRT
r=0.51

small heat map img

K562
Farnham
POLR2A
ENCSR000DLY
r=0.50

small heat map img

K562
Farnham
MXI1
ENCSR000EGZ
r=0.50

small heat map img

K562
Farnham
RCOR1
ENCSR000EGG
r=0.49

small heat map img

K562
Farnham
TBL1XR1
ENCSR000EGA
r=0.48

small heat map img

K562
Farnham
SETDB1
ENCSR000AUT
r=0.48

small heat map img

K562
Farnham
POLR2A
ENCSR000FAW
r=0.47

small heat map img

K562
Farnham
POLR2A
ENCSR000FAJ
r=0.47

small heat map img

K562
Farnham
HDAC1
ENCSR000AQF
r=0.47

small heat map img

K562
Farnham
KDM5B
ENCSR000AQA
r=0.47

small heat map img

K562
Farnham
RBBP5
ENCSR000AQI
r=0.47

small heat map img

K562
Farnham
HDAC2
ENCSR000AQG
r=0.46

small heat map img

K562
Farnham
ZMIZ1
ENCSR000EFQ
r=0.46

small heat map img

K562
Farnham
POLR2A
ENCSR000FAY
r=0.46

small heat map img

K562
Farnham
JUN
ENCSR000FAH
r=0.45

small heat map img

K562
Farnham
JUND
ENCSR000EGN
r=0.45

small heat map img

K562
Farnham
POLR2A
ENCSR000EHP
r=0.44

small heat map img

K562
Farnham
POLR2A
ENCSR000FAX
r=0.44

small heat map img

K562
Farnham
CREB1
ENCSR000BSO
r=0.44

small heat map img

K562
Farnham
PHF8
ENCSR000AQH
r=0.44

small heat map img

K562
Farnham
IRF1
ENCSR000EGK
r=0.44

small heat map img

K562
Farnham
STAT1
ENCSR000EHJ
r=0.43

small heat map img

K562
Farnham
STAT2
ENCSR000FAT
r=0.43

small heat map img

K562
Farnham
IRF1
ENCSR000EGL
r=0.42

small heat map img

K562
Farnham
JUN
ENCSR000EGH
r=0.42

small heat map img

K562
Farnham
RCOR1
ENCSR000EGC
r=0.42

small heat map img

K562
Farnham
SAP30
ENCSR000AQJ
r=0.41

small heat map img

K562
Farnham
POLR2A
ENCSR000BMR
r=0.41

small heat map img

K562
Farnham
TBL1XR1
ENCSR000EGB
r=0.41

small heat map img

K562
Farnham
ELK1
ENCSR000EFU
r=0.41

small heat map img

K562
Farnham
IRF1
ENCSR000EGT
r=0.40

small heat map img

K562
Farnham
CHD7
ENCSR000AVD
r=0.40

small heat map img

K562
Farnham
TRIM28
ENCSR000BRW
r=0.40

small heat map img

K562
Farnham
SMC3
ENCSR000EGW
r=0.39

small heat map img

K562
Farnham
YY1
ENCSR000BKU
r=0.39

small heat map img

K562
Farnham
HDAC6
ENCSR000ATJ
r=0.39

small heat map img

K562
Farnham
RNF2
ENCSR000AUA
r=0.38

small heat map img

K562
Farnham
HCFC1
ENCSR000EFN
r=0.38

small heat map img

K562
Farnham
TAF1
ENCSR000BKS
r=0.38

small heat map img

K562
Farnham
ATF3
ENCSR000BNU
r=0.38

small heat map img

K562
Farnham
ELF1
ENCSR000BMD
r=0.38

small heat map img

K562
Farnham
GTF2B
ENCSR000DOE
r=0.37

small heat map img

K562
Farnham
EP300
ENCSR000EGE
r=0.37

small heat map img

K562
Farnham
ATF1
ENCSR000DNZ
r=0.37

small heat map img

K562
Farnham
KAT2B
ENCSR000ATZ
r=0.37

small heat map img

K562
Farnham
ZNF263
ENCSR000EWN
r=0.36

small heat map img

K562
Farnham
STAT1
ENCSR000EHK
r=0.36

small heat map img

K562
Farnham
TBP
ENCSR000EHA
r=0.36

small heat map img

K562
Farnham
USF1
ENCSR000BKT
