CTCF

This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. RefSeq, Jul 2010
Transcriptional repressor CTCF also known as 11-zinc finger protein or CCCTC-binding factor is a transcription factor that in humans is encoded by the CTCF gene. CTCF is involved in many cellular processes, including transcriptional regulation, insulator activity, V(D)J recombination and regulation of chromatin architecture.wikipedia

CTCF

PDB image
PDB 1X6H

PDB 1X6H 2CT1
ENCODE experiments
Ensemble search
Entrez 10664
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia CTCF

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

A549 - Bernstein - ENCSR000AUE

loading

A549 - Bernstein - ENCSR000AUF

loading

A549 - Iyer - ENCSR000DNA

loading

A549 - Myers - ENCSR000BHV

loading

A549 - Myers - ENCSR000BHW

loading

A549 - Snyder - ENCSR000DYD

loading

A549 - Stam - ENCSR000DPF

loading

astrocyte - Bernstein - ENCSR000AOO

loading

astrocyte of the cerebellum - Stam - ENCSR000DSZ

loading

astrocyte of the spinal cord - Stam - ENCSR000DSU

loading

B cell - Bernstein - ENCSR000AUV

loading

BE2C - Stam - ENCSR000DQD

loading

brain microvascular endothelial cell - Stam - ENCSR000DTA

loading

bronchial epithelial cell - Stam - ENCSR000DXI

loading

Caco-2 - Stam - ENCSR000DQN

loading

cardiac fibroblast - Stam - ENCSR000DTF

loading

CD14-positive monocyte - Bernstein - ENCSR000ATN

loading

choroid plexus epithelial cell - Stam - ENCSR000DTL

loading

DND-41 - Bernstein - ENCSR000AQU

loading

endothelial cell of umbilical vein - Bernstein - ENCSR000ALA

loading

endothelial cell of umbilical vein - Iyer - ENCSR000DLW

loading

endothelial cell of umbilical vein - Stam - ENCSR000DVP

loading

fibroblast of dermis - Bernstein - ENCSR000APM

loading

fibroblast of gingiva - Stam - ENCSR000DPS

loading

fibroblast of lung - Bernstein - ENCSR000ANO

loading

fibroblast of lung - Stam - ENCSR000DPM

loading

fibroblast of lung - Stam - ENCSR000DVA

loading

fibroblast of lung - Stam - ENCSR000DWY

loading

fibroblast of pulmonary artery - Stam - ENCSR000DUX

loading

fibroblast of skin of abdomen - Stam - ENCSR000DPV

loading

foreskin fibroblast - Stam - ENCSR000DUH

loading

foreskin fibroblast - Stam - ENCSR000DWQ

loading

GM06990 - Stam - ENCSR000DQW

loading

GM12865 - Stam - ENCSR000DRE

loading

GM12866 - Stam - ENCSR000DRF

loading

GM12875 - Stam - ENCSR000DRU

loading

GM12878 - Bernstein - ENCSR000AKB

loading

GM12878 - Iyer - ENCSR000DKV

loading

GM12878 - Snyder - ENCSR000DZN

loading

GM12878 - Stam - ENCSR000DRZ

loading

H1-hESC - Bernstein - ENCSR000AMF

loading

H1-hESC - Iyer - ENCSR000DLK

loading

H1-hESC - Myers - ENCSR000BNH

loading

HCT116 - Myers - ENCSR000BSE

loading

HCT116 - Stam - ENCSR000DTO

loading

HeLa-S3 - Bernstein - ENCSR000AOA

loading

HeLa-S3 - Iyer - ENCSR000DLO

loading

HeLa-S3 - Stam - ENCSR000DUB

loading

HepG2 - Bernstein - ENCSR000AMA

loading

HepG2 - Iyer - ENCSR000DLS

loading

HepG2 - Myers - ENCSR000BIE

loading

HepG2 - Stam - ENCSR000DUG

loading

HL-60 - Stam - ENCSR000DUP

loading

K562 - Bernstein - ENCSR000AKO

loading

K562 - Iyer - ENCSR000DMA

loading

K562 - Myers - ENCSR000BPJ

loading

K562 - Snyder - ENCSR000EGM

loading

K562 - Stam - ENCSR000DWE

loading

keratinocyte - Bernstein - ENCSR000ALJ

loading

keratinocyte - Iyer - ENCSR000DNC

loading

keratinocyte - Stam - ENCSR000DWX

loading

kidney epithelial cell - Stam - ENCSR000DVH

loading

mammary epithelial cell - Bernstein - ENCSR000ALV

loading

mammary epithelial cell - Stam - ENCSR000DUS

loading

MCF-7 - Iyer - ENCSR000DML

loading

MCF-7 - Iyer - ENCSR000DMO

loading

MCF-7 - Iyer - ENCSR000DMR

loading

MCF-7 - Iyer - ENCSR000DMS

loading

MCF-7 - Iyer - ENCSR000DMV

loading

MCF-7 - Myers - ENCSR000AHD

loading

MCF-7 - Stam - ENCSR000DWH

loading

myotube - Bernstein - ENCSR000ANS

loading

NB4 - Stam - ENCSR000DWN

loading

osteoblast - Bernstein - ENCSR000APF

loading

skeletal muscle myoblast - Bernstein - ENCSR000ANE

loading

SK-N-SH - Myers - ENCSR000BLX

loading

SK-N-SH - Snyder - ENCSR000EIC

loading

SK-N-SH - Stam - ENCSR000DXQ

loading

WERI-Rb-1 - Stam - ENCSR000DXW

loading

WI38 - Stam - ENCSR000DYB

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

A549 - Bernstein - ENCSR000AUF

1.
301 / 500
8.4e-521
CCACTAGGGGGCACT
small heat map img p-value: 0.00
pct_center: 0.67
pct_ratio: 2.08
2.
87 / 500
5.3e-64
AAAGGAAAAGAATAAAATAAAATGGAAAG
small heat map img p-value: 0.78
pct_center: 0.22
pct_ratio: 0.75
3.
15 / 500
1.4e-15
GGAATGGAATCGAATGGA
small heat map img p-value: 0.03
pct_center: 0.07
pct_ratio: 0.53
4.
57 / 500
0.0099
AGAGGAAGGGAAAGG
small heat map img p-value: 1.00
pct_center: 0.32
pct_ratio: 0.47
5.
10 / 500
78
AATGGAATGGAATGAAAT
small heat map img p-value: 0.00
pct_center: 0.06
pct_ratio: 0.44
MEME output

A549 - Bernstein - ENCSR000AUE

1.
299 / 500
3.1e-619
GGCCACCAGGGGGCGCTAGA
small heat map img p-value: 0.00
pct_center: 0.72
pct_ratio: 2.19
2.
23 / 500
5.4e-113
AATGGAATGGAATGGAATGGAATGGAA
small heat map img p-value: 0.45
pct_center: 0.10
pct_ratio: 0.42
3.
23 / 500
1.0e-41
AATGGAATGGAATGGAATGGAATGGA
small heat map img p-value: 0.02
pct_center: 0.08
pct_ratio: 0.49
4.
55 / 500
9.4e-24
AAAAAAAAAATAAAA
small heat map img p-value: 1.00
pct_center: 0.24
pct_ratio: 0.91
5.
17 / 500
1.3e-8
AATGGAATGGAATG
small heat map img p-value: 0.52
pct_center: 0.06
pct_ratio: 0.41
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

A549 - Iyer - ENCSR000DNA

1.
487 / 500
1.1e-997
GCCACCAGGGGGCGCCG
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.20
2.
55 / 500
1.1e-14
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.66
pct_ratio: 2.28
3.
97 / 500
0.32
GCTGCAGT
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.73
4.
57 / 500
27
AGAGGAAG
small heat map img p-value: 0.51
pct_center: 0.24
pct_ratio: 0.63
5.
16 / 500
4.2e+4
ATGGCCGCCTGGAGGGACTGCTGGCATTT
small heat map img p-value: 0.73
pct_center: 0.12
pct_ratio: 0.64
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

A549 - Myers - ENCSR000BHV

1.
500 / 500
1.3e-1047
GTGGCCACCAGGGGGCGCCAT
small heat map img p-value: 0.00
pct_center: 0.90
pct_ratio: 3.15
2.
206 / 500
2.2e-112
GCCACCAGGGGGCGCCGGAG
small heat map img p-value: 0.00
pct_center: 0.89
pct_ratio: 2.77
3.
36 / 500
0.000032
AAAAAACAAAAGAAA
small heat map img p-value: 1.00
pct_center: 0.23
pct_ratio: 0.35
4.
4 / 500
1.3
TACTGCAGCCTCGCTGGTGCTGTAGTAA
small heat map img p-value: 0.68
pct_center: 0.08
pct_ratio: 0.65
5.
7 / 500
2.1e+4
TAAAAATTGGTTTCTCTGATGGTTGAATG
small heat map img p-value: 0.98
pct_center: 0.10
pct_ratio: 0.41
MEME output

A549 - Myers - ENCSR000BHW

1.
484 / 500
3.6e-965
GGCCACCAGGGGGCGCC
small heat map img p-value: 0.00
pct_center: 0.89
pct_ratio: 2.96
2.
254 / 500
2.0e-151
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.88
pct_ratio: 2.73
3.
43 / 500
3.5e-11
AAACTAAAAATGAAT
small heat map img p-value: 0.95
pct_center: 0.22
pct_ratio: 0.38
4.
26 / 500
5.8e+2
AAGTAAATAACTGCA
small heat map img p-value: 0.06
pct_center: 0.07
pct_ratio: 0.49
5.
14 / 500
2.7e+3
GACAGGGGGCGCTGCGGAGCA
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.73
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

A549 - Snyder - ENCSR000DYD

1.
491 / 500
5.3e-1004
GGCCACCAGGGGGCGCTA
small heat map img p-value: 0.00
pct_center: 0.91
pct_ratio: 2.98
2.
243 / 500
1.8e-105
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.88
pct_ratio: 2.57
3.
40 / 500
1.6e-16
AAAATTAAAAATATATTTATT
small heat map img p-value: 0.94
pct_center: 0.16
pct_ratio: 0.36
4.
9 / 500
2.3
AGGACACCAGGGGGTGCTCAG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.62
5.
7 / 500
2.9
AGAGGCTGCAGTACCACAGA
small heat map img p-value: 0.18
pct_center: 0.08
pct_ratio: 0.56
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

A549 - Stam - ENCSR000DPF

1.
493 / 500
6.4e-1012
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 2.76
2.
99 / 500
4.1e-26
CCAGCAGGGGGCGCC
small heat map img p-value: 0.00
pct_center: 0.73
pct_ratio: 2.27
3.
36 / 500
0.000025
TGGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.71
4.
31 / 500
0.012
CTGAAGAGGAAGGACAGGAA
small heat map img p-value: 0.30
pct_center: 0.24
pct_ratio: 0.54
5.
4 / 500
2.5e+2
CTCGGGTGCTGTAGCAAGCCATGGTACTGG
small heat map img p-value: 0.27
pct_center: 0.07
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

B cell - Bernstein - ENCSR000AUV

1.
228 / 500
3.9e-401
GGCCACCAGGGGGCACTATAG
small heat map img p-value: 0.00
pct_center: 0.66
pct_ratio: 1.72
2.
88 / 500
3.5e-24
ATTAAAAAAAAAAGAAAAAA
small heat map img p-value: 0.99
pct_center: 0.24
pct_ratio: 0.78
3.
69 / 500
3.9e-18
GGGGCTGGGGCGGCGGGGGGGGAGGAGGAG
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.84
4.
9 / 500
2.3e-7
TGGAATGGAGTCGAATGGAAT
small heat map img p-value: 0.21
pct_center: 0.10
pct_ratio: 0.47
5.
6 / 500
0.017
GTCCTGTGTGTTGCAGGATGTTTAGCAGC
small heat map img p-value: 0.22
pct_center: 0.08
pct_ratio: 0.57
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

BE2C - Stam - ENCSR000DQD

1.
496 / 500
1.1e-940
GCCACTAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.88
2.
103 / 500
7.2e-40
GGAACTGCAGG
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.73
3.
78 / 500
1.3e-33
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.70
pct_ratio: 3.02
4.
5 / 500
1.2e+3
TCTTTGGTGGTGTAGCAAACAGCGGTACTG
small heat map img p-value: 0.04
pct_center: 0.06
pct_ratio: 0.54
5.
7 / 500
1.2e+2
AAGCCTAGCATTGCACCAGCTGGCAAAGGG
small heat map img p-value: 0.49
pct_center: 0.12
pct_ratio: 0.61
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

BJ - Stam - ENCSR000DQI

1.
499 / 500
2.3e-898
GGCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 2.69
2.
114 / 500
2.4e-39
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.77
3.
41 / 500
0.054
CGGCAGGGGGCGCTG
small heat map img p-value: 0.00
pct_center: 0.46
pct_ratio: 1.29
4.
24 / 500
2.1
AGGGAGGAAAGAAAG
small heat map img p-value: 0.99
pct_center: 0.34
pct_ratio: 0.50
5.
16 / 500
87
GAGCCCTCTGGTGGCCCCTGGGGGGAT
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 1.93
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

CD14-positive monocyte - Bernstein - ENCSR000ATN

1.
220 / 500
2.0e-311
GCCACCAGGGGGCAC
small heat map img p-value: 0.00
pct_center: 0.62
pct_ratio: 1.47
2.
70 / 500
1.1e-40
GTTTTTTTTTTTTTTTTTTTTTTTTTTTTA
small heat map img p-value: 1.00
pct_center: 0.19
pct_ratio: 0.66
3.
65 / 500
3.6e-9
GGGCAGGGGCGGGGGCGGGAG
small heat map img p-value: 0.01
pct_center: 0.44
pct_ratio: 0.87
4.
7 / 500
0.000021
ATGGAATGGAATGGAATGGA
small heat map img p-value: 0.68
pct_center: 0.08
pct_ratio: 0.43
5.
12 / 500
54
GTGTGTGTATGTATATGAGTGTGTGTTTTG
small heat map img p-value: 1.00
pct_center: 0.09
pct_ratio: 0.44
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Caco-2 - Stam - ENCSR000DQN

1.
492 / 500
3.6e-915
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 2.67
2.
86 / 500
5.9e-18
GCCAGCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 2.57
3.
64 / 500
2.2e-10
AGAGCTGCAGCTGCC
small heat map img p-value: 0.04
pct_center: 0.20
pct_ratio: 0.63
4.
5 / 500
8.5e+3
CTGTGTGTGCCAATCAAAAAT
small heat map img p-value: 0.49
pct_center: 0.10
pct_ratio: 0.43
5.
17 / 500
1.6e+2
TGCAACTGCAAGGTAGAGA
small heat map img p-value: 0.14
pct_center: 0.12
pct_ratio: 0.63
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

DND-41 - Bernstein - ENCSR000AQU

1.
486 / 500
8.7e-1002
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 2.72
2.
154 / 500
2.7e-52
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.76
3.
10 / 500
0.0066
TTTGGCCACCAGGTGGCAGCA
small heat map img p-value: 0.00
pct_center: 0.39
pct_ratio: 3.07
4.
66 / 500
0.012
GGCAGGGAAAGGAGGGGAAGG
small heat map img p-value: 1.00
pct_center: 0.40
pct_ratio: 0.50
5.
5 / 500
87
CACAAACCTCCCTGCAGGGAGGCTGAGGGG
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 0.71
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM06990 - Stam - ENCSR000DQW

1.
490 / 500
1.3e-819
CACCAGGGGGCGCCGGAG
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.50
2.
116 / 500
1.8e-56
GCAAGGGGTGGAACTGCAGCC
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 0.80
3.
10 / 500
1.1e-20
ACACCAGGGGGCGCTCAGGACCACCAGGG
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 0.91
4.
74 / 500
1.3e-14
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.71
pct_ratio: 2.43
5.
12 / 500
33
AGGAAGAAGAAAAAG
small heat map img p-value: 0.01
pct_center: 0.29
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM10248 - Iyer - ENCSR000DKP

1.
497 / 500
6.9e-1059
GCCACCAGGGGGCGC
small heat map img p-value:
pct_center:
pct_ratio:
2.
18 / 500
2.2e-52
CAGTCCAGGGCCCGGCCTGTCGGAGGTGCT
small heat map img p-value:
pct_center:
pct_ratio:
3.
8 / 500
6.8e-24
GGCTTCACAGGACAGGAGCCAGGTACGCT
small heat map img p-value:
pct_center:
pct_ratio:
4.
88 / 500
6.2e-20
CCAGCAGGGGGCGCT
small heat map img p-value:
pct_center:
pct_ratio:
5.
9 / 500
2.0e-18
CTCGAAAGGGTTTGCCCTGAG
small heat map img p-value:
pct_center:
pct_ratio:
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM10266 - Iyer - ENCSR000DKR

1.
495 / 500
2.7e-916
CCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 1.46
2.
14 / 500
4.2e-60
CAGGCCCGGGCCCGGCGTGTCCGCGGTGCG
small heat map img p-value: 0.02
pct_center: 0.26
pct_ratio: 0.62
3.
11 / 500
5.1e-31
AGAGAGCCAGGAGCGGCCCGC
small heat map img p-value: 0.01
pct_center: 0.22
pct_ratio: 0.58
4.
99 / 500
3.2e-24
CCAGCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.59
pct_ratio: 1.38
5.
73 / 500
1.6e-19
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.66
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12801 - Stam - ENCSR000DQY

1.
497 / 500
4.4e-883
GCCACTAGAGGGC
small heat map img p-value: 0.00
pct_center: 0.91
pct_ratio: 4.08
2.
166 / 500
6.2e-44
GGGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.85
3.
43 / 500
0.00041
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 1.96
4.
7 / 500
0.33
CTGGTGTTGTAGTAAGCTGCGGTACTGGAG
small heat map img p-value: 0.04
pct_center: 0.05
pct_ratio: 0.54
5.
7 / 500
0.40
TTGTTTAAAATAGCAGATTTACTGTTGCAA
small heat map img p-value: 0.17
pct_center: 0.07
pct_ratio: 0.30
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12864 - Stam - ENCSR000DRB

1.
491 / 500
1.9e-919
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 2.42
2.
149 / 500
5.9e-53
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.76
3.
51 / 500
0.15
GCCAGCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.68
pct_ratio: 2.76
4.
17 / 500
1.3e+2
CAAGAAAAAGAAAAA
small heat map img p-value: 0.08
pct_center: 0.25
pct_ratio: 0.47
5.
41 / 500
2.1e+2
AAGCTCTGGCAGAAC
small heat map img p-value: 1.00
pct_center: 0.17
pct_ratio: 0.46
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12865 - Stam - ENCSR000DRE

1.
498 / 500
1.9e-860
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 2.48
2.
137 / 500
7.6e-45
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.77
3.
52 / 500
8.7e-7
GCCAGCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.70
pct_ratio: 2.72
4.
8 / 500
34
TTATTTTGTGAGAATGAAGTT
small heat map img p-value: 0.92
pct_center: 0.05
pct_ratio: 0.37
5.
21 / 500
4.7e+2
AAAGGAAAGAG
small heat map img p-value: 0.07
pct_center: 0.22
pct_ratio: 0.47
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12866 - Stam - ENCSR000DRF

1.
424 / 500
5.3e-611
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 1.99
2.
87 / 500
8.1e-32
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.81
3.
9 / 500
3.4e-25
GGCACTCAGGACACCAGGGGGTGCTCAGGA
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.76
4.
10 / 500
1.7e-11
AGGACACCAGGGGGCGCTCAGGACCACCA
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 1.04
5.
11 / 500
0.019
AGAAAGGAAGGAACGAAAA
small heat map img p-value: 0.01
pct_center: 0.15
pct_ratio: 0.34
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12867 - Stam - ENCSR000DRH

