CTBP2 - Factorbook

This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3; however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. Several transcript variants encoding two different isoforms have been found for this gene. RefSeq, Feb 2014

C-terminal-binding protein 2 also known as CtBP2 is a protein that in humans is encoded by the CTBP2 gene.wikipedia

CTBP2
PDB 2OME
PDB	2OME 4LCJ
ENCODE	experiments
Ensemble	search
Entrez	1488
GO	search
Gene Card	search
HGNC	search
RefSeq	search
UCSC	browse
UniProt	search
Wikipedia	CTBP2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

H1-hESC - Farnham - ENCSR000EUO

Legend

Proximal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Distal:

H2AFZ
H3K27ac
H3K27me3
H3K36me3
H3K4me1
H3K4me2
H3K4me3
H3K79me2
H3K9ac
H3K9me1
H3K9me3
H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

H1-hESC - Farnham

H1-hESC - Farnham - ENCSR000EUO

1. 225 / 500 3.8e-231 GGGAGGGAGGGGGAGAGGGGG		p-value: 0.00 pct_center: 0.75 pct_ratio: 0.56
2. 122 / 500 6.3e-27 GGGGAGGGAGA		p-value: 0.00 pct_center: 0.60 pct_ratio: 0.58
3. 24 / 500 1.6e-15 GAGGAATGTCAGGAATGT		p-value: 0.39 pct_center: 0.09 pct_ratio: 0.55
4. 24 / 500 0.16 AGTGAGTGCGTGGGTGAGTG		p-value: 0.00 pct_center: 0.40 pct_ratio: 0.54
5. 28 / 500 4.9 AAGGAAGTGCA		p-value: 0.00 pct_center: 0.11 pct_ratio: 0.52

MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at CTBP2 peaks

H1-hESC - Farnham

H1-hESC - Farnham - ENCSR000EUO

H1-hESC Farnham CTBP2 ENCSR000EUO r=1.00
H1-hESC Farnham H3K4me2 ENCSR000ANC r=0.40
H1-hESC Farnham H3K4me3 ENCSR000AMG r=0.34
H1-hESC Farnham H3K4me1 ENCSR000ANA r=0.32
H1-hESC Farnham H3K27me3 ENCSR000ALU r=0.31
H1-hESC Farnham H2AFZ ENCSR000APX r=0.27
H1-hESC Farnham H3K9ac ENCSR000AND r=0.24
H1-hESC Farnham H4K20me1 ENCSR000AMH r=0.20
H1-hESC Farnham H3K27ac ENCSR000ANP r=0.18
H1-hESC Farnham H3K9me3 ENCSR000APZ r=0.00
H1-hESC Farnham H3K79me2 ENCSR000APY r=-0.06
H1-hESC Farnham H3K36me3 ENCSR000ANB r=-0.10

