CTBP2

This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3; however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. Several transcript variants encoding two different isoforms have been found for this gene. RefSeq, Feb 2014
C-terminal-binding protein 2 also known as CtBP2 is a protein that in humans is encoded by the CTBP2 gene.wikipedia

CTBP2

PDB image
PDB 2OME

PDB 2OME 4LCJ
ENCODE experiments
Ensemble search
Entrez 1488
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia CTBP2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

H1-hESC - Farnham - ENCSR000EUO

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

H1-hESC - Farnham - ENCSR000EUO

1.
225 / 500
3.8e-231
GGGAGGGAGGGGGAGAGGGGG
small heat map img p-value: 0.00
pct_center: 0.75
pct_ratio: 0.56
2.
122 / 500
6.3e-27
GGGGAGGGAGA
small heat map img p-value: 0.00
pct_center: 0.60
pct_ratio: 0.58
3.
24 / 500
1.6e-15
GAGGAATGTCAGGAATGT
small heat map img p-value: 0.39
pct_center: 0.09
pct_ratio: 0.55
4.
24 / 500
0.16
AGTGAGTGCGTGGGTGAGTG
small heat map img p-value: 0.00
pct_center: 0.40
pct_ratio: 0.54
5.
28 / 500
4.9
AAGGAAGTGCA
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.52
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at CTBP2 peaks

H1-hESC - Farnham - ENCSR000EUO

H1-hESC
Farnham
CTBP2
ENCSR000EUO
r=1.00

small heat map img

H1-hESC
Farnham
H3K4me2
ENCSR000ANC
r=0.40

small heat map img

H1-hESC
Farnham
H3K4me3
ENCSR000AMG
r=0.34

small heat map img

H1-hESC
Farnham
H3K4me1
ENCSR000ANA
r=0.32

small heat map img

H1-hESC
Farnham
H3K27me3
ENCSR000ALU
r=0.31

small heat map img

H1-hESC
Farnham
H2AFZ
ENCSR000APX
r=0.27

small heat map img

H1-hESC
Farnham
H3K9ac
ENCSR000AND
r=0.24

small heat map img

H1-hESC
Farnham
H4K20me1
ENCSR000AMH
r=0.20

small heat map img

H1-hESC
Farnham
H3K27ac
ENCSR000ANP
r=0.18

small heat map img

H1-hESC
Farnham
H3K9me3
ENCSR000APZ
r=0.00

small heat map img

H1-hESC
Farnham
H3K79me2
ENCSR000APY
r=-0.06

small heat map img

H1-hESC
Farnham
H3K36me3
ENCSR000ANB
r=-0.10

small heat map img
7,089 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at CTBP2 peaks