1.
485 / 500
1.9e-672
CCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 2.48
2.
96 / 500
1.8e-39
GGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.69
3.
10 / 500
2.7e-21
GGGGTTCTGAGCGCCCCCTGGTGTCCTGAG
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.98
4.
56 / 500
0.000047
AGAAGGAAGAG
small heat map img p-value: 0.97
pct_center: 0.30
pct_ratio: 0.45
5.
32 / 500
1.1
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.73
pct_ratio: 2.87
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12868 - Stam - ENCSR000DRI

1.
431 / 500
1.5e-681
GCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 2.70
2.
123 / 500
3.3e-49
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.79
3.
6 / 500
1.1e-7
AGAACCACCAGGGGGCGCTCAGGACA
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 1.18
4.
10 / 500
0.00024
AGAGAAAGAAACAAAGAGACAGAAAGAGA
small heat map img p-value: 0.14
pct_center: 0.24
pct_ratio: 0.45
5.
47 / 500
0.51
CGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.71
pct_ratio: 2.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12869 - Stam - ENCSR000DRJ

1.
440 / 500
3.0e-659
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.86
pct_ratio: 2.20
2.
9 / 500
1.6e-30
TGGTGGTTCTGAGCACCCCCTGGTGTCCTG
small heat map img p-value: 0.12
pct_center: 0.15
pct_ratio: 0.70
3.
57 / 500
9.2e-19
GGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.82
4.
33 / 500
8.6e-9
AGAAAAAGAAAGACA
small heat map img p-value: 0.91
pct_center: 0.22
pct_ratio: 0.40
5.
13 / 500
7.1
TTTGACCATCAGGGGGCAGCA
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 1.95
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12870 - Stam - ENCSR000DRK

1.
423 / 500
1.8e-669
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 3.02
2.
160 / 500
5.1e-59
GGAACTGCAGG
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.66
3.
16 / 500
3.1e-24
GACACCAGGGGGTGCTCAGAACCACCAGGG
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.76
4.
41 / 500
2.0e-8
AGGAAGAAAAAAAAG
small heat map img p-value: 0.50
pct_center: 0.26
pct_ratio: 0.43
5.
66 / 500
2.3
AGCAGAGG
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.73
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12871 - Stam - ENCSR000DRL

1.
468 / 500
5.4e-782
GGCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.21
2.
133 / 500
8.1e-59
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.80
3.
13 / 500
1.7e-14
TGGTGGTCCTGAGCGCCCCCTGGTGGCT
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 1.66
4.
15 / 500
0.0014
TTTCACCAGAAGAGGGCAGCAGAGGGCA
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 1.07
5.
26 / 500
0.010
GGCCGACAGGGGGCGCTGT
small heat map img p-value: 0.00
pct_center: 0.41
pct_ratio: 1.36
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12872 - Stam - ENCSR000DRN

1.
490 / 500
9.5e-827
CCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.79
pct_ratio: 2.67
2.
160 / 500
1.5e-65
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.76
3.
70 / 500
0.0000079
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.71
pct_ratio: 2.41
4.
16 / 500
8.9e+3
AGCAAAGAGACAAAC
small heat map img p-value: 0.20
pct_center: 0.17
pct_ratio: 0.47
5.
9 / 500
9.0e+3
CAGAGGACCATGCAG
small heat map img p-value: 0.01
pct_center: 0.23
pct_ratio: 0.74
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12873 - Stam - ENCSR000DRP

1.
494 / 500
1.7e-721
CCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 2.65
2.
122 / 500
3.2e-47
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.65
3.
14 / 500
0.0012
TTTCACCAGCAGGGGGCAGCAGAGAGCCC
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 1.40
4.
39 / 500
2.8e+2
GCCAGCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.68
pct_ratio: 2.05
5.
4 / 500
1.5e+4
TGGTGATATAGTAAGACATAGCACTGGAGC
small heat map img p-value: 0.85
pct_center: 0.07
pct_ratio: 0.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12874 - Stam - ENCSR000DRR

1.
497 / 500
6.8e-801
CCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 2.46
2.
110 / 500
2.8e-45
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.79
3.
7 / 500
0.0040
AGGACACCAGGGGGCGCTCAGAACCAGCAG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.92
4.
13 / 500
0.00010
ATTGGCCACCAGGGGGCGGCAGAG
small heat map img p-value: 0.00
pct_center: 0.47
pct_ratio: 2.63
5.
11 / 500
24
CAGAAAAGTGCCAGA
small heat map img p-value: 0.74
pct_center: 0.12
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12875 - Stam - ENCSR000DRU

1.
494 / 500
1.0e-857
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 2.37
2.
107 / 500
1.3e-36
GGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.68
3.
60 / 500
0.000050
GCCAGCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.70
pct_ratio: 1.81
4.
24 / 500
2.5e+4
ACAGAAGAAA
small heat map img p-value: 0.17
pct_center: 0.22
pct_ratio: 0.48
5.
6 / 500
2.8e+4
AGCGATGTTTTGCCAGAGCTAATTCTG
small heat map img p-value: 0.58
pct_center: 0.07
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Bernstein - ENCSR000AKB

1.
488 / 500
1.3e-893
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.82
pct_ratio: 2.61
2.
124 / 500
6.6e-43
AAAGGTGGAACTGCA
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.66
3.
85 / 500
2.5e-21
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 2.44
4.
16 / 500
0.25
AAAAAGAAATGATAC
small heat map img p-value: 0.47
pct_center: 0.12
pct_ratio: 0.43
5.
6 / 500
0.27
GGGTGCTCAGGACAGCAGGGGGTGCTCAG
small heat map img p-value: 0.01
pct_center: 0.14
pct_ratio: 0.69
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Iyer - ENCSR000DKV

1.
490 / 500
6.1e-995
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 2.73
2.
123 / 500
6.3e-22
CTGGAACTGCA
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.65
3.
71 / 500
4.0e-27
TGGCCAGCAGGGGGCGCCG
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 3.09
4.
4 / 500
17
CTGGTGCTGTAGTAAGCTGCAGTACTGGA
small heat map img p-value: 0.48
pct_center: 0.06
pct_ratio: 0.55
5.
24 / 500
4.1e+3
ACACTGCAGGAGGAA
small heat map img p-value: 0.20
pct_center: 0.24
pct_ratio: 0.62
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Snyder - ENCSR000DZN

1.
482 / 500
1.6e-808
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 2.47
2.
151 / 500
2.5e-55
CCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.76
pct_ratio: 2.71
3.
38 / 500
0.0000020
GGAACTGCAGCCT
small heat map img p-value: 0.80
pct_center: 0.15
pct_ratio: 0.50
4.
25 / 500
0.29
AGGGGAACGGAAAAGAGAAAA
small heat map img p-value: 1.00
pct_center: 0.20
pct_ratio: 0.41
5.
34 / 500
8.6
GCTGCAGAGAC
small heat map img p-value: 0.08
pct_center: 0.16
pct_ratio: 0.56
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Stam - ENCSR000DRZ

1.
492 / 500
1.0e-879
GCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 2.84
2.
149 / 500
1.8e-86
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.65
3.
38 / 500
3.8e-8
AGAGCGCCCCCTGGTGGCCAG
small heat map img p-value: 0.00
pct_center: 0.46
pct_ratio: 1.57
4.
26 / 500
0.013
TGTGGCCACCAGGGGGCAGCG
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 1.27
5.
48 / 500
7.1e+2
AGCCTGG
small heat map img p-value: 1.00
pct_center: 0.21
pct_ratio: 0.41
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12891 - Iyer - ENCSR000DKX

1.
500 / 500
2.6e-964
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 1.73
2.
147 / 500
9.6e-36
TGCAGCCGCAG
small heat map img p-value: 0.04
pct_center: 0.30
pct_ratio: 0.70
3.
167 / 500
1.2e-19
CAGGGCAG
small heat map img p-value: 0.06
pct_center: 0.34
pct_ratio: 0.65
4.
29 / 500
0.028
CACCAGGGGGCGCTCTAGGCC
small heat map img p-value: 0.00
pct_center: 0.52
pct_ratio: 1.49
5.
29 / 500
2.1e+2
AGGCAGCATGGCAGC
small heat map img p-value: 0.68
pct_center: 0.34
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12892 - Iyer - ENCSR000DKY

1.
488 / 500
3.8e-841
GCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.77
pct_ratio: 1.98
2.
154 / 500
0.000038
AGCTGCAG
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 0.71
3.
48 / 500
0.027
GGCCAGCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.68
pct_ratio: 1.99
4.
24 / 500
7.0e+3
GAAGAGAGCAG
small heat map img p-value: 1.00
pct_center: 0.14
pct_ratio: 0.51
5.
4 / 500
2.8e+4
TTATGTTATGAGCAGGAA
small heat map img p-value: 0.98
pct_center: 0.05
pct_ratio: 0.32
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM13976 - Iyer - ENCSR000DKZ

1.
496 / 500
5.3e-890
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.59
pct_ratio: 1.71
2.
10 / 500
1.7e-35
AGGCCCGGGCCCGGCGTGTCCGCGGTGCGC
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.65
3.
89 / 500
3.1e-35
CGGCCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 1.92
4.
6 / 500
3.2e-19
AGAGAGCCAGGAGCGGCCCGCGGAGGAGC
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.66
5.
81 / 500
0.0000070
ACTGCAGG
small heat map img p-value: 0.02
pct_center: 0.17
pct_ratio: 0.64
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM13977 - Iyer - ENCSR000DLB

1.
494 / 500
5.0e-1019
CCACCAGGGGGCGCCGGGG
small heat map img p-value: 0.00
pct_center: 0.74
pct_ratio: 1.63
2.
89 / 500
4.3e-42
CCAGCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.63
pct_ratio: 1.53
3.
9 / 500
2.1e-28
CAGGCCCGGGCCCGGCGTGTCCGCGGTGC
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 0.65
4.
54 / 500
5.6e-17
AGCTGTGGAACTGCAGCCT
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.72
5.
6 / 500
0.0000058
AAGGACTCTTTTTCTGGGAGGCTGGAGCT
small heat map img p-value: 0.11
pct_center: 0.08
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM19238 - Iyer - ENCSR000DLD

1.
491 / 500
8.2e-796
CCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.74
pct_ratio: 1.93
2.
152 / 500
2.5e-20
AGAGGCTGCAG
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 0.77
3.
9 / 500
0.00046
GCGCTGCGGGGCACAGAATGCGGTGCCAG
small heat map img p-value: 0.22
pct_center: 0.15
pct_ratio: 0.62
4.
4 / 500
0.30
ACCTGCCCCAGGCGGACGCGGTGACGTGT
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.73
5.
110 / 500
64
CAGGGCTG
small heat map img p-value: 0.66
pct_center: 0.31
pct_ratio: 0.64
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM19239 - Iyer - ENCSR000DLE

1.
500 / 500
4.6e-692
CACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.72
pct_ratio: 2.22
2.
109 / 500
6.7e-18
TGCAGCCGCAG
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 0.74
3.
16 / 500
0.64
TGCAGGGACACTGCATGAGGA
small heat map img p-value: 0.80
pct_center: 0.24
pct_ratio: 0.59
4.
9 / 500
92
CCCAGTGCACAGTGCAGGATT
small heat map img p-value: 0.19
pct_center: 0.15
pct_ratio: 0.54
5.
11 / 500
1.2e+3
GAGTGTGTGTGGGCGTGTGCCTGTGTGC
small heat map img p-value: 0.54
pct_center: 0.20
pct_ratio: 0.63
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM19240 - Iyer - ENCSR000DLF

1.
499 / 500
1.4e-1000
TGGCCACCAGGGGGCGCC
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 1.94
2.
61 / 500
1.3e-17
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.68
pct_ratio: 2.17
3.
61 / 500
8.6e-9
CTGTGCTGCAG
small heat map img p-value: 0.38
pct_center: 0.21
pct_ratio: 0.58
4.
39 / 500
0.047
AGGGGGGAACTGCAG
small heat map img p-value: 0.34
pct_center: 0.33
pct_ratio: 0.59
5.
49 / 500
0.56
AGCAAGGCTGG
small heat map img p-value: 1.00
pct_center: 0.28
pct_ratio: 0.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM20000 - Iyer - ENCSR000DLG

1.
488 / 500
4.9e-1021
CGCGGCCACCAGGGGGCGCC
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 1.74
2.
16 / 500
7.9e-79
CAGGCCCGGGCCCGGCGTGTCCGCGGTGCG
small heat map img p-value: 0.04
pct_center: 0.20
pct_ratio: 0.63
3.
13 / 500
2.0e-57
AATGACGGCAGTGGTGCCGCCTGGTGAATG
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 1.00
4.
94 / 500
8.4e-31
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.48
pct_ratio: 1.59
5.
8 / 500
4.2e-28
GCTCGAAAGGGTTTGCCCTGA
small heat map img p-value: 0.07
pct_center: 0.06
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Bernstein - ENCSR000AMF

1.
496 / 500
7.9e-839
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.74
pct_ratio: 2.82
2.
135 / 500
5.2e-24
CTGGTGCTGCA
small heat map img p-value: 0.00
pct_center: 0.28
pct_ratio: 0.73
3.
65 / 500
8.8e-7
CCACCAGGGGGCGGC
small heat map img p-value: 0.00
pct_center: 0.64
pct_ratio: 2.12
4.
5 / 500
0.0018
GGTAAGAGCCGGCTGAGTGCTGTACAATG
small heat map img p-value: 0.14
pct_center: 0.07
pct_ratio: 0.57
5.
27 / 500
0.45
GTGGTGGCAGCACAG
small heat map img p-value: 0.01
pct_center: 0.23
pct_ratio: 0.72
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Iyer - ENCSR000DLK

1.
480 / 500
6.9e-701
GGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.77
pct_ratio: 1.94
2.
239 / 500
7.0e-44
GGCTGCAG
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 0.73
3.
15 / 500
0.000021
AGACTGCCCCCCAGTGGCCAGAAGAGGAA
small heat map img p-value: 0.00
pct_center: 0.41
pct_ratio: 1.18
4.
24 / 500
0.068
GCGACAGCGCCACCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.52
pct_ratio: 1.24
5.
25 / 500
7.0e+3
GCAGGAACTGCAAG
small heat map img p-value: 0.31
pct_center: 0.18
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Myers - ENCSR000BNH

1.
500 / 500
5.4e-925
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 2.47
2.
229 / 500
5.6e-125
GGCCACCAGGGGGCGCTGGAG
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 2.15
3.
7 / 500
0.00023
TGTAATACTGCAGTCTCGCTGGTGGTGTA
small heat map img p-value: 0.00
pct_center: 0.06
pct_ratio: 0.60
4.
20 / 500
42
GCCAGCAGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.99
5.
17 / 500
6.3e+3
AAAAAGAAAAC
small heat map img p-value: 0.91
pct_center: 0.13
pct_ratio: 0.37
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H54 - Iyer - ENCSR000DKN

1.
482 / 500
1.6e-1069
GGCCACCAGGGGGCGCTGGAGCCC
small heat map img p-value: 0.00
pct_center: 0.82
pct_ratio: 2.07
2.
62 / 500
3.2e-31
CGCCCCCTGGTGGCCACAGCGGGAAATG
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 2.22
3.
62 / 500
0.00011
AGAGGCTGCAGTTCC
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.71
4.
20 / 500
0.029
AGAAAGGAAGTGCAGATCAG
small heat map img p-value: 0.21
pct_center: 0.26
pct_ratio: 0.62
5.
25 / 500
2.3e+2
AGGGGAAGGAA
small heat map img p-value: 0.61
pct_center: 0.25
pct_ratio: 0.50
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HCT116 - Myers - ENCSR000BSE

1.
318 / 500
2.8e-474
GCCACCAGGGGGCGCTATAG
small heat map img p-value: 0.00
pct_center: 0.93
pct_ratio: 3.33
2.
88 / 500
1.9e-34
GCCACTAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.87
pct_ratio: 2.89
3.
69 / 500
1.0e-33
AAATAAAATAAATTTAAAAAAAATGAAAA
small heat map img p-value: 1.00
pct_center: 0.24
pct_ratio: 0.36
4.
22 / 500
5.1
CACAGGGCCTGGCAG
small heat map img p-value: 0.04
pct_center: 0.24
pct_ratio: 0.74
5.
22 / 500
5.0e+2
GAAAAAGAAAA
small heat map img p-value: 0.50
pct_center: 0.21
pct_ratio: 0.43
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HCT116 - Stam - ENCSR000DTO

1.
500 / 500
3.3e-1000
TGGCCACCAGGGGGCGCTG
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 2.88
2.
79 / 500
2.6e-34
GGGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.79
3.
59 / 500
0.000020
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 2.96
4.
39 / 500
0.015
AGGCTGCAGGGCTGC
small heat map img p-value: 0.02
pct_center: 0.17
pct_ratio: 0.68
5.
10 / 500
0.077
AGCAGCTGGCAAAGCAGAAAT
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.63
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HEK293 - Stam - ENCSR000DTW

1.
500 / 500
3.2e-983
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 2.52
2.
124 / 500
1.2e-16
CTGGGGCTGCA
small heat map img p-value: 0.99
pct_center: 0.28
pct_ratio: 0.57
3.
36 / 500
0.0024
CCAGGCTGCAG
small heat map img p-value: 0.32
pct_center: 0.25
pct_ratio: 0.53
4.
65 / 500
0.13
CAGGGCTG
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.67
5.
17 / 500
77
GCAGGGACACTGCAGGAGGA
small heat map img p-value: 0.88
pct_center: 0.18
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HFF-Myc - Stam - ENCSR000DUM

1.
487 / 500
4.3e-1009
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 2.60
2.
125 / 500
9.3e-39
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.75
3.
11 / 500
6.9e-8
AAGCCTAGCATTGCACCAGCTGGCAAAAGG
small heat map img p-value: 0.01
pct_center: 0.13
pct_ratio: 0.69
4.
21 / 500
0.22
TGACCACTAGGGGGCAGCAGA
small heat map img p-value: 0.00
pct_center: 0.46
pct_ratio: 1.38
5.
6 / 500
7.1e+3
ACTAGGTGGAACTCCAGTA
small heat map img p-value: 0.25
pct_center: 0.17
pct_ratio: 0.65
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HGPS cell - Iyer - ENCSR000DNG

1.
495 / 500
7.5e-886
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 2.30
2.
116 / 500
2.2e-14
GGCTGCAGTGC
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.71
3.
53 / 500
9.9e-8
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.70
pct_ratio: 2.73
4.
4 / 500
2.4e+3
AGGGCGCTGCGGCTCACAGAATGCGGTGAC
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.64
5.
4 / 500
2.0e+3
GGCTGAGATTGGCTTTCATTGCACTGC
small heat map img p-value: 0.88
pct_center: 0.12
pct_ratio: 0.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HL-60 - Stam - ENCSR000DUP

1.
499 / 500
2.8e-1004
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.93
pct_ratio: 3.28
2.
160 / 500
5.1e-41
TGTGGAACTGCAGCC
small heat map img p-value: 0.34
pct_center: 0.25
pct_ratio: 0.60
3.
60 / 500
1.2e+3
AGAGGAAG
small heat map img p-value: 0.04
pct_center: 0.20
pct_ratio: 0.58
4.
16 / 500
1.9e+5
TGGAACTGCAAAGGC
small heat map img p-value: 0.00
pct_center: 0.08
pct_ratio: 0.62
5.
14 / 500
2.1e+5
AAAAAAACAGA
small heat map img p-value: 0.81
pct_center: 0.15
pct_ratio: 0.39
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Bernstein - ENCSR000AOA