7,089 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

Binding of other TFs at CTBP2 peaks

H1-hESC - Farnham

H1-hESC - Farnham - ENCSR000EUO

H1-hESC Farnham CTBP2 ENCSR000EUO r=1.00
H1-hESC Farnham SUZ12 ENCSR000ATS r=0.58
H1-hESC Farnham HDAC2 ENCSR000AVB r=0.57
H1-hESC Farnham RBBP5 ENCSR000AQC r=0.55
H1-hESC Farnham CHD7 ENCSR000AVA r=0.55
H1-hESC Farnham EP300 ENCSR000AUQ r=0.51
H1-hESC Farnham SIN3A ENCSR000EBO r=0.49
H1-hESC Farnham MXI1 ENCSR000EBR r=0.47
H1-hESC Farnham MAX ENCSR000BSJ r=0.45
H1-hESC Farnham KDM4A ENCSR000AVC r=0.44
H1-hESC Farnham BACH1 ENCSR000EBQ r=0.44
H1-hESC Farnham JUND ENCSR000EBZ r=0.43
H1-hESC Farnham ZNF143 ENCSR000EBW r=0.42
H1-hESC Farnham CHD1 ENCSR000AQK r=0.40
H1-hESC Farnham MYC ENCSR000EBY r=0.40
H1-hESC Farnham SUZ12 ENCSR000EUQ r=0.39
H1-hESC Farnham EZH2 ENCSR000ASY r=0.39
H1-hESC Farnham HDAC6 ENCSR000ATQ r=0.39
H1-hESC Farnham TEAD4 ENCSR000BRY r=0.39
H1-hESC Farnham RAD21 ENCSR000ECE r=0.37
H1-hESC Farnham CEBPB ENCSR000EBV r=0.36
H1-hESC Farnham E2F6 ENCSR000BSI r=0.36
H1-hESC Farnham MAX ENCSR000EUP r=0.35
H1-hESC Farnham KDM5B ENCSR000AUR r=0.35
H1-hESC Farnham BRCA1 ENCSR000EBX r=0.34
H1-hESC Farnham JUN ENCSR000ECA r=0.34
H1-hESC Farnham SIRT6 ENCSR000AUS r=0.34
H1-hESC Farnham USF2 ENCSR000ECD r=0.34
H1-hESC Farnham SAP30 ENCSR000ATR r=0.33
H1-hESC Farnham YY1 ENCSR000BKD r=0.32
H1-hESC Farnham CREB1 ENCSR000BSN r=0.32
H1-hESC Farnham CHD1 ENCSR000EBU r=0.31
H1-hESC Farnham CTCF ENCSR000DLK r=0.29
H1-hESC Farnham GABPA ENCSR000BIW r=0.28
H1-hESC Farnham RFX5 ENCSR000ECF r=0.28
H1-hESC Farnham TBP ENCSR000ECB r=0.27
H1-hESC Farnham PHF8 ENCSR000ATK r=0.27
H1-hESC Farnham SP1 ENCSR000BIR r=0.27
H1-hESC Farnham CTCF ENCSR000AMF r=0.26
H1-hESC Farnham MAFK ENCSR000EBS r=0.25
H1-hESC Farnham POLR2A ENCSR000DLJ r=0.24
H1-hESC Farnham NRF1 ENCSR000ECC r=0.23
H1-hESC Farnham SIN3A ENCSR000BIS r=0.23
H1-hESC Farnham RAD21 ENCSR000BLD r=0.22
H1-hESC Farnham EGR1 ENCSR000BJA r=0.21
H1-hESC Farnham TCF12 ENCSR000BIT r=0.21
H1-hESC Farnham MYC ENCSR000DLI r=0.21
H1-hESC Farnham HDAC2 ENCSR000BNR r=0.20
H1-hESC Farnham ATF2 ENCSR000BQU r=0.20
H1-hESC Farnham CTCF ENCSR000BNH r=0.19
H1-hESC Farnham TAF1 ENCSR000BHO r=0.19
H1-hESC Farnham KDM5A ENCSR000AQL r=0.18
H1-hESC Farnham JUND ENCSR000BKP r=0.17
H1-hESC Farnham POLR2A ENCSR000BHN r=0.15
H1-hESC Farnham EP300 ENCSR000BKK r=0.14
H1-hESC Farnham NANOG ENCSR000BMT r=0.13
H1-hESC Farnham SP4 ENCSR000BQV r=0.13
H1-hESC Farnham BCL11A ENCSR000BMJ r=0.12
H1-hESC Farnham USF1 ENCSR000BIU r=0.11
H1-hESC Farnham BCL11A ENCSR000BIP r=0.10
H1-hESC Farnham SRF ENCSR000BIV r=0.09
H1-hESC Farnham TAF7 ENCSR000BLU r=0.09
H1-hESC Farnham FOSL1 ENCSR000BNS r=0.09
H1-hESC Farnham RXRA ENCSR000BJW r=0.09
H1-hESC Farnham REST ENCSR000BHM r=0.07
H1-hESC Farnham ATF3 ENCSR000BKC r=0.07
H1-hESC Farnham SIX5 ENCSR000BIQ r=0.07
H1-hESC Farnham SP2 ENCSR000BQG r=0.04
H1-hESC Farnham ZNF274 ENCSR000EUN r=0.02

7,089 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.