H1-hESC - Farnham - ENCSR000EUO

H1-hESC
Farnham
CTBP2
ENCSR000EUO
r=1.00

small heat map img

H1-hESC
Farnham
SUZ12
ENCSR000ATS
r=0.58

small heat map img

H1-hESC
Farnham
HDAC2
ENCSR000AVB
r=0.57

small heat map img

H1-hESC
Farnham
RBBP5
ENCSR000AQC
r=0.55

small heat map img

H1-hESC
Farnham
CHD7
ENCSR000AVA
r=0.55

small heat map img

H1-hESC
Farnham
EP300
ENCSR000AUQ
r=0.51

small heat map img

H1-hESC
Farnham
SIN3A
ENCSR000EBO
r=0.49

small heat map img

H1-hESC
Farnham
MXI1
ENCSR000EBR
r=0.47

small heat map img

H1-hESC
Farnham
MAX
ENCSR000BSJ
r=0.45

small heat map img

H1-hESC
Farnham
KDM4A
ENCSR000AVC
r=0.44

small heat map img

H1-hESC
Farnham
BACH1
ENCSR000EBQ
r=0.44

small heat map img

H1-hESC
Farnham
JUND
ENCSR000EBZ
r=0.43

small heat map img

H1-hESC
Farnham
ZNF143
ENCSR000EBW
r=0.42

small heat map img

H1-hESC
Farnham
CHD1
ENCSR000AQK
r=0.40

small heat map img

H1-hESC
Farnham
MYC
ENCSR000EBY
r=0.40

small heat map img

H1-hESC
Farnham
SUZ12
ENCSR000EUQ
r=0.39

small heat map img

H1-hESC
Farnham
EZH2
ENCSR000ASY
r=0.39

small heat map img

H1-hESC
Farnham
HDAC6
ENCSR000ATQ
r=0.39

small heat map img

H1-hESC
Farnham
TEAD4
ENCSR000BRY
r=0.39

small heat map img

H1-hESC
Farnham
RAD21
ENCSR000ECE
r=0.37

small heat map img

H1-hESC
Farnham
CEBPB
ENCSR000EBV
r=0.36

small heat map img

H1-hESC
Farnham
E2F6
ENCSR000BSI
r=0.36

small heat map img

H1-hESC
Farnham
MAX
ENCSR000EUP
r=0.35

small heat map img

H1-hESC
Farnham
KDM5B
ENCSR000AUR
r=0.35

small heat map img

H1-hESC
Farnham
BRCA1
ENCSR000EBX
r=0.34

small heat map img

H1-hESC
Farnham
JUN
ENCSR000ECA
r=0.34

small heat map img

H1-hESC
Farnham
SIRT6
ENCSR000AUS
r=0.34

small heat map img

H1-hESC
Farnham
USF2
ENCSR000ECD
r=0.34

small heat map img

H1-hESC
Farnham
SAP30
ENCSR000ATR
r=0.33

small heat map img

H1-hESC
Farnham
YY1
ENCSR000BKD
r=0.32

small heat map img

H1-hESC
Farnham
CREB1
ENCSR000BSN
r=0.32

small heat map img

H1-hESC
Farnham
CHD1
ENCSR000EBU
r=0.31

small heat map img

H1-hESC
Farnham
CTCF
ENCSR000DLK
r=0.29

small heat map img

H1-hESC
Farnham
GABPA
ENCSR000BIW
r=0.28

small heat map img

H1-hESC
Farnham
RFX5
ENCSR000ECF
r=0.28

small heat map img

H1-hESC
Farnham
TBP
ENCSR000ECB
r=0.27

small heat map img

H1-hESC
Farnham
PHF8
ENCSR000ATK
r=0.27

small heat map img

H1-hESC
Farnham
SP1
ENCSR000BIR
r=0.27

small heat map img

H1-hESC
Farnham
CTCF
ENCSR000AMF
r=0.26

small heat map img

H1-hESC
Farnham
MAFK
ENCSR000EBS
r=0.25

small heat map img

H1-hESC
Farnham
POLR2A
ENCSR000DLJ
r=0.24

small heat map img

H1-hESC
Farnham
NRF1
ENCSR000ECC
r=0.23

small heat map img

H1-hESC
Farnham
SIN3A
ENCSR000BIS
r=0.23

small heat map img

H1-hESC
Farnham
RAD21
ENCSR000BLD
r=0.22

small heat map img

H1-hESC
Farnham
EGR1
ENCSR000BJA
r=0.21

small heat map img

H1-hESC
Farnham
TCF12
ENCSR000BIT
r=0.21

small heat map img

H1-hESC
Farnham
MYC
ENCSR000DLI
r=0.21

small heat map img

H1-hESC
Farnham
HDAC2
ENCSR000BNR
r=0.20

small heat map img

H1-hESC
Farnham
ATF2
ENCSR000BQU
r=0.20

small heat map img

H1-hESC
Farnham
CTCF
ENCSR000BNH
r=0.19

small heat map img

H1-hESC
Farnham
TAF1
ENCSR000BHO
r=0.19

small heat map img

H1-hESC
Farnham
KDM5A
ENCSR000AQL
r=0.18

small heat map img

H1-hESC
Farnham
JUND
ENCSR000BKP
r=0.17

small heat map img

H1-hESC
Farnham
POLR2A
ENCSR000BHN
r=0.15

small heat map img

H1-hESC
Farnham
EP300
ENCSR000BKK
r=0.14

small heat map img

H1-hESC
Farnham
NANOG
ENCSR000BMT
r=0.13

small heat map img

H1-hESC
Farnham
SP4
ENCSR000BQV
r=0.13

small heat map img

H1-hESC
Farnham
BCL11A
ENCSR000BMJ
r=0.12

small heat map img

H1-hESC
Farnham
USF1
ENCSR000BIU
r=0.11

small heat map img

H1-hESC
Farnham
BCL11A
ENCSR000BIP
r=0.10

small heat map img

H1-hESC
Farnham
SRF
ENCSR000BIV
r=0.09

small heat map img

H1-hESC
Farnham
TAF7
ENCSR000BLU
r=0.09

small heat map img

H1-hESC
Farnham
FOSL1
ENCSR000BNS
r=0.09

small heat map img

H1-hESC
Farnham
RXRA
ENCSR000BJW
r=0.09

small heat map img

H1-hESC
Farnham
REST
ENCSR000BHM
r=0.07

small heat map img

H1-hESC
Farnham
ATF3
ENCSR000BKC
r=0.07

small heat map img

H1-hESC
Farnham
SIX5
ENCSR000BIQ
r=0.07

small heat map img

H1-hESC
Farnham
SP2
ENCSR000BQG
r=0.04

small heat map img

H1-hESC
Farnham
ZNF274
ENCSR000EUN
r=0.02

small heat map img
7,089 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

No GM12878 or K562 datasets available.

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help