1.
500 / 500
4.3e-1009
TGGCCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.82
pct_ratio: 2.74
2.
111 / 500
1.2e-33
AGGGGGAACTGCAGG
small heat map img p-value: 0.99
pct_center: 0.20
pct_ratio: 0.53
3.
34 / 500
0.11
GGCCACCAGAGGGCA
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 2.62
4.
26 / 500
4.4e+3
AGCAGAGCTGCAGCA
small heat map img p-value: 0.95
pct_center: 0.26
pct_ratio: 0.55
5.
46 / 500
2.7e+5
CCTGGCAG
small heat map img p-value: 1.00
pct_center: 0.23
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Iyer - ENCSR000DLO

1.
490 / 500
5.7e-875
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 3.00
2.
40 / 500
2.9e-21
TTTGGCCACTAGGTGGCAGCA
small heat map img p-value: 0.00
pct_center: 0.55
pct_ratio: 2.95
3.
63 / 500
0.000016
CTGAAGCTGCA
small heat map img p-value: 0.01
pct_center: 0.20
pct_ratio: 0.69
4.
67 / 500
0.019
CTGCAGTG
small heat map img p-value: 0.01
pct_center: 0.25
pct_ratio: 0.73
5.
88 / 500
5.2
CAAGGCTG
small heat map img p-value: 0.95
pct_center: 0.26
pct_ratio: 0.47
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Stam - ENCSR000DUB

1.
486 / 500
1.1e-797
CACCAGGGGGCGCCA
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 2.75
2.
76 / 500
4.2e-26
GCAAAGGGTGGAACTGCAGCA
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.68
3.
141 / 500
0.024
CAGCAGAG
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 0.73
4.
24 / 500
32
TGGCCACCAGGTGGC
small heat map img p-value: 0.00
pct_center: 0.60
pct_ratio: 2.48
5.
13 / 500
1.2e+4
AAAACGAAAAA
small heat map img p-value: 0.36
pct_center: 0.15
pct_ratio: 0.44
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Bernstein - ENCSR000AMA

1.
494 / 500
5.9e-910
GGCCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.86
pct_ratio: 2.72
2.
79 / 500
1.4e-24
CTGCAGTG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.64
3.
69 / 500
1.8e-14
GCCAGCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 2.79
4.
41 / 500
0.016
GAGGACAGCAG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.64
5.
40 / 500
22
AGAGGCAGGGA
small heat map img p-value: 1.00
pct_center: 0.21
pct_ratio: 0.40
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Iyer - ENCSR000DLS

1.
497 / 500
5.4e-1118
CCACTAGGGGGCACT
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 3.27
2.
9 / 500
2.7e-15
AGAGGCCAGGGATGCTGCTAAACATCCTA
small heat map img p-value: 0.38
pct_center: 0.11
pct_ratio: 0.61
3.
44 / 500
6.5e-7
AAGCTGCAGTTCCAGAGACTG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.68
4.
7 / 500
0.095
CATTTTTGGTTGTCACAACTGGGG
small heat map img p-value: 0.16
pct_center: 0.07
pct_ratio: 0.50
5.
44 / 500
4.5
AGGACACAGCAGGAGGAAGTG
small heat map img p-value: 0.49
pct_center: 0.19
pct_ratio: 0.56
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Myers - ENCSR000BIE

1.
500 / 500
3.6e-938
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 2.65
2.
429 / 500
1.3e-143
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.87
pct_ratio: 2.30
3.
11 / 500
4.0e-7
TGGCAATATTTGCAGACATTTTTTATTTT
small heat map img p-value: 0.46
pct_center: 0.09
pct_ratio: 0.35
4.
8 / 500
0.0084
TACTAAAGCACCAGTGAGGCCACAGTAAGA
small heat map img p-value: 0.05
pct_center: 0.08
pct_ratio: 0.55
5.
10 / 500
3.0
AAAAAAAAAAAGAAA
small heat map img p-value: 1.00
pct_center: 0.21
pct_ratio: 0.67
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Stam - ENCSR000DUG

1.
496 / 500
2.8e-965
TGGCCACCAGGGGGCGCCGG
small heat map img p-value: 0.00
pct_center: 0.86
pct_ratio: 2.46
2.
86 / 500
1.1e-25
GGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.75
3.
79 / 500
5.6e-25
GCCAGCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.74
pct_ratio: 2.02
4.
20 / 500
3.6e+3
CAGAGATGCTG
small heat map img p-value: 0.97
pct_center: 0.18
pct_ratio: 0.50
5.
6 / 500
6.6e+3
AGAACTTGGATGCTGTGTGGACTGTGCT
small heat map img p-value: 0.05
pct_center: 0.09
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

IMR-90 - Snyder - ENCSR000EFI

1.
500 / 500
5.0e-738
GCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 2.83
2.
154 / 500
7.7e-72
CGGCCACCAGGGGGCGCCA
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.56
3.
31 / 500
1.4e-17
AGTTACAAAGTTTCAGAAAAGCAAAAAAAA
small heat map img p-value: 0.55
pct_center: 0.16
pct_ratio: 0.37
4.
32 / 500
0.021
GGCTGCAGTACCGCA
small heat map img p-value: 0.46
pct_center: 0.14
pct_ratio: 0.65
5.
18 / 500
5.1
AAACAAGAAAAGAA
small heat map img p-value: 0.82
pct_center: 0.17
pct_ratio: 0.45
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Ishikawa - Myers - ENCSR000BQE

1.
474 / 500
1.2e-1068
TGTGGCCACCAGGGGGCGCTA
small heat map img p-value: 0.00
pct_center: 0.94
pct_ratio: 3.54
2.
272 / 500
5.7e-188
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.93
pct_ratio: 3.06
3.
38 / 500
7.6e-18
AAAGATAAAGAAATA
small heat map img p-value: 1.00
pct_center: 0.21
pct_ratio: 0.33
4.
4 / 500
1.2
ACTACACTGTGAGCAAGAGGGCCCTG
small heat map img p-value: 0.25
pct_center: 0.07
pct_ratio: 0.59
5.
12 / 500
1.8e+2
ATTTTTTAAGATGTT
small heat map img p-value: 0.70
pct_center: 0.10
pct_ratio: 0.37
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Bernstein - ENCSR000AKO

1.
495 / 500
3.1e-838
CCACCAGGGGGCGCCGTG
small heat map img p-value: 0.00
pct_center: 0.82
pct_ratio: 1.96
2.
75 / 500
3.1e-12
GCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.74
pct_ratio: 2.10
3.
50 / 500
2.4e-10
CAAAGGGCGGAACTGCAGCCA
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.70
4.
6 / 500
0.40
AAACCATTGTGTGCTCAGGTGACCAGGGC
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.63
5.
17 / 500
15
AGAGAAAGAAGAAAAACCT
small heat map img p-value: 0.71
pct_center: 0.17
pct_ratio: 0.41
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Iyer - ENCSR000DMA

1.
474 / 500
2.4e-849
CACCAGGGGGCGCTGTA
small heat map img p-value: 0.00
pct_center: 0.77
pct_ratio: 2.46
2.
63 / 500
1.4e-37
GCCCCCTGGTGGCCAGTGAGG
small heat map img p-value: 0.00
pct_center: 0.66
pct_ratio: 2.36
3.
62 / 500
1.9e-12
TGGGAACTGCA
small heat map img p-value: 0.06
pct_center: 0.15
pct_ratio: 0.58
4.
6 / 500
0.00024
GGACCATTCCTGAGAAGACTGGGGGTAA
small heat map img p-value: 0.36
pct_center: 0.08
pct_ratio: 0.48
5.
8 / 500
0.0028
CTCCACACTGGCAGCTGGAGGCTCAGGGA
small heat map img p-value: 0.26
pct_center: 0.20
pct_ratio: 0.61
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Myers - ENCSR000BPJ

1.
500 / 500
2.2e-938
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 2.40
2.
317 / 500
9.5e-153
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.86
pct_ratio: 2.13
3.
8 / 500
0.67
TGTCTGTGGTACTGCAGACT
small heat map img p-value: 0.29
pct_center: 0.08
pct_ratio: 0.49
4.
14 / 500
6.4e+2
AAAATATATTAAATT
small heat map img p-value: 1.00
pct_center: 0.10
pct_ratio: 0.27
5.
6 / 500
4.4e+2
TTGTGACTGCAGTTACCTTCGTGTGAAAA
small heat map img p-value: 0.10
pct_center: 0.04
pct_ratio: 0.47
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Snyder - ENCSR000EGM

1.
480 / 500
2.6e-947
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.63
2.
245 / 500
4.5e-119
CGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.76
pct_ratio: 2.65
3.
31 / 500
1.3e-11
AATAAAATAGTTTTGAAATTATAAAGAAA
small heat map img p-value: 0.78
pct_center: 0.16
pct_ratio: 0.35
4.
11 / 500
0.073
GAGGCTGCAGTACTACAGA
small heat map img p-value: 0.01
pct_center: 0.14
pct_ratio: 0.67
5.
17 / 500
23
GGGAAAAAGAAATG
small heat map img p-value: 0.09
pct_center: 0.22
pct_ratio: 0.51
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Stam - ENCSR000DWE

1.
498 / 500
3.4e-837
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.86
pct_ratio: 2.25
2.
119 / 500
7.1e-51
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.67
3.
4 / 500
0.000046
AAACCATTGTATGATAAGGTGACCAGAGC
small heat map img p-value: 0.62
pct_center: 0.06
pct_ratio: 0.54
4.
18 / 500
0.00013
ACTGGCCACCAGGGGGCGGCAGAGGCCT
small heat map img p-value: 0.00
pct_center: 0.45
pct_ratio: 1.72
5.
4 / 500
0.0017
TGGGGACCATTCCTGAGAAGACTGGGGGTA
small heat map img p-value: 0.67
pct_center: 0.09
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

LNCaP clone FGC - Iyer - ENCSR000DMF

1.
493 / 500
1.7e-1068
GCCACCAGGGGGCGCCGG
small heat map img p-value: 0.00
pct_center: 0.73
pct_ratio: 2.30
2.
10 / 500
1.0e-42
TGAGCGCGGCGCAGGCCCGGGCCCGGCGTG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.62
3.
108 / 500
8.8e-36
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.64
pct_ratio: 2.02
4.
5 / 500
1.1e-19
TTGTGTGCTATTACAACACATTGATGATTT
small heat map img p-value: 0.29
pct_center: 0.07
pct_ratio: 0.38
5.
9 / 500
4.7e-17
CGAAAGGGTTTGCCCTGAGA
small heat map img p-value: 0.79
pct_center: 0.06
pct_ratio: 0.52
MEME output

LNCaP clone FGC - Iyer - ENCSR000DME

1.
486 / 500
2.9e-1003
GGCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 2.72
2.
10 / 500
4.9e-35
TGGTCTAGCGGTAATGCCAGCGCCTGGG
small heat map img p-value: 0.01
pct_center: 0.08
pct_ratio: 0.65
3.
8 / 500
4.3e-27
GGCATGACAGAGGGCTCACAC
small heat map img p-value: 0.84
pct_center: 0.08
pct_ratio: 0.58
4.
6 / 500
1.6e-17
AGGCCCGGGCCCGGCGTGTCCGCGGTGCGC
small heat map img p-value: 0.12
pct_center: 0.17
pct_ratio: 0.62
5.
51 / 500
1.3e-32
GCGCCCCCTAGTGGCCAGAGGTGGAACTG
small heat map img p-value: 0.00
pct_center: 0.41
pct_ratio: 1.91
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF-7 - Iyer - ENCSR000DMS

1.
500 / 500
1.7e-956
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.79
pct_ratio: 2.64
2.
147 / 500
6.5e-15
CTGCAGTG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.68
3.
51 / 500
0.000066
CCAGCAGGAAG
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 0.88
4.
6 / 500
0.054
CTGAGTGCTGTACAATGATGTCAGCAGTT
small heat map img p-value: 0.33
pct_center: 0.06
pct_ratio: 0.49
5.
61 / 500
1.3e+2
CAGCCTGG
small heat map img p-value: 1.00
pct_center: 0.22
pct_ratio: 0.48
MEME output

MCF-7 - Iyer - ENCSR000DMR

1.
490 / 500
1.7e-975
CCACCAGGGGGCGCTAGA
small heat map img p-value: 0.00
pct_center: 0.77
pct_ratio: 2.48
2.
101 / 500
8.3e-34
GCCAGCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.67
pct_ratio: 2.37
3.
14 / 500
1.8
ACACTGCAGGAGAAA
small heat map img p-value: 0.32
pct_center: 0.13
pct_ratio: 0.50
4.
64 / 500
1.3e+3
ACAGGCTG
small heat map img p-value: 0.14
pct_center: 0.22
pct_ratio: 0.62
5.
59 / 500
3.2e+3
CAGGGCTG
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.66
MEME output

MCF-7 - Iyer - ENCSR000DMO

1.
482 / 500
8.0e-930
CCACCAGGGGGCGCCG
small heat map img p-value: 0.00
pct_center: 0.79
pct_ratio: 1.76
2.
78 / 500
2.4e-18
CAGCAGCTGCAGCAG
small heat map img p-value: 0.01
pct_center: 0.38
pct_ratio: 0.78
3.
145 / 500
5.2e-8
CAGGGCTG
small heat map img p-value: 0.15
pct_center: 0.36
pct_ratio: 0.67
4.
30 / 500
4.6
ATGGCTGGACTGCAG
small heat map img p-value: 0.52
pct_center: 0.21
pct_ratio: 0.60
5.
19 / 500
3.8e+3
GTGGCTGGTGCTGCC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.69
MEME output

MCF-7 - Iyer - ENCSR000DMV

1.
493 / 500
7.6e-1053
CGGCCACCAGGGGGCGCCGGG
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 1.79
2.
56 / 500
6.1e-11
TGCAGGTGCAG
small heat map img p-value: 0.05
pct_center: 0.31
pct_ratio: 0.73
3.
33 / 500
0.79
TGGCCAGCAGGTGGC
small heat map img p-value: 0.00
pct_center: 0.58
pct_ratio: 1.63
4.
8 / 500
1.6e+4
TGGCCAATGGCGTGGCTGCAGAGCTGACA
small heat map img p-value: 0.16
pct_center: 0.26
pct_ratio: 0.73
5.
8 / 500
1.1e+4
AACAGGAAAGAAACATGCCT
small heat map img p-value: 0.00
pct_center: 0.08
pct_ratio: 0.50
MEME output

MCF-7 - Iyer - ENCSR000DML

1.
487 / 500
3.7e-1033
GGCCACCAGGGGGCGCCGGGG
small heat map img p-value: 0.00
pct_center: 0.82
pct_ratio: 1.68
2.
59 / 500
3.1e-13
CAGAGGCTGCTGCAG
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 0.82
3.
23 / 500
2.7e+3
GCAGAGGGCAG
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 0.87
4.
25 / 500
44
TCAGGGCAGGGGCTGTGGCTG
small heat map img p-value: 0.77
pct_center: 0.24
pct_ratio: 0.61
5.
4 / 500
2.1e+5
ATGAGGAAGTCTGAAAATGTG
small heat map img p-value: 0.21
pct_center: 0.07
pct_ratio: 0.44
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF-7 - Myers - ENCSR000AHD

1.
410 / 500
3.0e-685
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.88
pct_ratio: 3.63
2.
119 / 500
3.0e-37
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 3.49
3.
53 / 500
4.3e-31
AATAAAAGAAATTAAAAAATATTAAAAAA
small heat map img p-value: 1.00
pct_center: 0.20
pct_ratio: 0.32
4.
13 / 500
0.0015
CAGGACACCAGGGGG
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.71
5.
24 / 500
4.4e+2
AAAGAAAGAAAGCAT
small heat map img p-value: 0.93
pct_center: 0.19
pct_ratio: 0.36
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

MCF-7 - Stam - ENCSR000DWH

1.
500 / 500
8.6e-868
CCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 3.03
2.
42 / 500
8.8e-8
CACCAGGGGGCGCTG
small heat map img p-value: 0.00
pct_center: 0.43
pct_ratio: 2.01
3.
79 / 500
0.000037
CAGGGGGAGGAACTGCAGGAA
small heat map img p-value: 0.65
pct_center: 0.25
pct_ratio: 0.59
4.
42 / 500
0.0012
AAAGGAAAAGA
small heat map img p-value: 1.00
pct_center: 0.24
pct_ratio: 0.97
5.
8 / 500
1.8e+4
AACGGGAAACAACAAGGCCTTGCAG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.57
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

NB4 - Stam - ENCSR000DWN

1.
500 / 500
1.4e-1007
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.88
pct_ratio: 2.91
2.
106 / 500
3.0e-33
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.79
3.
64 / 500
2.5e-19
CCACCAGGGGGCAGC
small heat map img p-value: 0.00
pct_center: 0.73
pct_ratio: 2.69
4.
6 / 500
1.4e-18
GGTCTAGCGGTAACGCCAGTGCCTGGGAAG
small heat map img p-value: 0.69
pct_center: 0.11
pct_ratio: 0.59
5.
6 / 500
3.1e-18
AGTGTGAGCCCTCTGTTATGCCCGGACAGG
small heat map img p-value: 0.82
pct_center: 0.08
pct_ratio: 0.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

SK-N-SH - Myers - ENCSR000BLX

1.
494 / 500
4.6e-781
CCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 3.04
2.
96 / 500
4.9e-50
AGTGGCCACCAGGGGGCGCCA
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 3.40
3.
113 / 500
4.3e-11
AGGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.71
4.
9 / 500
2.4e+2
GTGTTATTTGTCATAAAATAA
small heat map img p-value: 0.70
pct_center: 0.06
pct_ratio: 0.41
5.
21 / 500
1.0e+4
CTGATGCTGGTGCTG
small heat map img p-value: 0.12
pct_center: 0.18
pct_ratio: 0.63
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

SK-N-SH - Snyder - ENCSR000EIC

1.
499 / 500
1.4e-815
CCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.86
pct_ratio: 3.49
2.
66 / 500
1.1e-10
CTGAGAAAAAA
small heat map img p-value: 0.36
pct_center: 0.22
pct_ratio: 0.45
3.
6 / 500
1.4e+3
CAAGTAACATTTATGATTGTT
small heat map img p-value: 1.00
pct_center: 0.11
pct_ratio: 0.33
4.
6 / 500
8.4e+3
TGATTGTCATTTTT
small heat map img p-value: 0.54
pct_center: 0.09
pct_ratio: 0.46
5.
29 / 500
15
AGTTGTGTGCTGCAG
small heat map img p-value: 0.10
pct_center: 0.10
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

SK-N-SH - Stam - ENCSR000DXQ

1.
490 / 500
4.3e-919
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 2.37
2.
72 / 500
3.5e-26
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.80
3.
20 / 500
0.0000030
TTTCCCAGCGGCCACCAGGGGGCGGCGCAG
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 1.98
4.
17 / 500
2.3e+2
AAACAGAAAAGCAAA
small heat map img p-value: 0.83
pct_center: 0.19
pct_ratio: 0.40
5.
6 / 500
3.6e+4
CTAATGGGAAACTCCAAGCTGTGGCTGAG
small heat map img p-value: 0.11
pct_center: 0.09
pct_ratio: 0.57
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