r=0.36

small heat map img

K562
Farnham
POLR2A
ENCSR000EHL
r=0.36

small heat map img

K562
Farnham
GATA1
ENCSR000EFT
r=0.35

small heat map img

K562
Farnham
ATF3
ENCSR000DOG
r=0.35

small heat map img

K562
Farnham
STAT1
ENCSR000FAU
r=0.34

small heat map img

K562
Farnham
CBX3
ENCSR000ATV
r=0.33

small heat map img

K562
Farnham
CEBPD
ENCSR000BVY
r=0.33

small heat map img

K562
Farnham
UBTF
ENCSR000EFZ
r=0.33

small heat map img

K562
Farnham
WHSC1
ENCSR000AVE
r=0.32

small heat map img

K562
Farnham
STAT1
ENCSR000FAV
r=0.32

small heat map img

K562
Farnham
EGR1
ENCSR000BNE
r=0.32

small heat map img

K562
Farnham
ETS1
ENCSR000BKQ
r=0.32

small heat map img

K562
Farnham
NFE2
ENCSR000FAF
r=0.31

small heat map img

K562
Farnham
STAT2
ENCSR000FBC
r=0.30

small heat map img

K562
Farnham
ARID3A
ENCSR000EFY
r=0.30

small heat map img

K562
Farnham
NRF1
ENCSR000EHH
r=0.30

small heat map img

K562
Farnham
STAT5A
ENCSR000BRR
r=0.30

small heat map img

K562
Farnham
ZNF384
ENCSR000EFP
r=0.30

small heat map img

K562
Farnham
YY1
ENCSR000EWF
r=0.29

small heat map img

K562
Farnham
NFYA
ENCSR000EGR
r=0.29

small heat map img

K562
Farnham
UBTF
ENCSR000EFW
r=0.29

small heat map img

K562
Farnham
USF2
ENCSR000EHG
r=0.29

small heat map img

K562
Farnham
CTCF
ENCSR000EGM
r=0.29

small heat map img

K562
Farnham
TEAD4
ENCSR000BRK
r=0.29

small heat map img

K562
Farnham
GTF3C2
ENCSR000DOD
r=0.28

small heat map img

K562
Farnham
NR2F2
ENCSR000BRS
r=0.28

small heat map img

K562
Farnham
REST
ENCSR000BMW
r=0.28

small heat map img

K562
Farnham
FOS
ENCSR000FAI
r=0.27

small heat map img

K562
Farnham
ZNF143
ENCSR000EGP
r=0.27

small heat map img

K562
Farnham
JUN
ENCSR000EZX
r=0.27

small heat map img

K562
Farnham
GATA1
ENCSR000EWM
r=0.26

small heat map img

K562
Farnham
SIRT6
ENCSR000AUB
r=0.26

small heat map img

K562
Farnham
MAFK
ENCSR000EGX
r=0.26

small heat map img

K562
Farnham
HDAC2
ENCSR000BMG
r=0.26

small heat map img

K562
Farnham
PML
ENCSR000BQY
r=0.26

small heat map img

K562
Farnham
BACH1
ENCSR000EGD
r=0.26

small heat map img

K562
Farnham
CTCF
ENCSR000BPJ
r=0.25

small heat map img

K562
Farnham
NCOR1
ENCSR000ATY
r=0.25

small heat map img

K562
Farnham
CUX1
ENCSR000EFO
r=0.25

small heat map img

K562
Farnham
EP300
ENCSR000EGY
r=0.25

small heat map img

K562
Farnham
NFYB
ENCSR000EGQ
r=0.24

small heat map img

K562
Farnham
CTCFL
ENCSR000BNK
r=0.24

small heat map img

K562
Farnham
CTCF
ENCSR000DMA
r=0.24

small heat map img

K562
Farnham
CTCF
ENCSR000AKO
r=0.24

small heat map img

K562
Farnham
JUN
ENCSR000EZT
r=0.24

small heat map img

K562
Farnham
CTCF
ENCSR000DWE
r=0.23

small heat map img

K562
Farnham
GATA2
ENCSR000EWG
r=0.23

small heat map img

K562
Farnham
SMARCA4
ENCSR000EHO
r=0.23

small heat map img

K562
Farnham
SETDB1
ENCSR000EWD
r=0.23

small heat map img

