CHD1

The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. RefSeq, Jul 2008
Chromodomain-helicase-DNA-binding protein 1 is an enzyme that in humans is encoded by the CHD1 gene. The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains.wikipedia

CHD1

PDB image
PDB 2B2T

PDB 2B2T 2B2U 2B2V 2B2W 2B2Y 4B4C 4NW2 4O42
ENCODE experiments
Ensemble search
Entrez 1105
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia CHD1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZE

loading

H1-hESC - Bernstein - ENCSR000AQK

loading

H1-hESC - Snyder - ENCSR000EBU

loading

K562 - Bernstein - ENCSR000AQD

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZE

1.
102 / 500
7.7e-74
AAATAAAAAAAAAAAAAAATT
small heat map img p-value: 0.70
pct_center: 0.21
pct_ratio: 0.44
2.
91 / 500
5.3e-109
GGGCGGGCCGTACCACTGCGGGGGGGGGGG
small heat map img p-value: 0.87
pct_center: 0.25
pct_ratio: 0.56
3.
89 / 500
1.5e-16
GGGGGCGGCGGCGGGGGGGGG
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 0.55
4.
36 / 500
0.0086
GAAAAATTGTTTTGGAAAATT
small heat map img p-value: 0.00
pct_center: 0.08
pct_ratio: 0.43
5.
53 / 500
0.053
GGAGAAAGAAG
small heat map img p-value: 0.00
pct_center: 0.34
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Bernstein - ENCSR000AQK

1.
16 / 500
2.0e-88
ACGTGGGTGGCTCTGAAAAGAGCCTTTG
small heat map img p-value: 0.02
pct_center: 0.08
pct_ratio: 0.52
2.
113 / 500
3.9e-50
GAGAAAGAGGGAGGGAGAAAG
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 0.49
3.
45 / 500
8.5e-17
AAAAGAAGAAAAAAA
small heat map img p-value: 0.72
pct_center: 0.23
pct_ratio: 0.53
4.
74 / 500
6.1e-12
GGGGCGGGGAGGCGGGGGGTG
small heat map img p-value: 1.00
pct_center: 0.53
pct_ratio: 0.44
5.
6 / 500
9.3e-9
GACGCACTCTTTATGGCTTCGGCGGCTAAG
small heat map img p-value: 0.00
pct_center: 0.07
pct_ratio: 0.46
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Snyder - ENCSR000EBU

1.
115 / 500
1.3e-85
AAAAAGATTAAAAATAAATAAAAAAAAAAT
small heat map img p-value: 0.03
pct_center: 0.21
pct_ratio: 0.52
2.
115 / 500
1.3e-134
GGGCGGTACCACTGGGGGGGGGGGGGGGG
small heat map img p-value: 0.08
pct_center: 0.27
pct_ratio: 0.62
3.
7 / 500
2.0e-15
TGGCTCTGAAAAGAGCCTTTG
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.60
4.
6 / 500
3.1e-14
TTGTGGTGGCTCTCAGTCTTCTTGGGCAG
small heat map img p-value: 0.33
pct_center: 0.06
pct_ratio: 0.47
5.
5 / 500
2.8e-12
CCTGGATGTTGGGCAGGACACCGCCCTG
small heat map img p-value: 1.00
pct_center: 0.13
pct_ratio: 0.51
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

IMR-90 - Snyder - ENCSR000EFC

1.
122 / 500
4.1e-104
GAAGAGGAGGAGAAGGAGGAAGAGAAAGAG
small heat map img p-value: 0.00
pct_center: 0.53
pct_ratio: 0.53
2.
48 / 500
3.5e-14
GCAGCGGCGGCGGCGGCGGCG
small heat map img p-value: 0.00
pct_center: 0.51
pct_ratio: 0.55
3.
84 / 500
3.3e-7
AGGAGGGGGAG
small heat map img p-value: 0.06
pct_center: 0.31
pct_ratio: 0.45
4.
13 / 500
0.022
TGTGTGTGCGTGTGTTTGTGGGTGTGTGT
small heat map img p-value: 0.35
pct_center: 0.10
pct_ratio: 0.50
5.
16 / 500
0.000020
AGATTTTTAGAAAATTAAAAAACATTTGT
small heat map img p-value: 0.50
pct_center: 0.07
pct_ratio: 0.30
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Bernstein - ENCSR000AQD