T47D - Myers - ENCSR000BNO

1.
461 / 500
8.2e-860
GCCACCAGGGGGCGCCGTA
small heat map img p-value: 0.00
pct_center: 0.91
pct_ratio: 2.77
2.
293 / 500
2.9e-225
GGCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.86
pct_ratio: 2.72
3.
28 / 500
0.000046
AAATTTTTGTTTGTT
small heat map img p-value: 1.00
pct_center: 0.15
pct_ratio: 0.30
4.
4 / 500
0.47
TACTGCAGCCTCGCTGGTGCTGTAGTAA
small heat map img p-value: 0.06
pct_center: 0.08
pct_ratio: 0.67
5.
6 / 500
1.7e+2
TGCTATTAAAATAAATTGATGTCGTG
small heat map img p-value: 0.14
pct_center: 0.05
pct_ratio: 0.40
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

WERI-Rb-1 - Stam - ENCSR000DXW

1.
496 / 500
7.7e-900
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 2.25
2.
124 / 500
2.0e-16
GGCTGCTG
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.72
3.
5 / 500
0.0098
TCAGGGCTGTGCTTGATCTGGAAAAGGA
small heat map img p-value: 0.80
pct_center: 0.09
pct_ratio: 0.54
4.
14 / 500
43
GAGGCAGGGAGAGCCCAGGCC
small heat map img p-value: 0.00
pct_center: 0.37
pct_ratio: 0.72
5.
54 / 500
0.075
AGGAGGAAGAGCAGGGAGCA
small heat map img p-value: 1.00
pct_center: 0.36
pct_ratio: 0.48
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

WI38 - Stam - ENCSR000DYB

1.
491 / 500
1.7e-832
GCCACCAGGGGGCGCC
small heat map img p-value: 0.00
pct_center: 0.87
pct_ratio: 2.85
2.
251 / 500
2.1e-153
CAGGGGGGGAACTGCAGCCCC
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.60
3.
44 / 500
0.0000042
TGGCCACTAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.71
pct_ratio: 2.58
4.
5 / 500
6.7e+2
TGTAGTAAGTTGTGGTACTGG
small heat map img p-value: 0.19
pct_center: 0.05
pct_ratio: 0.48
5.
34 / 500
2.6e+4
AGCAGCCTGAG
small heat map img p-value: 1.00
pct_center: 0.28
pct_ratio: 0.45
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

astrocyte - Bernstein - ENCSR000AOO

1.
488 / 500
1.3e-1157
GCCACTAGGTGGCGCTA
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 3.72
2.
195 / 500
8.0e-26
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.80
3.
49 / 500
5.2e-9
GGCCACTAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.77
pct_ratio: 3.07
4.
17 / 500
4.3e+4
CAGGTTGCTTTAAAA
small heat map img p-value: 1.00
pct_center: 0.10
pct_ratio: 0.34
5.
20 / 500
2.9e+4
GAGAAAAACTAAAGGGAGCTG
small heat map img p-value: 0.96
pct_center: 0.19
pct_ratio: 0.44
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

astrocyte of the cerebellum - Stam - ENCSR000DSZ

1.
497 / 500
1.9e-834
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 3.11
2.
162 / 500
3.1e-59
AGGGGAACTGCAGCC
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.70
3.
34 / 500
9.8e-13
TTCACCACTAGAGGGCAGCAG
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 1.32
4.
16 / 500
3.1
AGGAAAAGAAAAACA
small heat map img p-value: 1.00
pct_center: 0.15
pct_ratio: 0.35
5.
5 / 500
1.6e+2
AGCTGATGCAATGTT
small heat map img p-value: 0.64
pct_center: 0.06
pct_ratio: 0.51
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

astrocyte of the spinal cord - Stam - ENCSR000DSU

1.
499 / 500
1.8e-936
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 2.71
2.
160 / 500
9.7e-82
AGGGGGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.70
3.
40 / 500
1.2e-10
TGCCCCCTAGTGGCCAAAGCGGGAAATGC
small heat map img p-value: 0.00
pct_center: 0.66
pct_ratio: 2.85
4.
17 / 500
2.6
AGAAAAGAAAAAAAA
small heat map img p-value: 0.37
pct_center: 0.22
pct_ratio: 0.47
5.
26 / 500
86
CAGCCTGG
small heat map img p-value: 1.00
pct_center: 0.19
pct_ratio: 0.45
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

brain microvascular endothelial cell - Stam - ENCSR000DTA

1.
499 / 500
3.3e-1033
GCCACCAGGGGGCGCCG
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.61
2.
142 / 500
5.5e-40
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.68
3.
63 / 500
3.0e-14
GCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.63
pct_ratio: 2.90
4.
51 / 500
0.91
CAGCCTGG
small heat map img p-value: 1.00
pct_center: 0.23
pct_ratio: 0.48
5.
42 / 500
45
CAGCAAGCAGAGGCA
small heat map img p-value: 0.77
pct_center: 0.26
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

bronchial epithelial cell - Stam - ENCSR000DXI

1.
494 / 500
1.1e-915
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 2.49
2.
63 / 500
4.7e-17
CAAAGGGGGAACTGCAGCCT
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 0.67
3.
10 / 500
3.2e+2
CACCAGAAAAAGGCAGAGCTG
small heat map img p-value: 0.33
pct_center: 0.21
pct_ratio: 0.65
4.
24 / 500
1.5e+3
AGCGGCCACTAGAGGGCG
small heat map img p-value: 0.00
pct_center: 0.68
pct_ratio: 3.17
5.
43 / 500
7.2e+3
CTGCAGGAAGA
small heat map img p-value: 0.83
pct_center: 0.21
pct_ratio: 0.59
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

cardiac fibroblast - Stam - ENCSR000DTF

1.
499 / 500
7.0e-917
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 2.77
2.
161 / 500
6.6e-53
GGGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.67
3.
8 / 500
0.46
AAGCCTAGCATTGCGCCAGCTGGCAAAGGG
small heat map img p-value: 0.35
pct_center: 0.09
pct_ratio: 0.62
4.
13 / 500
6.9
TCTGCTGCCCCCTGGTGGTCAGAGCTGGAA
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 1.52
5.
56 / 500
9.9e+2
CAGGAAGGAAGGGC
small heat map img p-value: 0.25
pct_center: 0.32
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

cardiac muscle cell - Stam - ENCSR000DTI

1.
490 / 500
2.6e-815
CACCAGGGGGCGCCA
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 2.59
2.
126 / 500
5.8e-52
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.62
3.
65 / 500
2.9e-20
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 2.88
4.
9 / 500
0.16
GCCTAGCATTGTGCCAGCTGGCAAATGGGA
small heat map img p-value: 0.27
pct_center: 0.10
pct_ratio: 0.62
5.
14 / 500
89
GAGGCTGAAGTGCCAGAGAAG
small heat map img p-value: 0.22
pct_center: 0.21
pct_ratio: 0.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

choroid plexus epithelial cell - Stam - ENCSR000DTL

1.
495 / 500
1.1e-910
CCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.73
pct_ratio: 2.80
2.
113 / 500
4.6e-31
AGGCTGCAGTTCCAGCATTTG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.78
3.
56 / 500
2.6e-8
GGCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 2.92
4.
8 / 500
3.2e+3
TTTTCCTTTGCTAGCTGGCGCGATGCTAGG
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.69
5.
63 / 500
4.6e+2
CAGCCTGG
small heat map img p-value: 1.00
pct_center: 0.21
pct_ratio: 0.46
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

endothelial cell of umbilical vein - Bernstein - ENCSR000ALA

1.
500 / 500
3.4e-879
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.87
pct_ratio: 2.42
2.
73 / 500
1.8e-8
GGAACTGCAG
small heat map img p-value: 0.07
pct_center: 0.23
pct_ratio: 0.61
3.
15 / 500
1.1e-7
AGAAATATTTGTTTTTGTTTT
small heat map img p-value: 0.98
pct_center: 0.15
pct_ratio: 0.39
4.
46 / 500
2.4e-12
AGTGGCCACCAGGGGGCA
small heat map img p-value: 0.00
pct_center: 0.72
pct_ratio: 3.06
5.
9 / 500
0.77
ACTAGTTGGGTTTATTTTATGAGAAT
small heat map img p-value: 0.69
pct_center: 0.04
pct_ratio: 0.40
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

endothelial cell of umbilical vein - Iyer - ENCSR000DLW

1.
493 / 500
2.0e-1163
GTGCCATCTAGTGGT
small heat map img p-value: 0.00
pct_center: 0.79
pct_ratio: 4.02
2.
51 / 500
2.7e-11
ATGTGGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.71
3.
28 / 500
7.0e-10
TGACCACTAGGGGGCAGTA
small heat map img p-value: 0.00
pct_center: 0.56
pct_ratio: 4.00
4.
5 / 500
0.0026
AGTTACACCAATGGATTGTAATACTGGT
small heat map img p-value: 0.01
pct_center: 0.06
pct_ratio: 0.48
5.
6 / 500
0.64
TGTACATTACCAGAAACGTTAATATAAAAG
small heat map img p-value: 0.02
pct_center: 0.07
pct_ratio: 0.40
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

endothelial cell of umbilical vein - Stam - ENCSR000DVP

1.
496 / 500
1.0e-785
CGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 2.57
2.
56 / 500
4.7e-14
GCCAGCAGGGGGCGCTGGAG
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 2.25
3.
58 / 500
3.0e-8
GGCTGCAGTTC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.71
4.
9 / 500
8.4
AAAAAGAAAA
small heat map img p-value: 0.37
pct_center: 0.13
pct_ratio: 0.40
5.
30 / 500
1.9e+3
CGGCTCTGGCTGCAG
small heat map img p-value: 0.19
pct_center: 0.23
pct_ratio: 0.61
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

epithelial cell of esophagus - Stam - ENCSR000DTR

1.
492 / 500
3.1e-757
CACCAGAGGGCGC
small heat map img p-value: 0.00
pct_center: 0.74
pct_ratio: 2.63
2.
166 / 500
7.3e-68
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.79
3.
77 / 500
1.3e-32
GCCACCAGAGGGCG
small heat map img p-value: 0.00
pct_center: 0.70
pct_ratio: 3.00
4.
6 / 500
0.00014
TTTGGTGCTGTAGTAAGCTGCGGTACTGGA
small heat map img p-value: 0.16
pct_center: 0.07
pct_ratio: 0.59
5.
103 / 500
0.18
GGCAGAAA
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.57
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

epithelial cell of proximal tubule - Stam - ENCSR000DXD

1.
486 / 500
4.2e-1004
TGGCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 3.04
2.
116 / 500
1.9e-67
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.71
pct_ratio: 2.77
3.
76 / 500
3.0e-18
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.74
4.
27 / 500
2.9e+3
AGAAAAGGGAA
small heat map img p-value: 0.07
pct_center: 0.23
pct_ratio: 0.51
5.
14 / 500
3.6e+3
CCTCCAGGGGCTGGA
small heat map img p-value: 0.39
pct_center: 0.22
pct_ratio: 0.62
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of dermis - Bernstein - ENCSR000APM

1.
494 / 500
1.4e-965
GCGCCCTCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 2.82
2.
162 / 500
1.8e-27
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.72
3.
54 / 500
2.1e-19
TGGCCACTAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.71
pct_ratio: 3.05
4.
46 / 500
0.11
CAGCCTGG
small heat map img p-value: 1.00
pct_center: 0.16
pct_ratio: 0.40
5.
28 / 500
7.5e+2
AACTGCCAGGGCAGG
small heat map img p-value: 0.60
pct_center: 0.21
pct_ratio: 0.57
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of gingiva - Stam - ENCSR000DPS

1.
496 / 500
4.0e-975
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 2.66
2.
105 / 500
7.7e-50
GGTGGAACTGCAGCC
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.62
3.
64 / 500
3.4e-12
AGCGGCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.69
pct_ratio: 2.46
4.
64 / 500
1.1e+2
GGGAAGGAGGA
small heat map img p-value: 0.25
pct_center: 0.27
pct_ratio: 0.51
5.
35 / 500
2.1e+2
CAGCCTGG
small heat map img p-value: 1.00
pct_center: 0.19
pct_ratio: 0.46
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of lung - Bernstein - ENCSR000ANO

1.
478 / 500
4.9e-926
TGTGGCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 2.44
2.
95 / 500
7.6e-25
GAGGCTGCAGTTCC
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.70
3.
59 / 500
6.6e-12
GCCACCAGAGGGCG
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 2.71
4.
20 / 500
7.5
CTGGAACTGCTGCAG
small heat map img p-value: 0.91
pct_center: 0.15
pct_ratio: 0.63
5.
12 / 500
1.1e+3
AAAGCGTATTCTAGCAAAAAA
small heat map img p-value: 0.96
pct_center: 0.07
pct_ratio: 0.37
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of lung - Stam - ENCSR000DPM

1.
497 / 500
3.6e-977
GGCGCCCCCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.78
2.
101 / 500
2.9e-38
GGGAACTGCAGCC
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.81
3.
75 / 500
0.0000029
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.72
pct_ratio: 3.04
4.
75 / 500
14
AGCCAGAG
small heat map img p-value: 1.00
pct_center: 0.26
pct_ratio: 0.43
5.
5 / 500
0.0046
TCGCTGGTGCTGTAGTAAGCCGCGGTACTG
small heat map img p-value: 0.19
pct_center: 0.06
pct_ratio: 0.51
MEME output

fibroblast of lung - Stam - ENCSR000DVA

1.
497 / 500
1.6e-953
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.98
2.
243 / 500
1.8e-100
TGTGGAACTGCAGCC
small heat map img p-value: 0.06
pct_center: 0.22
pct_ratio: 0.58
3.
21 / 500
0.51
AGGTGGCAGCA
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 1.11
4.
6 / 500
2.2e+3
AGCTGGTGCAATGTTAGGCTT
small heat map img p-value: 0.36
pct_center: 0.06
pct_ratio: 0.55
5.
6 / 500
2.7e+2
CCAGGGATGCTGCTAGGCTTTCTACATTG
small heat map img p-value: 0.01
pct_center: 0.09
pct_ratio: 0.60
MEME output

fibroblast of lung - Stam - ENCSR000DWY

1.
481 / 500
7.8e-928
GGCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.85
pct_ratio: 2.62
2.
129 / 500
1.1e-55
TGGAACTGCAGCC
small heat map img p-value: 0.12
pct_center: 0.18
pct_ratio: 0.54
3.
87 / 500
1.2e-22
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 2.63
4.
34 / 500
9.4
CTGCAGGGAAGGGAAAGAAAG
small heat map img p-value: 0.29
pct_center: 0.33
pct_ratio: 0.52
5.
6 / 500
5.5e+2
TAACATTGCACCAGCTGGAAAATTAGAAAT
small heat map img p-value: 0.75
pct_center: 0.08
pct_ratio: 0.49
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of mammary gland - Stam - ENCSR000DUU

1.
500 / 500
1.3e-1039
CCACTAGAGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 3.17
2.
159 / 500
6.3e-50
AGGGGAACTGCAGG
small heat map img p-value: 0.00
pct_center: 0.17
pct_ratio: 0.67
3.
88 / 500
7.2e-22
GCCACCAGGGGGCAG
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 2.47
4.
12 / 500
4.8e-20
AAAGCCTAGCATTGTGCCAGCTGGCAAAGA
small heat map img p-value: 0.00
pct_center: 0.08
pct_ratio: 0.57
5.
55 / 500
2.8e+3
CAGGGAAG
small heat map img p-value: 0.09
pct_center: 0.18
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of pedal digit skin - Stam - ENCSR000DPP

1.
497 / 500
4.9e-973
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 2.74
2.
116 / 500
3.0e-33
GGAACTGCAGG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.77
3.
61 / 500
3.5e-13
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 3.01
4.
28 / 500
67
AGAGAGCA
small heat map img p-value: 0.44
pct_center: 0.09
pct_ratio: 0.57
5.
5 / 500
2.1e+3
GCCTAGCATCGTACCAGCTGGCAAAGGAGA
small heat map img p-value: 0.36
pct_center: 0.13
pct_ratio: 0.63
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of pulmonary artery - Stam - ENCSR000DUX

1.
498 / 500
1.5e-1014
AGCGCCCTCTGGTGG
small heat map img p-value: 0.00
pct_center: 0.76
pct_ratio: 2.89
2.
128 / 500
1.2e-48
AGGCTGCAGTTCCA
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.68
3.
9 / 500
3.2e-8
AAGCCTAGCATTGCACCAGCTGGCAAAGGA
small heat map img p-value: 0.13
pct_center: 0.11
pct_ratio: 0.60
4.
69 / 500
1.0e-8
GGCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.70
pct_ratio: 2.21
5.
15 / 500
0.025
AGAGGGAGACTGCAAGAATGGAGAAGGAA
small heat map img p-value: 0.64
pct_center: 0.21
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of skin of abdomen - Stam - ENCSR000DPV

1.
499 / 500
1.3e-1101
GCCACTAGAGGGCGCTAG
small heat map img p-value: 0.00
pct_center: 0.79
pct_ratio: 3.11
2.
113 / 500
4.5e-48
TGGGGAACTGCAGCC
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.72
3.
84 / 500
6.2e-34
TGGCCACCAGAGGGCGC
small heat map img p-value: 0.00
pct_center: 0.76
pct_ratio: 2.61
4.
10 / 500
0.000012
AAGCGTAGCATTGTGCCAGCTGGCAAATAA
small heat map img p-value: 0.17
pct_center: 0.07
pct_ratio: 0.52
5.
10 / 500
3.5e+2
CTGTTTCTGTTGCTG
small heat map img p-value: 0.25
pct_center: 0.16
pct_ratio: 0.56
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of the aortic adventitia - Stam - ENCSR000DPY

1.
499 / 500
1.6e-922
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.79
pct_ratio: 2.70
2.
201 / 500
1.2e-80
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.68
3.
21 / 500
0.000025
ATTGACCACGAGAGGGCAGCA
small heat map img p-value: 0.00
pct_center: 0.38
pct_ratio: 2.07
4.
8 / 500
0.074
AACATTGCACCAGCTGGGAAAGGAGAAA
small heat map img p-value: 0.05
pct_center: 0.09
pct_ratio: 0.53
5.
8 / 500
4.6
AGAGGGAGCCTGGAAGGCGGGAGGAGGGAA
small heat map img p-value: 0.91
pct_center: 0.33
pct_ratio: 0.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of upper leg skin - Stam - ENCSR000DPG