K562
Farnham
EP300
ENCSR000AQB
r=0.23

small heat map img

K562
Farnham
SMARCB1
ENCSR000EHN
r=0.23

small heat map img

K562
Farnham
KDM1A
ENCSR000ATX
r=0.23

small heat map img

K562
Farnham
GABPA
ENCSR000BLO
r=0.23

small heat map img

K562
Farnham
THAP1
ENCSR000BNN
r=0.22

small heat map img

K562
Farnham
SIRT6
ENCSR000DOH
r=0.21

small heat map img

K562
Farnham
TAL1
ENCSR000EHB
r=0.21

small heat map img

K562
Farnham
SRF
ENCSR000BLK
r=0.21

small heat map img

K562
Farnham
CEBPB
ENCSR000BRQ
r=0.21

small heat map img

K562
Farnham
SIN3A
ENCSR000BLR
r=0.21

small heat map img

K562
Farnham
RFX5
ENCSR000EGO
r=0.20

small heat map img

K562
Farnham
SUZ12
ENCSR000AUC
r=0.20

small heat map img

K562
Farnham
CHD1
ENCSR000AQD
r=0.20

small heat map img

K562
Farnham
ZNF274
ENCSR000EVX
r=0.19

small heat map img

K562
Farnham
ZBTB7A
ENCSR000BME
r=0.19

small heat map img

K562
Farnham
CHD4
ENCSR000ATL
r=0.19

small heat map img

K562
Farnham
RAD21
ENCSR000FAD
r=0.19

small heat map img

K562
Farnham
IRF1
ENCSR000EGU
r=0.19

small heat map img

K562
Farnham
TRIM28
ENCSR000EVY
r=0.19

small heat map img

K562
Farnham
JUN
ENCSR000EZW
r=0.18

small heat map img

K562
Farnham
SP2
ENCSR000BNL
r=0.18

small heat map img

K562
Farnham
CEBPB
ENCSR000EHE
r=0.17

small heat map img

K562
Farnham
CREBBP
ENCSR000ATT
r=0.16

small heat map img

K562
Farnham
RAD21
ENCSR000BKV
r=0.16

small heat map img

K562
Farnham
REST
ENCSR000ATM
r=0.16

small heat map img

K562
Farnham
TAF7
ENCSR000BNM
r=0.16

small heat map img

K562
Farnham
YY1
ENCSR000BMH
r=0.15

small heat map img

K562
Farnham
SPI1
ENCSR000BGW
r=0.15

small heat map img

K562
Farnham
SP1
ENCSR000BKO
r=0.15

small heat map img

K562
Farnham
BRF2
ENCSR000DOC
r=0.15

small heat map img

K562
Farnham
FOSL1
ENCSR000BMV
r=0.13

small heat map img

K562
Farnham
ZBTB33
ENCSR000BKF
r=0.13

small heat map img

K562
Farnham
MEF2A
ENCSR000BNV
r=0.12

small heat map img

K562
Farnham
XRCC4
ENCSR000FAC
r=0.12

small heat map img

K562
Farnham
SIX5
ENCSR000BGX
r=0.12

small heat map img

K562
Farnham
MAFF
ENCSR000EGI
r=0.12

small heat map img

K562
Farnham
GATA2
ENCSR000BKM
r=0.12

small heat map img

K562
Farnham
EZH2
ENCSR000AQE
r=0.10

small heat map img

K562
Farnham
NR2C2
ENCSR000EWH
r=0.09

small heat map img

K562
Farnham
SIX5
ENCSR000BNW
r=0.08

small heat map img

K562
Farnham
POLR3A
ENCSR000DOI
r=0.05

small heat map img

K562
Farnham
BRF1
ENCSR000DOJ
r=0.04

small heat map img

K562
Farnham
CBX2
ENCSR000ATU
r=0.03

small heat map img

K562
Farnham
CBX8
ENCSR000ATW
r=0.02

small heat map img

K562
Farnham
BDP1
ENCSR000DOK
r=0.02

small heat map img

K562
Farnham
POLR3G
ENCSR000EHQ
r=0.01

small heat map img

K562
Farnham
ZNF274
ENCSR000EWE
r=-0.15

small heat map img
10,000 randomly-selected peaks from a total of 16,312 (download )