1.
494 / 500
2.9e-863
CCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.76
pct_ratio: 2.41
2.
136 / 500
2.4e-20
GGAGGCTGCAG
small heat map img p-value: 0.00
pct_center: 0.31
pct_ratio: 0.75
3.
41 / 500
0.0023
CTGGCCAGCAGGTGG
small heat map img p-value: 0.00
pct_center: 0.42
pct_ratio: 1.26
4.
27 / 500
1.2e+2
GCAGGAGGAAG
small heat map img p-value: 0.42
pct_center: 0.32
pct_ratio: 0.59
5.
23 / 500
1.1e+3
CGGCAGGGGGCGCTG
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 1.39
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

fibroblast of villous mesenchyme - Stam - ENCSR000DVQ

1.
494 / 500
6.8e-924
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.82
pct_ratio: 2.79
2.
177 / 500
3.8e-78
TGGGGAACTGCAGCC
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.69
3.
40 / 500
7.5e-10
TTGTCCACCAGGGGGCACCAG
small heat map img p-value: 0.00
pct_center: 0.57
pct_ratio: 2.69
4.
5 / 500
0.0011
CTGGTGCTGTAGTAAGCCATGGTACTGGA
small heat map img p-value: 0.18
pct_center: 0.06
pct_ratio: 0.60
5.
39 / 500
0.0012
CAGAGAGAAAA
small heat map img p-value: 0.05
pct_center: 0.24
pct_ratio: 0.47
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

foreskin fibroblast - Stam - ENCSR000DUH

1.
490 / 500
4.4e-957
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.87
pct_ratio: 2.99
2.
131 / 500
1.6e-30
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.67
3.
44 / 500
0.000041
AGTGGCCACCAGGGGGCA
small heat map img p-value: 0.00
pct_center: 0.69
pct_ratio: 2.94
4.
30 / 500
0.23
GGGGAAGGGAAATGA
small heat map img p-value: 0.79
pct_center: 0.27
pct_ratio: 0.53
5.
16 / 500
9.1
AAATGACAGCAATTTGCTGAG
small heat map img p-value: 0.62
pct_center: 0.15
pct_ratio: 0.49
MEME output

foreskin fibroblast - Stam - ENCSR000DWQ

1.
500 / 500
7.0e-951
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.95
2.
106 / 500
2.5e-31
TGGGGAACTGCAGCC
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.68
3.
68 / 500
2.2e-22
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.71
pct_ratio: 2.69
4.
8 / 500
3.0
TTTTCTTTTGCCTGCTGGTGCAATGTTA
small heat map img p-value: 0.02
pct_center: 0.13
pct_ratio: 0.50
5.
8 / 500
3.0e+2
TGTAGGATGAAAAGCAGCTTCCCTGGCCT
small heat map img p-value: 0.33
pct_center: 0.09
pct_ratio: 0.60
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

keratinocyte - Bernstein - ENCSR000ALJ

1.
499 / 500
5.5e-847
CCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 2.97
2.
183 / 500
3.8e-64
GGTGGAACTGCAGCC
small heat map img p-value: 0.23
pct_center: 0.23
pct_ratio: 0.59
3.
55 / 500
1.6e-10
TGGCCACTAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.71
pct_ratio: 3.05
4.
71 / 500
0.79
AGGCAGAAGAG
small heat map img p-value: 1.00
pct_center: 0.27
pct_ratio: 0.48
5.
5 / 500
6.0
GGGTGCTGTAGTAAGCCATGGTACTGGAG
small heat map img p-value: 0.97
pct_center: 0.10
pct_ratio: 0.46
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

keratinocyte - Iyer - ENCSR000DNC

1.
500 / 500
1.7e-946
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.80
pct_ratio: 2.10
2.
79 / 500
5.6e-14
GGGAGCACTGCAGCA
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.71
3.
75 / 500
1.8e-7
TGCAGGCACAG
small heat map img p-value: 0.01
pct_center: 0.22
pct_ratio: 0.70
4.
85 / 500
1.6e+3
TGGGTGCA
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.73
5.
21 / 500
1.3e+3
GGAGGGCGGCGCTGCGCAGC
small heat map img p-value: 0.02
pct_center: 0.29
pct_ratio: 0.70
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

keratinocyte - Stam - ENCSR000DWX

1.
485 / 500
1.5e-791
CCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.81
pct_ratio: 2.81
2.
140 / 500
6.4e-39
GGGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.77
3.
14 / 500
0.0030
TATTCACCACCAGGTGGCAGCAGAGAGC
small heat map img p-value: 0.00
pct_center: 0.41
pct_ratio: 1.75
4.
42 / 500
8.0e+3
CAGAGCCCAGGACTG
small heat map img p-value: 0.03
pct_center: 0.26
pct_ratio: 0.63
5.
6 / 500
2.0e+4
AAAAAGAAAT
small heat map img p-value: 0.31
pct_center: 0.13
pct_ratio: 0.36
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

kidney - Iyer - ENCSR000DMC

1.
488 / 500
2.9e-1086
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.59
pct_ratio: 1.89
2.
123 / 500
3.4e-57
AATTGGGGAACTGCA
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.70
3.
9 / 500
1.3e-35
GCAGGCCCGGGCCCGGCGTGTCCGCGGTGC
small heat map img p-value: 0.00
pct_center: 0.25
pct_ratio: 0.64
4.
11 / 500
5.0e-23
CAGAGAGCCAGGCGCGCCCCGCGGAGGAGC
small heat map img p-value: 0.80
pct_center: 0.36
pct_ratio: 0.92
5.
4 / 500
1.5e-11
ACGTTTGGCCTTAGCGGTGGACCTGAGTCT
small heat map img p-value: 0.06
pct_center: 0.05
pct_ratio: 0.55
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

kidney epithelial cell - Stam - ENCSR000DVH

1.
494 / 500
9.3e-943
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 2.66
2.
116 / 500
2.1e-31
GGAACTGCAGG
small heat map img p-value: 0.00
pct_center: 0.22
pct_ratio: 0.75
3.
92 / 500
1.3e-18
CCAGCAGGTGGCGCT
small heat map img p-value: 0.00
pct_center: 0.78
pct_ratio: 2.31
4.
5 / 500
4.3e+4
TGGGGTCTTGGTCCTAATATAGAGAAA
small heat map img p-value: 0.07
pct_center: 0.06
pct_ratio: 0.43
5.
14 / 500
3.9e+4
AGGAAGAACAAGAGG
small heat map img p-value: 0.88
pct_center: 0.25
pct_ratio: 0.46
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

lung - Iyer - ENCSR000DMH

1.
497 / 500
3.1e-1031
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.60
pct_ratio: 1.85
2.
65 / 500
8.5e-33
TGGCCACCAGGTGGCGCTGCA
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 1.92
3.
9 / 500
4.1e-27
TAGTGCACTGCATGAGACCATTGCTAAAG
small heat map img p-value: 0.69
pct_center: 0.06
pct_ratio: 0.59
4.
64 / 500
3.7e-20
TTGGGAACTGCAGCC
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.70
5.
9 / 500
1.6e-18
GTAGGATTAAACGTCACCGCCGTGGGCTGA
small heat map img p-value: 0.00
pct_center: 0.05
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

mammary epithelial cell - Bernstein - ENCSR000ALV

1.
490 / 500
7.4e-946
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.83
pct_ratio: 3.28
2.
189 / 500
4.8e-77
GGGGGAACTGCAGCC
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.76
3.
55 / 500
0.0022
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 3.25
4.
5 / 500
0.0030
CTGGTGCTGTAGTAAGCCGCGGTACTGGA
small heat map img p-value: 0.50
pct_center: 0.06
pct_ratio: 0.57
5.
25 / 500
8.7
GGGAATGAGGAGCAGAGTCTG
small heat map img p-value: 0.69
pct_center: 0.19
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

mammary epithelial cell - Stam - ENCSR000DUS

1.
494 / 500
7.9e-925
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.79
pct_ratio: 2.59
2.
51 / 500
3.5e-21
AGAGGGGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.65
3.
62 / 500
5.6e-24
AGTGGCCACTAGGGGGCAGCG
small heat map img p-value: 0.00
pct_center: 0.67
pct_ratio: 2.51
4.
51 / 500
0.19
CCAGCAGGTGG
small heat map img p-value: 0.00
pct_center: 0.44
pct_ratio: 1.20
5.
28 / 500
2.7e+2
TCCTGGGAGCGCAGC
small heat map img p-value: 0.00
pct_center: 0.26
pct_ratio: 0.78
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

medulloblastoma - Iyer - ENCSR000DMY

1.
499 / 500
1.4e-1116
GCCACTAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.71
pct_ratio: 2.60
2.
97 / 500
9.6e-48
GCCAGCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.67
pct_ratio: 2.45
3.
9 / 500
2.9e-17
TGGAGGGACACTGCAGGAGGAAGGGGTTT
small heat map img p-value: 0.96
pct_center: 0.13
pct_ratio: 0.59
4.
7 / 500
1.8e-11
CAGCAAAGAGCAAATGATCAACAGTTTCTG
small heat map img p-value: 0.01
pct_center: 0.06
pct_ratio: 0.51
5.
46 / 500
3.9e-12
AAGAGGCTGCAATGCCTCAGA
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

myotube - Bernstein - ENCSR000ANS

1.
488 / 500
3.4e-1016
CCACCAGGGGGCGCT
small heat map img p-value: 0.00
pct_center: 0.79
pct_ratio: 2.91
2.
164 / 500
1.1e-14
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 0.70
3.
50 / 500
2.3e-9
TGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.61
pct_ratio: 2.46
4.
8 / 500
3.5e+2
AAGCCTAGCATTGTGTCAGCTGGGAAATA
small heat map img p-value: 0.45
pct_center: 0.09
pct_ratio: 0.58
5.
5 / 500
7.8e+3
AGACAGAAACAAGGTGGAACTGCAGTAC
small heat map img p-value: 0.03
pct_center: 0.07
pct_ratio: 0.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

osteoblast - Bernstein - ENCSR000APF

1.
499 / 500
1.9e-1011
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 2.47
2.
105 / 500
6.8e-26
GGAACTGCAGC
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 0.74
3.
66 / 500
1.2e-16
CGGCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.67
pct_ratio: 2.30
4.
41 / 500
1.6e+2
AAAAGAAA
small heat map img p-value: 0.58
pct_center: 0.15
pct_ratio: 0.44
5.
26 / 500
3.5e+4
AGAAAAGGGAA
small heat map img p-value: 0.06
pct_center: 0.22
pct_ratio: 0.53
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

pancreas - Iyer - ENCSR000DND

1.
495 / 500
4.6e-821
GCCACCAGGGGGC
small heat map img p-value: 0.00
pct_center: 0.66
pct_ratio: 2.10
2.
78 / 500
1.2e-23
ACTGGGGAACTGCAG
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.72
3.
5 / 500
6.2e-14
GCCAGAGAGCCAGGAGCGGCCCGCGGAGGA
small heat map img p-value: 0.01
pct_center: 0.29
pct_ratio: 0.66
4.
34 / 500
2.6e-13
GCAGGGGGCGCTGTG
small heat map img p-value: 0.00
pct_center: 0.27
pct_ratio: 0.93
5.
9 / 500
4.8e-10
GGCCCGGGCCCGGCGTGTCCGCGGTGCGCG
small heat map img p-value: 0.17
pct_center: 0.31
pct_ratio: 0.94
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

retinal pigment epithelial cell - Stam - ENCSR000DVI

1.
493 / 500
1.2e-855
CCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.79
pct_ratio: 2.94
2.
204 / 500
4.1e-65
GGTGGAACTGCAGCC
small heat map img p-value: 0.00
pct_center: 0.23
pct_ratio: 0.67
3.
5 / 500
0.0016
GCCTAACATTGCACCAGCTGGGAAAGAAGA
small heat map img p-value: 0.10
pct_center: 0.10
pct_ratio: 0.59
4.
34 / 500
0.0099
AGGTGGCAGCA
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 1.12
5.
32 / 500
1.3
AGGAAAGAGAAGCAG
small heat map img p-value: 1.00
pct_center: 0.22
pct_ratio: 0.46
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

skeletal muscle myoblast - Bernstein - ENCSR000ANE

1.
494 / 500
4.2e-965
GCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.76
pct_ratio: 3.30
2.
87 / 500
7.5e-24
AAGTGAGGAACTGCA
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 0.68
3.
58 / 500
1.2e-12
TGGCCACTAGAGGGC
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 3.16
4.
62 / 500
0.0015
AGGCTGCAGCCTCAG
small heat map img p-value: 0.79
pct_center: 0.22
pct_ratio: 0.56
5.
4 / 500
9.8e+3
TACAAAATGTGTGTGGGCCAATCTGCTAT
small heat map img p-value: 0.78
pct_center: 0.06
pct_ratio: 0.49
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

skin fibroblast - Iyer - ENCSR000DKL

1.
482 / 500
2.9e-819
GGCCACCAGGGGGCG
small heat map img p-value: 0.00
pct_center: 0.77
pct_ratio: 2.11
2.
223 / 500
9.2e-15
GGCTGCAG
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 0.79
3.
24 / 500
0.36
CCAGGTGGCGCTGT
small heat map img p-value: 0.00
pct_center: 0.32
pct_ratio: 1.69
4.
7 / 500
2.2e+3
AATGGCAGAATGGCAGCAAGG
small heat map img p-value: 0.03
pct_center: 0.19
pct_ratio: 0.63
5.
15 / 500
2.6e+4
TGTTGTCAGCT
small heat map img p-value: 0.06
pct_center: 0.12
pct_ratio: 0.58
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

spleen - Iyer - ENCSR000DNI

1.
500 / 500
6.8e-1111
GCCACCAGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.64
pct_ratio: 1.59
2.
87 / 500
1.5e-38
ATTTGTGGAACTGCA
small heat map img p-value: 0.00
pct_center: 0.09
pct_ratio: 0.63
3.
14 / 500
5.3e-33
CAGAGAGCCAGGCGCGCCCCGCGGAGGAG
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 0.64
4.
8 / 500
8.9e-20
GCAGGCCCGGGCCCGGCGTGTCCGCGGTGC
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 1.01
5.
63 / 500
6.0e-13
TGGCCAGCAGGTGGC
small heat map img p-value: 0.00
pct_center: 0.49
pct_ratio: 1.35
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at CTCF peaks

A549 - Bernstein - ENCSR000AUE

A549
Bernstein
CTCF
ENCSR000AUE
r=1.00

small heat map img

A549
Bernstein
CTCF
ENCSR000AUF
r=0.97

small heat map img

A549
Bernstein
CTCF
ENCSR000DYD
r=0.83

small heat map img

A549
Bernstein
CTCF
ENCSR000DPF
r=0.75

small heat map img

A549
Bernstein
CTCF
ENCSR000DNA
r=0.72

small heat map img

A549
Bernstein
CTCF
ENCSR000BHW
r=0.66

small heat map img

A549
Bernstein
CTCF
ENCSR000BHV
r=0.66

small heat map img

A549
Bernstein
H2AFZ
ENCSR000AUG
r=0.19

small heat map img

A549
Bernstein
H2AFZ
ENCSR000AUH
r=0.18

small heat map img

A549
Bernstein
H3K4me1
ENCSR000AUM
r=0.14

small heat map img

A549
Bernstein
H3K4me2
ENCSR000AVI
r=0.13

small heat map img

A549
Bernstein
H3K4me1
ENCSR000AVH
r=0.13

small heat map img

A549
Bernstein
H3K4me2
ENCSR000ATO
r=0.12

small heat map img

A549
Bernstein
H4K20me1
ENCSR000AUO
r=0.10

small heat map img

A549
Bernstein
H3K4me3
ENCSR000ASH
r=0.10

small heat map img

A549
Bernstein
H3K9ac
ENCSR000ASV
r=0.09

small heat map img

A549
Bernstein
H3K4me3
ENCSR000AST
r=0.09

small heat map img

A549
Bernstein
H3K27ac
ENCSR000AVF
r=0.09

small heat map img

A549
Bernstein
H3K4me3
ENCSR000DPD
r=0.07

small heat map img

A549
Bernstein
H3K27ac
ENCSR000AUI
r=0.07

small heat map img

A549
Bernstein
H3K27me3
ENCSR000AUK
r=0.03

small heat map img

A549
Bernstein
H3K27me3
ENCSR000AUJ
r=0.02

small heat map img

A549
Bernstein
H3K36me3
ENCSR000AVG
r=0.01

small heat map img

A549
Bernstein
H3K36me3
ENCSR000AUL
r=0.01

small heat map img

A549
Bernstein
H3K79me2
ENCSR000ATP
r=-0.00

small heat map img

A549
Bernstein
H3K79me2
ENCSR000ASU
r=-0.01

small heat map img

A549
Bernstein
H3K9me3
ENCSR000AUN
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 64,485 (download )

A549 - Bernstein - ENCSR000AUF

A549
Bernstein
CTCF
ENCSR000AUF
r=1.00

small heat map img

A549
Bernstein
CTCF
ENCSR000AUE
r=0.97

small heat map img

A549
Bernstein
CTCF
ENCSR000DYD
r=0.82

small heat map img

A549
Bernstein
CTCF
ENCSR000DPF
r=0.75

small heat map img

A549
Bernstein
CTCF
ENCSR000DNA
r=0.72

small heat map img

A549
Bernstein
CTCF
ENCSR000BHV
r=0.65

small heat map img

A549
Bernstein
CTCF
ENCSR000BHW
r=0.64

small heat map img

A549
Bernstein
H2AFZ
ENCSR000AUG
r=0.17

small heat map img

A549
Bernstein
H2AFZ
ENCSR000AUH
r=0.17

small heat map img

A549
Bernstein
H3K4me1
ENCSR000AUM
r=0.13

small heat map img

A549
Bernstein
H3K4me2
ENCSR000AVI
r=0.12

small heat map img

A549
Bernstein
H3K4me1
ENCSR000AVH
r=0.12

small heat map img

A549
Bernstein
H3K4me2
ENCSR000ATO
r=0.11

small heat map img

A549
Bernstein
H4K20me1
ENCSR000AUO
r=0.09

small heat map img

A549
Bernstein
H3K4me3
ENCSR000ASH
r=0.09

small heat map img

A549
Bernstein
H3K4me3
ENCSR000AST
r=0.08

small heat map img

A549
Bernstein
H3K9ac
ENCSR000ASV
r=0.08

small heat map img

A549
Bernstein
H3K27ac
ENCSR000AVF
r=0.08

small heat map img

A549
Bernstein
H3K27ac
ENCSR000AUI
r=0.07

small heat map img

A549
Bernstein
H3K4me3
ENCSR000DPD
r=0.07

small heat map img

A549
Bernstein
H3K27me3
ENCSR000AUK
r=0.03

small heat map img

A549
Bernstein
H3K27me3
ENCSR000AUJ
r=0.01

small heat map img

A549
Bernstein
H3K36me3
ENCSR000AVG
r=0.01

small heat map img

A549
Bernstein
H3K36me3
ENCSR000AUL
r=0.01

small heat map img

A549
Bernstein
H3K79me2
ENCSR000ATP
r=0.00

small heat map img

A549
Bernstein
H3K79me2
ENCSR000ASU
r=-0.00

small heat map img

A549
Bernstein
H3K9me3
ENCSR000AUN
r=-0.00

small heat map img
10,000 randomly-selected peaks from a total of 77,196 (download )

A549 - Iyer - ENCSR000DNA

A549
Iyer
CTCF
ENCSR000DNA
r=1.00

small heat map img

A549
Iyer
CTCF
ENCSR000DYD
r=0.87

small heat map img

A549
Iyer
CTCF
ENCSR000BHV
r=0.81

small heat map img

A549
Iyer
CTCF
ENCSR000AUF
r=0.76

small heat map img

A549
Iyer
CTCF
ENCSR000AUE
r=0.76

small heat map img

A549
Iyer
CTCF
ENCSR000BHW
r=0.76

small heat map img

A549
Iyer
CTCF
ENCSR000DPF
r=0.62

small heat map img

A549
Iyer
H2AFZ
ENCSR000AUG
r=0.25

small heat map img

A549
Iyer
H2AFZ
ENCSR000AUH
r=0.24

small heat map img

A549
Iyer
H3K4me2
ENCSR000AVI
r=0.19

small heat map img

A549
Iyer
H3K4me2
ENCSR000ATO
r=0.18

small heat map img

A549
Iyer
H3K4me3
ENCSR000ASH
r=0.16

small heat map img

A549
Iyer
H3K4me3
ENCSR000AST
r=0.15

small heat map img

A549
Iyer
H3K9ac
ENCSR000ASV
r=0.14

small heat map img

A549
Iyer
H3K4me3
ENCSR000DPD
r=0.14

small heat map img

A549
Iyer
H3K4me1
ENCSR000AUM
r=0.13

small heat map img

A549
Iyer
H3K27ac
ENCSR000AVF
r=0.13

small heat map img

A549
Iyer
H3K4me1
ENCSR000AVH
r=0.12

small heat map img

A549
Iyer
H3K27ac
ENCSR000AUI
r=0.11

small heat map img

A549
Iyer
H4K20me1
ENCSR000AUO
r=0.07

small heat map img

A549
Iyer
H3K27me3
ENCSR000AUK
r=0.01

small heat map img

A549
Iyer
H3K27me3
ENCSR000AUJ
r=0.00

small heat map img

A549
Iyer
H3K79me2
ENCSR000ASU
r=0.00

small heat map img

A549
Iyer
H3K79me2
ENCSR000ATP
r=0.00

small heat map img

A549
Iyer
H3K36me3
ENCSR000AUL
r=-0.02

small heat map img

A549
Iyer
H3K36me3
ENCSR000AVG
r=-0.02

small heat map img

A549
Iyer
H3K9me3
ENCSR000AUN
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 55,351 (download )