K562 - Myers - ENCSR000BLI

K562
Myers
E2F6
ENCSR000BLI
r=1.00

small heat map img

K562
Myers
E2F6
ENCSR000EWJ
r=0.61

small heat map img

K562
Myers
MAX
ENCSR000BLP
r=0.49

small heat map img

K562
Myers
MAX
ENCSR000EFV
r=0.48

small heat map img

K562
Myers
MAX
ENCSR000FAE
r=0.44

small heat map img

K562
Myers
MYC
ENCSR000EGJ
r=0.43

small heat map img

K562
Myers
E2F4
ENCSR000EWL
r=0.42

small heat map img

K562
Myers
MYC
ENCSR000EGS
r=0.42

small heat map img

K562
Myers
MYC
ENCSR000DLZ
r=0.41

small heat map img

K562
Myers
MYC
ENCSR000FAG
r=0.40

small heat map img

K562
Myers
MYC
ENCSR000EZU
r=0.39

small heat map img

K562
Myers
CCNT2
ENCSR000DOA
r=0.38

small heat map img

K562
Myers
MYC
ENCSR000EZV
r=0.37

small heat map img

K562
Myers
MYC
ENCSR000FAZ
r=0.37

small heat map img

K562
Myers
HMGN3
ENCSR000DOB
r=0.36

small heat map img

K562
Myers
JUN
ENCSR000EFS
r=0.35

small heat map img

K562
Myers
BHLHE40
ENCSR000EGV
r=0.33

small heat map img

K562
Myers
SETDB1
ENCSR000EWI
r=0.33

small heat map img

K562
Myers
CBX3
ENCSR000BRT
r=0.31

small heat map img

K562
Myers
RCOR1
ENCSR000EGG
r=0.31

small heat map img

K562
Myers
MXI1
ENCSR000EGZ
r=0.31

small heat map img

K562
Myers
POLR2A
ENCSR000FAJ
r=0.30

small heat map img

K562
Myers
ZMIZ1
ENCSR000EFQ
r=0.30

small heat map img

K562
Myers
POLR2A
ENCSR000FAW
r=0.29

small heat map img

K562
Myers
TBL1XR1
ENCSR000EGA
r=0.29

small heat map img

K562
Myers
POLR2A
ENCSR000DLY
r=0.29

small heat map img

K562
Myers
IRF1
ENCSR000EGK
r=0.28

small heat map img

K562
Myers
JUN
ENCSR000FAH
r=0.28

small heat map img

K562
Myers
CREB1
ENCSR000BSO
r=0.28

small heat map img

K562
Myers
POLR2A
ENCSR000EHP
r=0.28

small heat map img

K562
Myers
JUND
ENCSR000EGN
r=0.28

small heat map img

K562
Myers
POLR2A
ENCSR000FAY
r=0.28

small heat map img

K562
Myers
IRF1
ENCSR000EGL
r=0.28

small heat map img

K562
Myers
RBBP5
ENCSR000AQI
r=0.27

small heat map img

K562
Myers
KDM5B
ENCSR000AQA
r=0.27

small heat map img

K562
Myers
ELF1
ENCSR000BMD
r=0.27

small heat map img

K562
Myers
JUN
ENCSR000EGH
r=0.27

small heat map img

K562
Myers
IRF1
ENCSR000EGT
r=0.27

small heat map img

K562
Myers
POLR2A
ENCSR000BMR
r=0.27

small heat map img

K562
Myers
POLR2A
ENCSR000FAX
r=0.27

small heat map img

K562
Myers
TBL1XR1
ENCSR000EGB
r=0.27

small heat map img

K562
Myers
YY1
ENCSR000BKU
r=0.26

small heat map img

K562
Myers
STAT2
ENCSR000FAT
r=0.26

small heat map img

K562
Myers
TAF1
ENCSR000BKS
r=0.26

small heat map img

K562
Myers
TRIM28
ENCSR000BRW
r=0.25

small heat map img

K562
Myers
PHF8
ENCSR000AQH
r=0.25

small heat map img

K562
Myers
SETDB1
ENCSR000AUT
r=0.25

small heat map img

K562
Myers
STAT1
ENCSR000EHJ
r=0.25

small heat map img

K562
Myers
EP300
ENCSR000EGE
r=0.25

small heat map img

K562
Myers
RCOR1
ENCSR000EGC
r=0.25

small heat map img

K562
Myers
HDAC1
ENCSR000AQF
r=0.25

small heat map img

K562
Myers
ATF3
ENCSR000BNU
r=0.25

small heat map img

K562
Myers
GTF2B
ENCSR000DOE
r=0.25

small heat map img

K562
Myers
EGR1
ENCSR000BNE
r=0.25

small heat map img

K562
Myers
ELK1
ENCSR000EFU
r=0.24

small heat map img

K562
Myers
HDAC2
ENCSR000AQG
r=0.24

small heat map img

K562
Myers
HCFC1
ENCSR000EFN
r=0.24

small heat map img

K562
Myers
USF1
ENCSR000BKT
r=0.24

small heat map img

K562
Myers
TBP
ENCSR000EHA
r=0.24

small heat map img

K562
Myers
RNF2
ENCSR000AUA
r=0.23

small heat map img

K562
Myers
SMC3
ENCSR000EGW
r=0.23

small heat map img

K562
Myers
GATA1
ENCSR000EFT
r=0.23

small heat map img

K562
Myers
SAP30
ENCSR000AQJ
r=0.23

small heat map img

K562
Myers
ATF1
ENCSR000DNZ
r=0.22

small heat map img

K562
Myers
STAT1
ENCSR000EHK
r=0.22

small heat map img

K562
Myers
ARID3A
ENCSR000EFY
r=0.21

small heat map img

K562
Myers
CHD7
ENCSR000AVD
r=0.21

small heat map img

K562
Myers
CEBPD
ENCSR000BVY
r=0.21

small heat map img

K562
Myers
KAT2B
ENCSR000ATZ
r=0.21

small heat map img

K562
Myers
ATF3
ENCSR000DOG
r=0.21

small heat map img

K562
Myers
NRF1
ENCSR000EHH
r=0.20

small heat map img

K562
Myers
STAT1
ENCSR000FAU
r=0.20

small heat map img

K562
Myers
ETS1
ENCSR000BKQ
r=0.20

small heat map img

K562
Myers
TEAD4
ENCSR000BRK
r=0.20

small heat map img

K562
Myers
HDAC6
ENCSR000ATJ
r=0.20

small heat map img

K562
Myers
STAT1
ENCSR000FAV
r=0.20

small heat map img

K562
Myers
MAFK
ENCSR000EGX
r=0.19

small heat map img

K562
Myers
STAT2
ENCSR000FBC
r=0.19

small heat map img

K562
Myers
ZNF384
ENCSR000EFP
r=0.19

small heat map img

K562
Myers
STAT5A
ENCSR000BRR
r=0.19

small heat map img

K562
Myers
HDAC2
ENCSR000BMG
r=0.19

small heat map img

K562
Myers
REST
ENCSR000BMW
r=0.19

small heat map img

K562
Myers
NFE2
ENCSR000FAF
r=0.18

small heat map img