A549 - Myers - ENCSR000BHV

A549
Myers
CTCF
ENCSR000BHV
r=1.00

small heat map img

A549
Myers
CTCF
ENCSR000BHW
r=0.87

small heat map img

A549
Myers
CTCF
ENCSR000DYD
r=0.84

small heat map img

A549
Myers
CTCF
ENCSR000DNA
r=0.79

small heat map img

A549
Myers
CTCF
ENCSR000AUE
r=0.70

small heat map img

A549
Myers
CTCF
ENCSR000AUF
r=0.69

small heat map img

A549
Myers
CTCF
ENCSR000DPF
r=0.55

small heat map img

A549
Myers
H2AFZ
ENCSR000AUG
r=0.27

small heat map img

A549
Myers
H2AFZ
ENCSR000AUH
r=0.25

small heat map img

A549
Myers
H3K4me2
ENCSR000AVI
r=0.22

small heat map img

A549
Myers
H3K4me2
ENCSR000ATO
r=0.21

small heat map img

A549
Myers
H3K4me1
ENCSR000AUM
r=0.20

small heat map img

A549
Myers
H3K4me1
ENCSR000AVH
r=0.19

small heat map img

A549
Myers
H3K4me3
ENCSR000ASH
r=0.16

small heat map img

A549
Myers
H3K4me3
ENCSR000AST
r=0.14

small heat map img

A549
Myers
H3K9ac
ENCSR000ASV
r=0.14

small heat map img

A549
Myers
H3K27ac
ENCSR000AVF
r=0.13

small heat map img

A549
Myers
H3K27ac
ENCSR000AUI
r=0.12

small heat map img

A549
Myers
H4K20me1
ENCSR000AUO
r=0.11

small heat map img

A549
Myers
H3K4me3
ENCSR000DPD
r=0.11

small heat map img

A549
Myers
H3K79me2
ENCSR000ATP
r=0.01

small heat map img

A549
Myers
H3K79me2
ENCSR000ASU
r=0.01

small heat map img

A549
Myers
H3K36me3
ENCSR000AVG
r=0.00

small heat map img

A549
Myers
H3K36me3
ENCSR000AUL
r=0.00

small heat map img

A549
Myers
H3K27me3
ENCSR000AUK
r=-0.01

small heat map img

A549
Myers
H3K9me3
ENCSR000AUN
r=-0.02

small heat map img

A549
Myers
H3K27me3
ENCSR000AUJ
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 40,841 (download )

A549 - Myers - ENCSR000BHW

A549
Myers
CTCF
ENCSR000BHW
r=1.00

small heat map img

A549
Myers
CTCF
ENCSR000BHV
r=0.87

small heat map img

A549
Myers
CTCF
ENCSR000DYD
r=0.81

small heat map img

A549
Myers
CTCF
ENCSR000DNA
r=0.74

small heat map img

A549
Myers
CTCF
ENCSR000AUE
r=0.72

small heat map img

A549
Myers
CTCF
ENCSR000AUF
r=0.71

small heat map img

A549
Myers
CTCF
ENCSR000DPF
r=0.57

small heat map img

A549
Myers
H2AFZ
ENCSR000AUG
r=0.26

small heat map img

A549
Myers
H2AFZ
ENCSR000AUH
r=0.25

small heat map img

A549
Myers
H3K4me2
ENCSR000AVI
r=0.22

small heat map img

A549
Myers
H3K4me2
ENCSR000ATO
r=0.21

small heat map img

A549
Myers
H3K4me1
ENCSR000AUM
r=0.20

small heat map img

A549
Myers
H3K4me1
ENCSR000AVH
r=0.19

small heat map img

A549
Myers
H3K4me3
ENCSR000ASH
r=0.15

small heat map img

A549
Myers
H3K9ac
ENCSR000ASV
r=0.15

small heat map img

A549
Myers
H3K4me3
ENCSR000AST
r=0.14

small heat map img

A549
Myers
H3K27ac
ENCSR000AVF
r=0.14

small heat map img

A549
Myers
H3K27ac
ENCSR000AUI
r=0.12

small heat map img

A549
Myers
H3K4me3
ENCSR000DPD
r=0.11

small heat map img

A549
Myers
H4K20me1
ENCSR000AUO
r=0.11

small heat map img

A549
Myers
H3K79me2
ENCSR000ATP
r=0.01

small heat map img

A549
Myers
H3K79me2
ENCSR000ASU
r=0.01

small heat map img

A549
Myers
H3K36me3
ENCSR000AVG
r=0.00

small heat map img

A549
Myers
H3K36me3
ENCSR000AUL
r=0.00

small heat map img

A549
Myers
H3K27me3
ENCSR000AUK
r=-0.00

small heat map img

A549
Myers
H3K9me3
ENCSR000AUN
r=-0.01

small heat map img

A549
Myers
H3K27me3
ENCSR000AUJ
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 38,133 (download )

A549 - Snyder - ENCSR000DYD

A549
Snyder
CTCF
ENCSR000DYD
r=1.00

small heat map img

A549
Snyder
CTCF
ENCSR000BHV
r=0.86

small heat map img

A549
Snyder
CTCF
ENCSR000AUE
r=0.85

small heat map img

A549
Snyder
CTCF
ENCSR000AUF
r=0.85

small heat map img

A549
Snyder
CTCF
ENCSR000DNA
r=0.84

small heat map img

A549
Snyder
CTCF
ENCSR000BHW
r=0.82

small heat map img

A549
Snyder
CTCF
ENCSR000DPF
r=0.67

small heat map img

A549
Snyder
H2AFZ
ENCSR000AUG
r=0.33

small heat map img

A549
Snyder
H2AFZ
ENCSR000AUH
r=0.31

small heat map img

A549
Snyder
H3K4me2
ENCSR000AVI
r=0.29

small heat map img

A549
Snyder
H3K4me2
ENCSR000ATO
r=0.28

small heat map img

A549
Snyder
H3K4me1
ENCSR000AUM
r=0.26

small heat map img

A549
Snyder
H3K4me1
ENCSR000AVH
r=0.25

small heat map img

A549
Snyder
H3K4me3
ENCSR000ASH
r=0.23

small heat map img

A549
Snyder
H3K9ac
ENCSR000ASV
r=0.22

small heat map img

A549
Snyder
H3K4me3
ENCSR000AST
r=0.21

small heat map img

A549
Snyder
H3K27ac
ENCSR000AVF
r=0.21

small heat map img

A549
Snyder
H3K27ac
ENCSR000AUI
r=0.19

small heat map img

A549
Snyder
H3K4me3
ENCSR000DPD
r=0.18

small heat map img

A549
Snyder
H4K20me1
ENCSR000AUO
r=0.13

small heat map img

A549
Snyder
H3K79me2
ENCSR000ATP
r=0.06

small heat map img

A549
Snyder
H3K79me2
ENCSR000ASU
r=0.05

small heat map img

A549
Snyder
H3K36me3
ENCSR000AVG
r=0.03

small heat map img

A549
Snyder
H3K36me3
ENCSR000AUL
r=0.02

small heat map img

A549
Snyder
H3K9me3
ENCSR000AUN
r=-0.00

small heat map img

A549
Snyder
H3K27me3
ENCSR000AUK
r=-0.01

small heat map img

A549
Snyder
H3K27me3
ENCSR000AUJ
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 35,068 (download )

A549 - Stam - ENCSR000DPF

A549
Stam
CTCF
ENCSR000DPF
r=1.00

small heat map img

A549
Stam
CTCF
ENCSR000AUF
r=0.80

small heat map img

A549
Stam
CTCF
ENCSR000AUE
r=0.79

small heat map img

A549
Stam
CTCF
ENCSR000DYD
r=0.67

small heat map img

A549
Stam
CTCF
ENCSR000DNA
r=0.62

small heat map img

A549
Stam
CTCF
ENCSR000BHW
r=0.57

small heat map img

A549
Stam
CTCF
ENCSR000BHV
r=0.55

small heat map img

A549
Stam
H2AFZ
ENCSR000AUG
r=0.21

small heat map img

A549
Stam
H2AFZ
ENCSR000AUH
r=0.20

small heat map img

A549
Stam
H3K4me2
ENCSR000AVI
r=0.17

small heat map img

A549
Stam
H3K4me1
ENCSR000AUM
r=0.17

small heat map img

A549
Stam
H3K4me2
ENCSR000ATO
r=0.16

small heat map img

A549
Stam
H3K4me1
ENCSR000AVH
r=0.16

small heat map img

A549
Stam
H3K4me3
ENCSR000ASH
r=0.13

small heat map img

A549
Stam
H3K9ac
ENCSR000ASV
r=0.12

small heat map img

A549
Stam
H3K4me3
ENCSR000AST
r=0.12

small heat map img

A549
Stam
H3K27ac
ENCSR000AVF
r=0.12

small heat map img

A549
Stam
H4K20me1
ENCSR000AUO
r=0.11

small heat map img

A549
Stam
H3K27ac
ENCSR000AUI
r=0.10

small heat map img

A549
Stam
H3K4me3
ENCSR000DPD
r=0.10

small heat map img

A549
Stam
H3K79me2
ENCSR000ATP
r=0.02

small heat map img

A549
Stam
H3K27me3
ENCSR000AUK
r=0.02

small heat map img

A549
Stam
H3K36me3
ENCSR000AUL
r=0.02

small heat map img

A549
Stam
H3K36me3
ENCSR000AVG
r=0.02

small heat map img

A549
Stam
H3K79me2
ENCSR000ASU
r=0.02

small heat map img

A549
Stam
H3K27me3
ENCSR000AUJ
r=0.01

small heat map img

A549
Stam
H3K9me3
ENCSR000AUN
r=-0.00

small heat map img
10,000 randomly-selected peaks from a total of 45,732 (download )

B cell - Bernstein - ENCSR000AUV

B cell
Bernstein
CTCF
ENCSR000AUV
r=1.00

small heat map img

B cell
Bernstein
H2AFZ
ENCSR000AUX
r=0.14

small heat map img

B cell
Bernstein
H3K4me2
ENCSR000AUY
r=0.07

small heat map img

B cell
Bernstein
H3K4me3
ENCSR000DQP
r=0.05

small heat map img

B cell
Bernstein
H3K4me3
ENCSR000DQR
r=0.05

small heat map img

B cell
Bernstein
H4K20me1
ENCSR000AVJ
r=0.02

small heat map img

B cell
Bernstein
H3K27ac
ENCSR000AUP
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 52,783 (download )

BE2C - Stam - ENCSR000DQD

BE2C
Stam
CTCF
ENCSR000DQD
r=1.00

small heat map img

BE2C
Stam
H3K4me3
ENCSR000DQB
r=0.12

small heat map img
10,000 randomly-selected peaks from a total of 54,655 (download )

BJ - Stam - ENCSR000DQI

BJ
Stam
CTCF
ENCSR000DQI
r=1.00

small heat map img

BJ
Stam
H3K4me3
ENCSR000DQH
r=0.10

small heat map img

BJ
Stam
H3K27me3
ENCSR000DQG
r=0.01

small heat map img

BJ
Stam
H3K36me3
ENCSR000DQF
r=-0.00

small heat map img
10,000 randomly-selected peaks from a total of 44,668 (download )

CD14-positive monocyte - Bernstein - ENCSR000ATN

CD14-positive monocyte
Bernstein
CTCF
ENCSR000ATN
r=1.00

small heat map img

CD14-positive monocyte
Bernstein
H2AFZ
ENCSR000ASI
r=0.12

small heat map img

CD14-positive monocyte
Bernstein
H3K4me2
ENCSR000ATE
r=0.06

small heat map img

CD14-positive monocyte
Bernstein
H3K4me3
ENCSR000ASN
r=0.05

small heat map img

CD14-positive monocyte
Bernstein
H3K9ac
ENCSR000ATF
r=0.05

small heat map img

CD14-positive monocyte
Bernstein
H3K4me3
ENCSR000DWL
r=0.05

small heat map img

CD14-positive monocyte
Bernstein
H3K27me3
ENCSR000ASK
r=0.03

small heat map img

CD14-positive monocyte
Bernstein
H3K4me1
ENCSR000ASM
r=0.03

small heat map img

CD14-positive monocyte
Bernstein
H3K27me3
ENCSR000DWM
r=0.03

small heat map img

CD14-positive monocyte
Bernstein
H3K27ac
ENCSR000ASJ
r=0.01

small heat map img

CD14-positive monocyte
Bernstein
H4K20me1
ENCSR000ASQ
r=-0.01

small heat map img

CD14-positive monocyte
Bernstein
H3K9me3
ENCSR000ASP
r=-0.02

small heat map img

CD14-positive monocyte
Bernstein
H3K79me2
ENCSR000ASO
r=-0.05

small heat map img

CD14-positive monocyte
Bernstein
H3K36me3
ENCSR000ASL
r=-0.06

small heat map img
10,000 randomly-selected peaks from a total of 44,999 (download )

Caco-2 - Stam - ENCSR000DQN

Caco-2
Stam
CTCF
ENCSR000DQN
r=1.00

small heat map img

Caco-2
Stam
H3K4me3
ENCSR000DQM
r=0.15

small heat map img

Caco-2
Stam
H3K27me3
ENCSR000DQL
r=0.07

small heat map img

Caco-2
Stam
H3K36me3
ENCSR000DQK
r=0.07

small heat map img
10,000 randomly-selected peaks from a total of 46,852 (download )

DND-41 - Bernstein - ENCSR000AQU

DND-41
Bernstein
CTCF
ENCSR000AQU
r=1.00

small heat map img

DND-41
Bernstein
H2AFZ
ENCSR000AQV
r=0.21

small heat map img

DND-41
Bernstein
H3K4me2
ENCSR000AQZ
r=0.13

small heat map img

DND-41
Bernstein
H3K9ac
ENCSR000ARY
r=0.12

small heat map img

DND-41
Bernstein
H3K4me1
ENCSR000AQY
r=0.12

small heat map img

DND-41
Bernstein
H3K27ac
ENCSR000AQW
r=0.11

small heat map img

DND-41
Bernstein
H3K4me3
ENCSR000ARA
r=0.11

small heat map img

DND-41
Bernstein
H4K20me1
ENCSR000ARC
r=0.08

small heat map img

DND-41
Bernstein
H3K27me3
ENCSR000ASX
r=0.06

small heat map img

DND-41
Bernstein
H3K79me2
ENCSR000ARB
r=0.02

small heat map img

DND-41
Bernstein
H3K36me3
ENCSR000AQX
r=0.01

small heat map img

DND-41
Bernstein
H3K9me3
ENCSR000ARZ
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 50,070 (download )

GM06990 - Stam - ENCSR000DQW

GM06990
Stam
CTCF
ENCSR000DQW
r=1.00

small heat map img

GM06990
Stam
H3K4me3
ENCSR000DQV
r=0.10

small heat map img

GM06990
Stam
H3K27me3
ENCSR000DQU
r=0.03

small heat map img

GM06990
Stam
H3K36me3
ENCSR000DQT
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 45,500 (download )

GM10248 - Iyer - ENCSR000DKP

GM10248
Iyer
CTCF
ENCSR000DKP
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 79,681 (download )

GM10266 - Iyer - ENCSR000DKR

GM10266
Iyer
CTCF
ENCSR000DKR
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 75,501 (download )

GM12801 - Stam - ENCSR000DQY

GM12801
Stam
CTCF
ENCSR000DQY
r=1.00

small heat map img
2,883 peaks (download )

GM12864 - Stam - ENCSR000DRB

GM12864
Stam
CTCF
ENCSR000DRB
r=1.00

small heat map img

GM12864
Stam
H3K4me3
ENCSR000DQZ
r=0.13

small heat map img
10,000 randomly-selected peaks from a total of 46,798 (download )

GM12865 - Stam - ENCSR000DRE

GM12865
Stam
CTCF
ENCSR000DRE
r=1.00

small heat map img

GM12865
Stam
H3K4me3
ENCSR000DRC
r=0.16

small heat map img
10,000 randomly-selected peaks from a total of 44,069 (download )

GM12866 - Stam - ENCSR000DRF

GM12866
Stam
CTCF
ENCSR000DRF
r=1.00

small heat map img

GM12866
Stam
H3K4me3
ENCSR000DRG
r=0.15

small heat map img
10,000 randomly-selected peaks from a total of 29,799 (download )

GM12867 - Stam - ENCSR000DRH

GM12867
Stam
CTCF
ENCSR000DRH
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 28,716 (download )

GM12868 - Stam - ENCSR000DRI

GM12868
Stam
CTCF
ENCSR000DRI
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 31,418 (download )

GM12869 - Stam - ENCSR000DRJ

GM12869
Stam
CTCF
ENCSR000DRJ
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 30,999 (download )

GM12870 - Stam - ENCSR000DRK

GM12870
Stam
CTCF
ENCSR000DRK
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 28,884 (download )

GM12871 - Stam - ENCSR000DRL

GM12871
Stam
CTCF
ENCSR000DRL
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 45,018 (download )

GM12872 - Stam - ENCSR000DRN

GM12872
Stam
CTCF
ENCSR000DRN
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 47,151 (download )

GM12873 - Stam - ENCSR000DRP

GM12873
Stam
CTCF
ENCSR000DRP
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 51,005 (download )

GM12874 - Stam - ENCSR000DRR

GM12874
Stam
CTCF
ENCSR000DRR
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 37,517 (download )

GM12875 - Stam - ENCSR000DRU

GM12875
Stam
CTCF
ENCSR000DRU
r=1.00

small heat map img

GM12875
Stam
H3K4me3
ENCSR000DRS
r=0.15

small heat map img
10,000 randomly-selected peaks from a total of 39,184 (download )

GM12878 - Bernstein - ENCSR000AKB

GM12878
Bernstein
CTCF
ENCSR000AKB
r=1.00

small heat map img

GM12878
Bernstein
CTCF
ENCSR000DZN
r=0.92

small heat map img

GM12878
Bernstein
CTCF
ENCSR000DKV
r=0.92

small heat map img

GM12878
Bernstein
CTCF
ENCSR000DRZ
r=0.90

small heat map img

GM12878
Bernstein
H2AFZ
ENCSR000AOV
r=0.26

small heat map img

GM12878
Bernstein
H3K4me2
ENCSR000AKG
r=0.16

small heat map img

GM12878
Bernstein
H3K4me1
ENCSR000AKF
r=0.15

small heat map img

GM12878
Bernstein
H3K4me3
ENCSR000AKA
r=0.13

small heat map img

GM12878
Bernstein
H3K9ac
ENCSR000AKH
r=0.13

small heat map img

GM12878
Bernstein
H3K27ac
ENCSR000AKC
r=0.09

small heat map img

GM12878
Bernstein
H4K20me1
ENCSR000AKI
r=0.09

small heat map img

GM12878
Bernstein
H3K4me3
ENCSR000DRY
r=0.09

small heat map img

GM12878
Bernstein
H3K79me2
ENCSR000AOW
r=0.05

small heat map img

GM12878
Bernstein
H3K9me3
ENCSR000AOX
r=0.04

small heat map img

GM12878
Bernstein
H3K27me3
ENCSR000AKD
r=0.02

small heat map img

GM12878
Bernstein
H3K36me3
ENCSR000DRW
r=0.01

small heat map img

GM12878
Bernstein
H3K27me3
ENCSR000DRX
r=-0.00

small heat map img

GM12878
Bernstein
H3K36me3
ENCSR000AKE
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 44,982 (download )

GM12878 - Iyer - ENCSR000DKV

GM12878
Iyer
CTCF
ENCSR000DKV
r=1.00

small heat map img

GM12878
Iyer
CTCF
ENCSR000AKB
r=0.92

small heat map img

GM12878
Iyer
CTCF
ENCSR000DZN
r=0.87

small heat map img

GM12878
Iyer
CTCF
ENCSR000DRZ
r=0.82

small heat map img

GM12878
Iyer
H2AFZ
ENCSR000AOV
r=0.24

small heat map img

GM12878
Iyer
H3K4me2
ENCSR000AKG
r=0.13

small heat map img

GM12878
Iyer
H3K4me1
ENCSR000AKF
r=0.12

small heat map img

GM12878
Iyer
H3K4me3
ENCSR000AKA
r=0.10

small heat map img

GM12878
Iyer
H3K9ac
ENCSR000AKH
r=0.10

small heat map img

GM12878
Iyer
H4K20me1
ENCSR000AKI
r=0.08

small heat map img

GM12878
Iyer
H3K4me3
ENCSR000DRY
r=0.07

small heat map img

GM12878
Iyer
H3K27ac
ENCSR000AKC
r=0.05

small heat map img

GM12878
Iyer
H3K9me3
ENCSR000AOX
r=0.03

small heat map img

GM12878
Iyer
H3K79me2
ENCSR000AOW
r=0.03

small heat map img

GM12878
Iyer
H3K27me3
ENCSR000AKD
r=0.02

small heat map img

GM12878
Iyer
H3K36me3
ENCSR000DRW
r=0.01

small heat map img

GM12878
Iyer
H3K27me3
ENCSR000DRX
r=0.00

small heat map img

GM12878
Iyer
H3K36me3
ENCSR000AKE
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 48,916 (download )

GM12878 - Snyder - ENCSR000DZN

GM12878
Snyder
CTCF
ENCSR000DZN
r=1.00

small heat map img

GM12878
Snyder
CTCF
ENCSR000AKB
r=0.92

small heat map img

GM12878
Snyder
CTCF
ENCSR000DKV
r=0.87

small heat map img

GM12878
Snyder
CTCF
ENCSR000DRZ
r=0.86

small heat map img

GM12878
Snyder
H2AFZ
ENCSR000AOV
r=0.25

small heat map img

GM12878
Snyder
H3K4me2
ENCSR000AKG
r=0.15

small heat map img

GM12878
Snyder
H3K4me1
ENCSR000AKF
r=0.14

small heat map img

GM12878
Snyder
H3K9ac
ENCSR000AKH
r=0.13

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000AKA
r=0.13

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000DRY
r=0.10

small heat map img

GM12878
Snyder
H3K27ac
ENCSR000AKC
r=0.09

small heat map img

GM12878
Snyder
H4K20me1
ENCSR000AKI
r=0.08

small heat map img

GM12878
Snyder
H3K79me2
ENCSR000AOW
r=0.06

small heat map img

GM12878
Snyder
H3K9me3
ENCSR000AOX
r=0.02

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000AKD
r=0.02

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000DRW
r=0.01

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000DRX
r=-0.00

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000AKE
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 55,551 (download )

GM12878 - Stam - ENCSR000DRZ

GM12878
Stam
CTCF
ENCSR000DRZ
r=1.00

small heat map img

GM12878
Stam
CTCF
ENCSR000AKB
r=0.90

small heat map img

GM12878
Stam
CTCF
ENCSR000DZN
r=0.86

small heat map img

GM12878
Stam
CTCF
ENCSR000DKV
r=0.83

small heat map img

GM12878
Stam
H2AFZ
ENCSR000AOV
r=0.25

small heat map img

GM12878
Stam
H3K4me1
ENCSR000AKF
r=0.15

small heat map img

GM12878
Stam
H3K4me2
ENCSR000AKG
r=0.15

small heat map img

GM12878
Stam
H3K9ac
ENCSR000AKH
r=0.12

small heat map img

GM12878
Stam
H3K4me3
ENCSR000AKA
r=0.12

small heat map img

GM12878
Stam
H4K20me1
ENCSR000AKI
r=0.09

small heat map img

GM12878
Stam
H3K4me3
ENCSR000DRY
r=0.09

small heat map img

GM12878
Stam
H3K27ac
ENCSR000AKC
r=0.07

small heat map img

GM12878
Stam
H3K79me2
ENCSR000AOW
r=0.04

small heat map img

GM12878
Stam
H3K9me3
ENCSR000AOX
r=0.03

small heat map img

GM12878
Stam
H3K27me3
ENCSR000AKD
r=0.02

small heat map img

GM12878
Stam
H3K36me3
ENCSR000DRW
r=0.02

small heat map img

GM12878
Stam
H3K27me3
ENCSR000DRX
r=0.01

small heat map img

GM12878
Stam
H3K36me3
ENCSR000AKE
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 40,122 (download )

GM12891 - Iyer - ENCSR000DKX

GM12891
Iyer
CTCF
ENCSR000DKX
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 42,632 (download )

GM12892 - Iyer - ENCSR000DKY

GM12892
Iyer
CTCF
ENCSR000DKY
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 48,306 (download )

GM13976 - Iyer - ENCSR000DKZ

GM13976
Iyer
CTCF
ENCSR000DKZ
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 62,751 (download )

GM13977 - Iyer - ENCSR000DLB

GM13977
Iyer
CTCF
ENCSR000DLB
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 62,078 (download )

GM19238 - Iyer - ENCSR000DLD

GM19238
Iyer
CTCF
ENCSR000DLD
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 49,938 (download )

GM19239 - Iyer - ENCSR000DLE

GM19239
Iyer
CTCF
ENCSR000DLE
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 41,085 (download )

GM19240 - Iyer - ENCSR000DLF

GM19240
Iyer
CTCF
ENCSR000DLF
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 46,036 (download )

GM20000 - Iyer - ENCSR000DLG

GM20000
Iyer
CTCF
ENCSR000DLG
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 71,543 (download )

H1-hESC - Bernstein - ENCSR000AMF

H1-hESC
Bernstein
CTCF
ENCSR000AMF
r=1.00

small heat map img

H1-hESC
Bernstein
CTCF
ENCSR000BNH
r=0.81

small heat map img

H1-hESC
Bernstein
CTCF
ENCSR000DLK
r=0.77

small heat map img

H1-hESC
Bernstein
H2AFZ
ENCSR000APX
r=0.21

small heat map img

H1-hESC
Bernstein
H3K4me1
ENCSR000ANA
r=0.19

small heat map img

H1-hESC
Bernstein
H3K4me2
ENCSR000ANC
r=0.18

small heat map img

H1-hESC
Bernstein
H3K4me3
ENCSR000AMG
r=0.15

small heat map img

H1-hESC
Bernstein
H3K9ac
ENCSR000AND
r=0.14

small heat map img

H1-hESC
Bernstein
H3K27ac
ENCSR000ANP
r=0.14

small heat map img

H1-hESC
Bernstein
H4K20me1
ENCSR000AMH
r=0.09

small heat map img

H1-hESC
Bernstein
H3K27me3
ENCSR000ALU
r=0.06

small heat map img

H1-hESC
Bernstein
H3K9me3
ENCSR000APZ
r=0.03

small heat map img

H1-hESC
Bernstein
H3K36me3
ENCSR000ANB
r=0.02

small heat map img

H1-hESC
Bernstein
H3K79me2
ENCSR000APY
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 66,551 (download )

H1-hESC - Iyer - ENCSR000DLK

H1-hESC
Iyer
CTCF
ENCSR000DLK
r=1.00

small heat map img

H1-hESC
Iyer
CTCF
ENCSR000BNH
r=0.85

small heat map img

H1-hESC
Iyer
CTCF
ENCSR000AMF
r=0.84

small heat map img

H1-hESC
Iyer
H2AFZ
ENCSR000APX
r=0.23

small heat map img

H1-hESC
Iyer
H3K4me2
ENCSR000ANC
r=0.21

small heat map img

H1-hESC
Iyer
H3K4me1
ENCSR000ANA
r=0.21

small heat map img

H1-hESC
Iyer
H3K4me3
ENCSR000AMG
r=0.17

small heat map img

H1-hESC
Iyer
H3K9ac
ENCSR000AND
r=0.16

small heat map img

H1-hESC
Iyer
H3K27ac
ENCSR000ANP
r=0.14

small heat map img

H1-hESC
Iyer
H4K20me1
ENCSR000AMH
r=0.09

small heat map img

H1-hESC
Iyer
H3K27me3
ENCSR000ALU
r=0.07

small heat map img

H1-hESC
Iyer
H3K9me3
ENCSR000APZ
r=0.01

small heat map img

H1-hESC
Iyer
H3K36me3
ENCSR000ANB
r=0.00

small heat map img

H1-hESC
Iyer
H3K79me2
ENCSR000APY
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 43,247 (download )

H1-hESC - Myers - ENCSR000BNH

H1-hESC
Myers
CTCF
ENCSR000BNH
r=1.00

small heat map img

H1-hESC
Myers
CTCF
ENCSR000AMF
r=0.82

small heat map img

H1-hESC
Myers
CTCF
ENCSR000DLK
r=0.77

small heat map img

H1-hESC
Myers
H2AFZ
ENCSR000APX
r=0.22

small heat map img

H1-hESC
Myers
H3K4me1
ENCSR000ANA
r=0.18

small heat map img

H1-hESC
Myers
H3K4me2
ENCSR000ANC
r=0.17

small heat map img

H1-hESC
Myers
H3K4me3
ENCSR000AMG
r=0.13

small heat map img

H1-hESC
Myers
H3K9ac
ENCSR000AND
r=0.13

small heat map img

H1-hESC
Myers
H3K27ac
ENCSR000ANP
r=0.12

small heat map img

H1-hESC
Myers
H4K20me1
ENCSR000AMH
r=0.07

small heat map img

H1-hESC
Myers
H3K27me3
ENCSR000ALU
r=0.04

small heat map img

H1-hESC
Myers
H3K9me3
ENCSR000APZ
r=0.02

small heat map img

H1-hESC
Myers
H3K36me3
ENCSR000ANB
r=0.00

small heat map img

H1-hESC
Myers
H3K79me2
ENCSR000APY
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 54,111 (download )

H54 - Iyer - ENCSR000DKN

H54
Iyer
CTCF
ENCSR000DKN
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 62,772 (download )

HCT116 - Myers - ENCSR000BSE

HCT116
Myers
CTCF
ENCSR000BSE
r=1.00

small heat map img

HCT116
Myers
CTCF
ENCSR000DTO
r=0.78

small heat map img

HCT116
Myers
H3K4me1
ENCSR000EUS
r=0.25

small heat map img

HCT116
Myers
H3K27ac
ENCSR000EUT
r=0.17

small heat map img

HCT116
Myers
H3K4me3
ENCSR000DTQ
r=0.14

small heat map img
10,000 randomly-selected peaks from a total of 15,864 (download )

HCT116 - Stam - ENCSR000DTO

HCT116
Stam
CTCF
ENCSR000DTO
r=1.00

small heat map img

HCT116
Stam
CTCF
ENCSR000BSE
r=0.72

small heat map img

HCT116
Stam
H3K4me1
ENCSR000EUS
r=0.18

small heat map img

HCT116
Stam
H3K27ac
ENCSR000EUT
r=0.14

small heat map img

HCT116
Stam
H3K4me3
ENCSR000DTQ
r=0.12

small heat map img
10,000 randomly-selected peaks from a total of 50,294 (download )

HEK293 - Stam - ENCSR000DTW

HEK293
Stam
CTCF
ENCSR000DTW
r=1.00

small heat map img

HEK293
Stam
H3K4me3
ENCSR000DTU
r=0.12

small heat map img
10,000 randomly-selected peaks from a total of 47,331 (download )

HFF-Myc - Stam - ENCSR000DUM

HFF-Myc
Stam
CTCF
ENCSR000DUM
r=1.00

small heat map img

HFF-Myc
Stam
H3K4me3
ENCSR000DUK
r=0.11

small heat map img
10,000 randomly-selected peaks from a total of 43,821 (download )

HGPS cell - Iyer - ENCSR000DNG

HGPS cell
Iyer
CTCF
ENCSR000DNG
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 43,918 (download )

HL-60 - Stam - ENCSR000DUP

HL-60
Stam
CTCF
ENCSR000DUP
r=1.00

small heat map img

HL-60
Stam
H3K4me3
ENCSR000DUO
r=0.11

small heat map img
10,000 randomly-selected peaks from a total of 16,683 (download )

HeLa-S3 - Bernstein - ENCSR000AOA

HeLa-S3
Bernstein
CTCF
ENCSR000AOA
r=1.00

small heat map img

HeLa-S3
Bernstein
CTCF
ENCSR000DUB
r=0.90

small heat map img

HeLa-S3
Bernstein
CTCF
ENCSR000DLO
r=0.81

small heat map img

HeLa-S3
Bernstein
H2AFZ
ENCSR000AQN
r=0.22

small heat map img

HeLa-S3
Bernstein
H3K4me2
ENCSR000AOE
r=0.16

small heat map img

HeLa-S3
Bernstein
H3K4me1
ENCSR000APW
r=0.15

small heat map img

HeLa-S3
Bernstein
H3K4me3
ENCSR000AOF
r=0.14

small heat map img

HeLa-S3
Bernstein
H3K9ac
ENCSR000AOH
r=0.12

small heat map img

HeLa-S3
Bernstein
H3K27ac
ENCSR000AOC
r=0.10

small heat map img

HeLa-S3
Bernstein
H3K4me3
ENCSR000DUA
r=0.09

small heat map img

HeLa-S3
Bernstein
H4K20me1
ENCSR000AOI
r=0.07

small heat map img

HeLa-S3
Bernstein
H3K36me3
ENCSR000DTZ
r=0.04

small heat map img

HeLa-S3
Bernstein
H3K27me3
ENCSR000DTY
r=0.04

small heat map img

HeLa-S3
Bernstein
H3K9me3
ENCSR000AQO
r=0.04

small heat map img

HeLa-S3
Bernstein
H3K79me2
ENCSR000AOG
r=0.03

small heat map img

HeLa-S3
Bernstein
H3K27me3
ENCSR000APB
r=0.02

small heat map img

HeLa-S3
Bernstein
H3K36me3
ENCSR000AOD
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 52,783 (download )

HeLa-S3 - Iyer - ENCSR000DLO

HeLa-S3
Iyer
CTCF
ENCSR000DLO
r=1.00

small heat map img

HeLa-S3
Iyer
CTCF
ENCSR000AOA
r=0.80

small heat map img

HeLa-S3
Iyer
CTCF
ENCSR000DUB
r=0.78

small heat map img

HeLa-S3
Iyer
H2AFZ
ENCSR000AQN
r=0.20

small heat map img

HeLa-S3
Iyer
H3K4me2
ENCSR000AOE
r=0.14

small heat map img

HeLa-S3
Iyer
H3K4me3
ENCSR000AOF
r=0.12

small heat map img

HeLa-S3
Iyer
H3K4me1
ENCSR000APW
r=0.12

small heat map img

HeLa-S3
Iyer
H3K9ac
ENCSR000AOH
r=0.10

small heat map img

HeLa-S3
Iyer
H3K4me3
ENCSR000DUA
r=0.09

small heat map img

HeLa-S3
Iyer
H3K27ac
ENCSR000AOC
r=0.09

small heat map img

HeLa-S3
Iyer
H4K20me1
ENCSR000AOI
r=0.04

small heat map img

HeLa-S3
Iyer
H3K27me3
ENCSR000DTY
r=0.02

small heat map img

HeLa-S3
Iyer
H3K36me3
ENCSR000DTZ
r=0.01

small heat map img

HeLa-S3
Iyer
H3K9me3
ENCSR000AQO
r=0.01

small heat map img

HeLa-S3
Iyer
H3K79me2
ENCSR000AOG
r=0.01

small heat map img

HeLa-S3
Iyer
H3K27me3
ENCSR000APB
r=-0.01

small heat map img

HeLa-S3
Iyer
H3K36me3
ENCSR000AOD
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 58,806 (download )

HeLa-S3 - Stam - ENCSR000DUB

HeLa-S3
Stam
CTCF
ENCSR000DUB
r=1.00

small heat map img

HeLa-S3
Stam
CTCF
ENCSR000AOA
r=0.90

small heat map img

HeLa-S3
Stam
CTCF
ENCSR000DLO
r=0.80

small heat map img

HeLa-S3
Stam
H2AFZ
ENCSR000AQN
r=0.25

small heat map img

HeLa-S3
Stam
H3K4me2
ENCSR000AOE
r=0.20

small heat map img

HeLa-S3
Stam
H3K4me3
ENCSR000AOF
r=0.18

small heat map img

HeLa-S3
Stam
H3K4me1
ENCSR000APW
r=0.17

small heat map img

HeLa-S3
Stam
H3K9ac
ENCSR000AOH
r=0.16

small heat map img

HeLa-S3
Stam
H3K4me3
ENCSR000DUA
r=0.14

small heat map img

HeLa-S3
Stam
H3K27ac
ENCSR000AOC
r=0.14

small heat map img

HeLa-S3
Stam
H4K20me1
ENCSR000AOI
r=0.05

small heat map img

HeLa-S3
Stam
H3K27me3
ENCSR000DTY
r=0.04

small heat map img

HeLa-S3
Stam
H3K36me3
ENCSR000DTZ
r=0.04

small heat map img

HeLa-S3
Stam
H3K79me2
ENCSR000AOG
r=0.03

small heat map img

HeLa-S3
Stam
H3K9me3
ENCSR000AQO
r=0.01

small heat map img

HeLa-S3
Stam
H3K36me3
ENCSR000AOD
r=-0.01

small heat map img

HeLa-S3
Stam
H3K27me3
ENCSR000APB
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 38,400 (download )

HepG2 - Bernstein - ENCSR000AMA

HepG2
Bernstein
CTCF
ENCSR000AMA
r=1.00

small heat map img

HepG2
Bernstein
CTCF
ENCSR000DUG
r=0.90

small heat map img

HepG2
Bernstein
CTCF
ENCSR000DLS
r=0.87

small heat map img

HepG2
Bernstein
CTCF
ENCSR000BIE
r=0.77

small heat map img

HepG2
Bernstein
H2AFZ
ENCSR000AOK
r=0.20

small heat map img

HepG2
Bernstein
H3K4me2
ENCSR000AMC
r=0.18

small heat map img

HepG2
Bernstein
H3K4me1
ENCSR000APV
r=0.15

small heat map img

HepG2
Bernstein
H3K4me3
ENCSR000AMP
r=0.15

small heat map img

HepG2
Bernstein
H4K20me1
ENCSR000AMQ
r=0.14

small heat map img

HepG2
Bernstein
H3K9ac
ENCSR000AMD
r=0.13

small heat map img

HepG2
Bernstein
H3K4me3
ENCSR000DUF
r=0.11

small heat map img

HepG2
Bernstein
H3K27ac
ENCSR000AMO
r=0.10

small heat map img

HepG2
Bernstein
H3K9me3
ENCSR000ATD
r=0.05

small heat map img

HepG2
Bernstein
H3K79me2
ENCSR000AOM
r=0.05

small heat map img

HepG2
Bernstein
H3K27me3
ENCSR000AOL
r=0.05

small heat map img

HepG2
Bernstein
H3K27me3
ENCSR000DUE
r=0.04

small heat map img

HepG2
Bernstein
H3K36me3
ENCSR000DUD
r=0.04

small heat map img

HepG2
Bernstein
H3K36me3
ENCSR000AMB
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 46,448 (download )