K562
Myers
GTF3C2
ENCSR000DOD
r=0.18

small heat map img

K562
Myers
NFYA
ENCSR000EGR
r=0.18

small heat map img

K562
Myers
FOS
ENCSR000FAI
r=0.18

small heat map img

K562
Myers
ZNF263
ENCSR000EWN
r=0.18

small heat map img

K562
Myers
POLR2A
ENCSR000EHL
r=0.17

small heat map img

K562
Myers
PML
ENCSR000BQY
r=0.17

small heat map img

K562
Myers
CTCF
ENCSR000EGM
r=0.17

small heat map img

K562
Myers
NR2F2
ENCSR000BRS
r=0.17

small heat map img

K562
Myers
YY1
ENCSR000EWF
r=0.17

small heat map img

K562
Myers
CTCFL
ENCSR000BNK
r=0.17

small heat map img

K562
Myers
ZNF143
ENCSR000EGP
r=0.17

small heat map img

K562
Myers
JUN
ENCSR000EZX
r=0.17

small heat map img

K562
Myers
BACH1
ENCSR000EGD
r=0.17

small heat map img

K562
Myers
USF2
ENCSR000EHG
r=0.17

small heat map img

K562
Myers
UBTF
ENCSR000EFZ
r=0.17

small heat map img

K562
Myers
CTCF
ENCSR000BPJ
r=0.16

small heat map img

K562
Myers
EP300
ENCSR000EGY
r=0.16

small heat map img

K562
Myers
CUX1
ENCSR000EFO
r=0.16

small heat map img

K562
Myers
WHSC1
ENCSR000AVE
r=0.16

small heat map img

K562
Myers
SMARCB1
ENCSR000EHN
r=0.16

small heat map img

K562
Myers
CBX3
ENCSR000ATV
r=0.16

small heat map img

K562
Myers
SMARCA4
ENCSR000EHO
r=0.16

small heat map img

K562
Myers
NFYB
ENCSR000EGQ
r=0.15

small heat map img

K562
Myers
NCOR1
ENCSR000ATY
r=0.15

small heat map img

K562
Myers
TAL1
ENCSR000EHB
r=0.15

small heat map img

K562
Myers
JUN
ENCSR000EZT
r=0.15

small heat map img

K562
Myers
GABPA
ENCSR000BLO
r=0.15

small heat map img

K562
Myers
KDM1A
ENCSR000ATX
r=0.15

small heat map img

K562
Myers
CTCF
ENCSR000DMA
r=0.14

small heat map img

K562
Myers
THAP1
ENCSR000BNN
r=0.14

small heat map img

K562
Myers
SRF
ENCSR000BLK
r=0.14

small heat map img

K562
Myers
GATA1
ENCSR000EWM
r=0.14

small heat map img

K562
Myers
ZNF274
ENCSR000EVX
r=0.14

small heat map img

K562
Myers
SIN3A
ENCSR000BLR
r=0.14

small heat map img

K562
Myers
CEBPB
ENCSR000BRQ
r=0.14

small heat map img

K562
Myers
SIRT6
ENCSR000DOH
r=0.14

small heat map img

K562
Myers
UBTF
ENCSR000EFW
r=0.14

small heat map img

K562
Myers
SIRT6
ENCSR000AUB
r=0.14

small heat map img

K562
Myers
SETDB1
ENCSR000EWD
r=0.13

small heat map img

K562
Myers
RFX5
ENCSR000EGO
r=0.13

small heat map img

K562
Myers
EP300
ENCSR000AQB
r=0.13

small heat map img

K562
Myers
GATA2
ENCSR000EWG