HepG2 - Iyer - ENCSR000DLS

HepG2
Iyer
CTCF
ENCSR000DLS
r=1.00

small heat map img

HepG2
Iyer
CTCF
ENCSR000AMA
r=0.87

small heat map img

HepG2
Iyer
CTCF
ENCSR000BIE
r=0.86

small heat map img

HepG2
Iyer
CTCF
ENCSR000DUG
r=0.81

small heat map img

HepG2
Iyer
H2AFZ
ENCSR000AOK
r=0.18

small heat map img

HepG2
Iyer
H3K4me2
ENCSR000AMC
r=0.17

small heat map img

HepG2
Iyer
H3K4me3
ENCSR000AMP
r=0.14

small heat map img

HepG2
Iyer
H3K4me1
ENCSR000APV
r=0.13

small heat map img

HepG2
Iyer
H4K20me1
ENCSR000AMQ
r=0.13

small heat map img

HepG2
Iyer
H3K9ac
ENCSR000AMD
r=0.10

small heat map img

HepG2
Iyer
H3K4me3
ENCSR000DUF
r=0.09

small heat map img

HepG2
Iyer
H3K27ac
ENCSR000AMO
r=0.06

small heat map img

HepG2
Iyer
H3K27me3
ENCSR000DUE
r=0.04

small heat map img

HepG2
Iyer
H3K9me3
ENCSR000ATD
r=0.03

small heat map img

HepG2
Iyer
H3K79me2
ENCSR000AOM
r=0.03

small heat map img

HepG2
Iyer
H3K27me3
ENCSR000AOL
r=0.03

small heat map img

HepG2
Iyer
H3K36me3
ENCSR000DUD
r=0.02

small heat map img

HepG2
Iyer
H3K36me3
ENCSR000AMB
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 40,800 (download )

HepG2 - Myers - ENCSR000BIE

HepG2
Myers
CTCF
ENCSR000BIE
r=1.00

small heat map img

HepG2
Myers
CTCF
ENCSR000DLS
r=0.86

small heat map img

HepG2
Myers
CTCF
ENCSR000AMA
r=0.76

small heat map img

HepG2
Myers
CTCF
ENCSR000DUG
r=0.74

small heat map img

HepG2
Myers
H2AFZ
ENCSR000AOK
r=0.18

small heat map img

HepG2
Myers
H3K4me2
ENCSR000AMC
r=0.18

small heat map img

HepG2
Myers
H3K4me3
ENCSR000AMP
r=0.16

small heat map img

HepG2
Myers
H3K4me1
ENCSR000APV
r=0.12

small heat map img

HepG2
Myers
H3K9ac
ENCSR000AMD
r=0.12

small heat map img

HepG2
Myers
H3K4me3
ENCSR000DUF
r=0.11

small heat map img

HepG2
Myers
H4K20me1
ENCSR000AMQ
r=0.10

small heat map img

HepG2
Myers
H3K27ac
ENCSR000AMO
r=0.08

small heat map img

HepG2
Myers
H3K79me2
ENCSR000AOM
r=0.04

small heat map img

HepG2
Myers
H3K27me3
ENCSR000DUE
r=0.03

small heat map img

HepG2
Myers
H3K27me3
ENCSR000AOL
r=0.03

small heat map img

HepG2
Myers
H3K9me3
ENCSR000ATD
r=0.03

small heat map img

HepG2
Myers
H3K36me3
ENCSR000DUD
r=0.03

small heat map img

HepG2
Myers
H3K36me3
ENCSR000AMB
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 55,778 (download )

HepG2 - Stam - ENCSR000DUG

HepG2
Stam
CTCF
ENCSR000DUG
r=1.00

small heat map img

HepG2
Stam
CTCF
ENCSR000AMA
r=0.90

small heat map img

HepG2
Stam
CTCF
ENCSR000DLS
r=0.81

small heat map img

HepG2
Stam
CTCF
ENCSR000BIE
r=0.74

small heat map img

HepG2
Stam
H3K4me2
ENCSR000AMC
r=0.20

small heat map img

HepG2
Stam
H2AFZ
ENCSR000AOK
r=0.20

small heat map img

HepG2
Stam
H3K4me3
ENCSR000AMP
r=0.18

small heat map img

HepG2
Stam
H3K4me1
ENCSR000APV
r=0.15

small heat map img

HepG2
Stam
H3K9ac
ENCSR000AMD
r=0.15

small heat map img

HepG2
Stam
H3K4me3
ENCSR000DUF
r=0.14

small heat map img

HepG2
Stam
H4K20me1
ENCSR000AMQ
r=0.12

small heat map img

HepG2
Stam
H3K27ac
ENCSR000AMO
r=0.11

small heat map img

HepG2
Stam
H3K27me3
ENCSR000AOL
r=0.08

small heat map img

HepG2
Stam
H3K27me3
ENCSR000DUE
r=0.06

small heat map img

HepG2
Stam
H3K79me2
ENCSR000AOM
r=0.05

small heat map img

HepG2
Stam
H3K36me3
ENCSR000DUD
r=0.05

small heat map img

HepG2
Stam
H3K9me3
ENCSR000ATD
r=0.04

small heat map img

HepG2
Stam
H3K36me3
ENCSR000AMB
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 48,708 (download )

IMR-90 - Snyder - ENCSR000EFI

IMR-90
Snyder
CTCF
ENCSR000EFI
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 45,920 (download )

Ishikawa - Myers - ENCSR000BQE

Ishikawa
Myers
CTCF
ENCSR000BQE
r=1.00

small heat map img
10,000 randomly-selected peaks from a total of 23,192 (download )

K562 - Bernstein - ENCSR000AKO

K562
Bernstein
CTCF
ENCSR000AKO
r=1.00

small heat map img

K562
Bernstein
CTCF
ENCSR000DWE
r=0.94

small heat map img

K562
Bernstein
CTCF
ENCSR000EGM
r=0.92

small heat map img

K562
Bernstein
CTCF
ENCSR000DMA
r=0.84

small heat map img

K562
Bernstein
CTCF
ENCSR000BPJ
r=0.74

small heat map img

K562
Bernstein
H2AFZ
ENCSR000APC
r=0.25

small heat map img

K562
Bernstein
H3K4me2
ENCSR000AKT
r=0.19

small heat map img

K562
Bernstein
H3K4me1
ENCSR000EWC
r=0.18

small heat map img

K562
Bernstein
H3K4me3
ENCSR000AKU
r=0.18

small heat map img

K562
Bernstein
H3K9ac
ENCSR000EVZ
r=0.17

small heat map img

K562
Bernstein
H3K4me1
ENCSR000AKS
r=0.17

small heat map img

K562
Bernstein
H4K20me1
ENCSR000AKX
r=0.17

small heat map img

K562
Bernstein
H3K9ac
ENCSR000AKV
r=0.15

small heat map img

K562
Bernstein
H3K9me1
ENCSR000AKW
r=0.14

small heat map img

K562
Bernstein
H3K27ac
ENCSR000AKP
r=0.14

small heat map img

K562
Bernstein
H3K4me3
ENCSR000DWD
r=0.13

small heat map img

K562
Bernstein
H3K4me3
ENCSR000EWA
r=0.12

small heat map img

K562
Bernstein
H3K9me3
ENCSR000APE
r=0.09

small heat map img

K562
Bernstein
H3K79me2
ENCSR000APD
r=0.07

small heat map img

K562
Bernstein
H3K36me3
ENCSR000AKR
r=0.06

small heat map img

K562
Bernstein
H3K36me3
ENCSR000DWB
r=0.04

small heat map img

K562
Bernstein
H3K27me3
ENCSR000AKQ
r=0.04

small heat map img

K562
Bernstein
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Bernstein
H3K27me3
ENCSR000EWB
r=0.02

small heat map img
10,000 randomly-selected peaks from a total of 51,992 (download )

K562 - Iyer - ENCSR000DMA

K562
Iyer
CTCF
ENCSR000DMA
r=1.00

small heat map img

K562
Iyer
CTCF
ENCSR000EGM
r=0.87

small heat map img

K562
Iyer
CTCF
ENCSR000DWE
r=0.86

small heat map img

K562
Iyer
CTCF
ENCSR000AKO
r=0.84

small heat map img

K562
Iyer
CTCF
ENCSR000BPJ
r=0.76

small heat map img

K562
Iyer
H2AFZ
ENCSR000APC
r=0.21

small heat map img

K562
Iyer
H3K4me2
ENCSR000AKT
r=0.14

small heat map img

K562
Iyer
H3K4me1
ENCSR000EWC
r=0.13

small heat map img

K562
Iyer
H4K20me1
ENCSR000AKX
r=0.13

small heat map img

K562
Iyer
H3K4me3
ENCSR000AKU
r=0.13

small heat map img

K562
Iyer
H3K4me1
ENCSR000AKS
r=0.12

small heat map img

K562
Iyer
H3K9ac
ENCSR000EVZ
r=0.12

small heat map img

K562
Iyer
H3K9me1
ENCSR000AKW
r=0.10

small heat map img

K562
Iyer
H3K9ac
ENCSR000AKV
r=0.10

small heat map img

K562
Iyer
H3K4me3
ENCSR000DWD
r=0.09

small heat map img

K562
Iyer
H3K4me3
ENCSR000EWA
r=0.09

small heat map img

K562
Iyer
H3K27ac
ENCSR000AKP
r=0.08

small heat map img

K562
Iyer
H3K9me3
ENCSR000APE
r=0.07

small heat map img

K562
Iyer
H3K79me2
ENCSR000APD
r=0.03

small heat map img

K562
Iyer
H3K36me3
ENCSR000AKR
r=0.02

small heat map img

K562
Iyer
H3K27me3
ENCSR000AKQ
r=0.01

small heat map img

K562
Iyer
H3K27me3
ENCSR000EWB
r=0.01

small heat map img

K562
Iyer
H3K27me3
ENCSR000DWC
r=0.01

small heat map img

K562
Iyer
H3K36me3
ENCSR000DWB
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 56,058 (download )

K562 - Myers - ENCSR000BPJ

K562
Myers
CTCF
ENCSR000BPJ
r=1.00

small heat map img

K562
Myers
CTCF
ENCSR000DWE
r=0.74

small heat map img

K562
Myers
CTCF
ENCSR000EGM
r=0.74

small heat map img

K562
Myers
CTCF
ENCSR000DMA
r=0.74

small heat map img

K562
Myers
CTCF
ENCSR000AKO
r=0.71

small heat map img

K562
Myers
H2AFZ
ENCSR000APC
r=0.26

small heat map img

K562
Myers
H3K4me2
ENCSR000AKT
r=0.22

small heat map img

K562
Myers
H3K4me1
ENCSR000EWC
r=0.21

small heat map img

K562
Myers
H3K9ac
ENCSR000EVZ
r=0.20

small heat map img

K562
Myers
H3K4me3
ENCSR000AKU
r=0.19

small heat map img

K562
Myers
H3K9ac
ENCSR000AKV
r=0.16

small heat map img

K562
Myers
H3K4me3
ENCSR000DWD
r=0.16

small heat map img

K562
Myers
H3K4me3
ENCSR000EWA
r=0.16

small heat map img

K562
Myers
H3K4me1
ENCSR000AKS
r=0.15

small heat map img

K562
Myers
H3K27ac
ENCSR000AKP
r=0.14

small heat map img

K562
Myers
H4K20me1
ENCSR000AKX
r=0.13

small heat map img

K562
Myers
H3K9me1
ENCSR000AKW
r=0.11

small heat map img

K562
Myers
H3K9me3
ENCSR000APE
r=0.07

small heat map img

K562
Myers
H3K79me2
ENCSR000APD
r=0.07

small heat map img

K562
Myers
H3K36me3
ENCSR000AKR
r=0.03

small heat map img

K562
Myers
H3K36me3
ENCSR000DWB
r=0.03

small heat map img

K562
Myers
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Myers
H3K27me3
ENCSR000AKQ
r=0.02

small heat map img

K562
Myers
H3K27me3
ENCSR000EWB
r=0.01

small heat map img
10,000 randomly-selected peaks from a total of 45,603 (download )

K562 - Snyder - ENCSR000EGM

K562
Snyder
CTCF
ENCSR000EGM
r=1.00

small heat map img

K562
Snyder
CTCF
ENCSR000AKO
r=0.92

small heat map img

K562
Snyder
CTCF
ENCSR000DWE
r=0.90

small heat map img

K562
Snyder
CTCF
ENCSR000DMA
r=0.88

small heat map img

K562
Snyder
CTCF
ENCSR000BPJ
r=0.73

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.25

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.18

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.17

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.17

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.16

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.16

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.15

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.15

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.14

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.13

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.13

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.12

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.09

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.08

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=0.06

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=0.03

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=0.02

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=0.01

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.00

small heat map img
10,000 randomly-selected peaks from a total of 54,387 (download )

K562 - Stam - ENCSR000DWE

K562
Stam
CTCF
ENCSR000DWE
r=1.00

small heat map img

K562
Stam
CTCF
ENCSR000AKO
r=0.94

small heat map img

K562
Stam
CTCF
ENCSR000EGM
r=0.91

small heat map img

K562
Stam
CTCF
ENCSR000DMA
r=0.87

small heat map img

K562
Stam
CTCF
ENCSR000BPJ
r=0.74

small heat map img

K562
Stam
H2AFZ
ENCSR000APC
r=0.25

small heat map img

K562
Stam
H3K4me1
ENCSR000EWC
r=0.18

small heat map img

K562
Stam
H3K4me2
ENCSR000AKT
r=0.18

small heat map img

K562
Stam
H3K9ac
ENCSR000EVZ
r=0.17

small heat map img

K562
Stam
H4K20me1
ENCSR000AKX
r=0.17

small heat map img

K562
Stam
H3K4me3
ENCSR000AKU
r=0.17

small heat map img

K562
Stam
H3K4me1
ENCSR000AKS
r=0.15

small heat map img

K562
Stam
H3K9ac
ENCSR000AKV
r=0.14

small heat map img

K562
Stam
H3K9me1
ENCSR000AKW
r=0.14

small heat map img

K562
Stam
H3K4me3
ENCSR000DWD
r=0.13

small heat map img

K562
Stam
H3K27ac
ENCSR000AKP
r=0.13

small heat map img

K562
Stam
H3K4me3
ENCSR000EWA
r=0.12

small heat map img

K562
Stam
H3K9me3
ENCSR000APE
r=0.09

small heat map img

K562
Stam
H3K79me2
ENCSR000APD
r=0.06

small heat map img

K562
Stam
H3K36me3
ENCSR000AKR
r=0.04

small heat map img

K562
Stam
H3K36me3
ENCSR000DWB
r=0.03

small heat map img

K562
Stam
H3K27me3
ENCSR000AKQ
r=0.03

small heat map img

K562
Stam
H3K27me3
ENCSR000EWB
r=0.03

small heat map img

K562
Stam
H3K27me3
ENCSR000DWC
r=0.03

small heat map img
10,000 randomly-selected peaks from a total of 43,247 (download )

LNCaP clone FGC - Iyer - ENCSR000DME

LNCaP clone FGC
Iyer
CTCF
ENCSR000DME
r=1.00

small heat map img

LNCaP clone FGC
Iyer
CTCF
ENCSR000DMF
r=0.92

small heat map img

LNCaP clone FGC
Iyer
H3K4me3
ENCSR000DWF
r=0.09

small heat map img
10,000 randomly-selected peaks from a total of 69,584 (download )

LNCaP clone FGC - Iyer - ENCSR000DMF

LNCaP clone FGC
Iyer
CTCF
ENCSR000DMF
r=1.00

small heat map img

LNCaP clone FGC
Iyer
CTCF
ENCSR000DME
r=0.94

small heat map img

LNCaP clone FGC
Iyer
H3K4me3
ENCSR000DWF
r=0.11

small heat map img
10,000 randomly-selected peaks from a total of 68,672 (download )

MCF-7 - Iyer - ENCSR000DML

MCF-7
Iyer
CTCF
ENCSR000DML
r=1.00

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMO
r=0.97

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMV
r=0.97

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMS
r=0.92

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMR
r=0.91

small heat map img

MCF-7
Iyer
CTCF
ENCSR000AHD
r=0.80

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DWH
r=0.76

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.16

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.06

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.02

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.03

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 54,343 (download )

MCF-7 - Iyer - ENCSR000DMO

MCF-7
Iyer
CTCF
ENCSR000DMO
r=1.00

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DML
r=0.97

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMV
r=0.96

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMS
r=0.88

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMR
r=0.87

small heat map img

MCF-7
Iyer
CTCF
ENCSR000AHD
r=0.77

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DWH
r=0.71

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.17

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.07

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.02

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.03

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 58,608 (download )

MCF-7 - Iyer - ENCSR000DMR

MCF-7
Iyer
CTCF
ENCSR000DMR
r=1.00

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMS
r=0.98

small heat map img

MCF-7
Iyer
CTCF
ENCSR000AHD
r=0.84

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DML
r=0.84

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DWH
r=0.83

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMV
r=0.83

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMO
r=0.80

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.13

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.06

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.01

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.02

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 82,176 (download )

MCF-7 - Iyer - ENCSR000DMS

MCF-7
Iyer
CTCF
ENCSR000DMS
r=1.00

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMR
r=0.98

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DML
r=0.85

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMV
r=0.85

small heat map img

MCF-7
Iyer
CTCF
ENCSR000AHD
r=0.84

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMO
r=0.82

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DWH
r=0.80

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.12

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.05

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.01

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.03

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 66,592 (download )

MCF-7 - Iyer - ENCSR000DMV

MCF-7
Iyer
CTCF
ENCSR000DMV
r=1.00

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DML
r=0.97

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMO
r=0.95

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMS
r=0.92

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DMR
r=0.91

small heat map img

MCF-7
Iyer
CTCF
ENCSR000AHD
r=0.80

small heat map img

MCF-7
Iyer
CTCF
ENCSR000DWH
r=0.74

small heat map img

MCF-7
Iyer
H3K4me3
ENCSR000DWJ
r=0.17

small heat map img

MCF-7
Iyer
H3K27ac
ENCSR000EWR
r=0.08

small heat map img

MCF-7
Iyer
H3K9me3
ENCSR000EWQ
r=-0.01

small heat map img

MCF-7
Iyer
H3K36me3
ENCSR000EWO
r=-0.02

small heat map img

MCF-7
Iyer
H3K27me3
ENCSR000EWP
r=-0.03

small heat map img
10,000 randomly-selected peaks from a total of 57,936 (download )

MCF-7 - Myers - ENCSR000AHD

MCF-7
Myers
CTCF
ENCSR000AHD
r=1.00

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMR
r=0.87

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMS
r=0.86

small heat map img

MCF-7
Myers
CTCF
ENCSR000DWH
r=0.79

small heat map img

MCF-7
Myers
CTCF
ENCSR000DML
r=0.76

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMV
r=0.76

small heat map img

MCF-7
Myers
CTCF
ENCSR000DMO
r=0.75

small heat map img

MCF-7
Myers
H3K4me3
ENCSR000DWJ
r=0.15

small heat map img

MCF-7
Myers
H3K27ac
ENCSR000EWR
r=0.11

small heat map img

MCF-7
Myers
H3K9me3
ENCSR000EWQ
r=0.03

small heat map img

MCF-7
Myers
H3K36me3
ENCSR000EWO
r=0.01