r=0.13

small heat map img

K562
Myers
CTCF
ENCSR000DWE
r=0.13

small heat map img

K562
Myers
ZBTB7A
ENCSR000BME
r=0.13

small heat map img

K562
Myers
JUN
ENCSR000EZW
r=0.13

small heat map img

K562
Myers
CTCF
ENCSR000AKO
r=0.13

small heat map img

K562
Myers
TRIM28
ENCSR000EVY
r=0.12

small heat map img

K562
Myers
IRF1
ENCSR000EGU
r=0.12

small heat map img

K562
Myers
TAF7
ENCSR000BNM
r=0.12

small heat map img

K562
Myers
SP2
ENCSR000BNL
r=0.12

small heat map img

K562
Myers
CHD1
ENCSR000AQD
r=0.12

small heat map img

K562
Myers
CHD4
ENCSR000ATL
r=0.11

small heat map img

K562
Myers
RAD21
ENCSR000BKV
r=0.11

small heat map img

K562
Myers
RAD21
ENCSR000FAD
r=0.11

small heat map img

K562
Myers
CEBPB
ENCSR000EHE
r=0.11

small heat map img

K562
Myers
YY1
ENCSR000BMH
r=0.10

small heat map img

K562
Myers
SUZ12
ENCSR000AUC
r=0.10

small heat map img

K562
Myers
SP1
ENCSR000BKO
r=0.10

small heat map img

K562
Myers
MAFF
ENCSR000EGI
r=0.10

small heat map img

K562
Myers
MEF2A
ENCSR000BNV
r=0.09

small heat map img

K562
Myers
BRF2
ENCSR000DOC
r=0.09

small heat map img

K562
Myers
GATA2
ENCSR000BKM
r=0.09

small heat map img

K562
Myers
SPI1
ENCSR000BGW
r=0.09

small heat map img

K562
Myers
FOSL1
ENCSR000BMV
r=0.09

small heat map img

K562
Myers
REST
ENCSR000ATM
r=0.08

small heat map img

K562
Myers
CREBBP
ENCSR000ATT
r=0.08

small heat map img

K562
Myers
ZBTB33
ENCSR000BKF
r=0.07

small heat map img

K562
Myers
XRCC4
ENCSR000FAC
r=0.07

small heat map img

K562
Myers
SIX5
ENCSR000BGX
r=0.06

small heat map img

K562
Myers
SIX5
ENCSR000BNW
r=0.06

small heat map img

K562
Myers
EZH2
ENCSR000AQE
r=0.04

small heat map img

K562
Myers
POLR3A
ENCSR000DOI
r=0.03

small heat map img

K562
Myers
BRF1
ENCSR000DOJ
r=0.03

small heat map img

K562
Myers
NR2C2
ENCSR000EWH
r=0.03

small heat map img

K562
Myers
BDP1
ENCSR000DOK
r=0.02

small heat map img

K562
Myers
POLR3G
ENCSR000EHQ
r=0.01

small heat map img

K562
Myers
CBX2
ENCSR000ATU
r=0.00

small heat map img

K562
Myers
CBX8
ENCSR000ATW
r=-0.00

small heat map img

K562
Myers
ZNF274
ENCSR000EWE
r=-0.08

small heat map img
10,000 randomly-selected peaks from a total of 24,570 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

K562 - Farnham - ENCSR000EWJ

loading

K562 - Myers - ENCSR000BLI

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help