1.
63 / 500
3.6e-30
GAAAAGCCAGCAAAAGGACAAGGAAAAAG
small heat map img p-value: 0.72
pct_center: 0.33
pct_ratio: 0.48
2.
18 / 500
1.7e-10
CTACGCGAGCCCGGGGATTCG
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 0.56
3.
7 / 500
5.6e-9
GCCGTCTGGATCTCCCTGGAGGTGATGGT
small heat map img p-value: 0.51
pct_center: 0.24
pct_ratio: 0.57
4.
9 / 500
8.4e-9
CATGCTGCTGCCCGGGGAGCTGGCCAAGCA
small heat map img p-value: 0.96
pct_center: 0.25
pct_ratio: 0.56
5.
8 / 500
0.00021
GGCTCTGAAAAGAGCCTTTGGGGTTGGA
small heat map img p-value: 0.75
pct_center: 0.09
pct_ratio: 0.54
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at CHD1 peaks

GM12878 - Snyder - ENCSR000DZE

GM12878
Snyder
CHD1
ENCSR000DZE
r=1.00

small heat map img

GM12878
Snyder
H3K9ac
ENCSR000AKH
r=0.38

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000AKA
r=0.36

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000DRY
r=0.35

small heat map img

GM12878
Snyder
H3K27ac
ENCSR000AKC
r=0.34

small heat map img

GM12878
Snyder
H3K4me2
ENCSR000AKG
r=0.29

small heat map img

GM12878
Snyder
H2AFZ
ENCSR000AOV
r=0.25

small heat map img

GM12878
Snyder
H3K79me2
ENCSR000AOW
r=0.25

small heat map img

GM12878
Snyder
H3K4me1
ENCSR000AKF
r=0.04

small heat map img

GM12878
Snyder
H4K20me1
ENCSR000AKI
r=0.04

small heat map img

GM12878
Snyder
H3K9me3
ENCSR000AOX
r=0.04

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000AKE
r=-0.02

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000DRW
r=-0.03

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000AKD
r=-0.03

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000DRX
r=-0.06

small heat map img
6,668 peaks (download )

H1-hESC - Bernstein - ENCSR000AQK

H1-hESC
Bernstein
CHD1
ENCSR000AQK
r=1.00

small heat map img

H1-hESC
Bernstein
CHD1
ENCSR000EBU
r=0.80

small heat map img

H1-hESC
Bernstein
H3K9ac
ENCSR000AND
r=0.38

small heat map img

H1-hESC
Bernstein
H3K4me3
ENCSR000AMG
r=0.36

small heat map img

H1-hESC
Bernstein
H3K27ac
ENCSR000ANP
r=0.36

small heat map img

H1-hESC
Bernstein
H3K4me2
ENCSR000ANC
r=0.33

small heat map img

H1-hESC
Bernstein
H3K79me2
ENCSR000APY
r=0.23

small heat map img

H1-hESC
Bernstein
H4K20me1
ENCSR000AMH
r=0.15

small heat map img

H1-hESC
Bernstein
H3K4me1
ENCSR000ANA
r=0.10

small heat map img

H1-hESC
Bernstein
H3K36me3
ENCSR000ANB
r=0.10

small heat map img

H1-hESC
Bernstein
H2AFZ
ENCSR000APX
r=0.09

small heat map img

H1-hESC
Bernstein
H3K9me3
ENCSR000APZ
r=0.03

small heat map img

H1-hESC
Bernstein
H3K27me3
ENCSR000ALU
r=-0.02

small heat map img
7,247 peaks (download )

H1-hESC - Snyder - ENCSR000EBU

H1-hESC
Snyder
CHD1
ENCSR000EBU
r=1.00

small heat map img

H1-hESC
Snyder
CHD1
ENCSR000AQK
r=0.71

small heat map img

H1-hESC
Snyder
H3K9ac
ENCSR000AND
r=0.40

small heat map img

H1-hESC
Snyder
H3K27ac
ENCSR000ANP
r=0.40

small heat map img

H1-hESC
Snyder
H3K4me3
ENCSR000AMG
r=0.37

small heat map img

H1-hESC
Snyder
H3K4me2
ENCSR000ANC
r=0.33

small heat map img

H1-hESC
Snyder
H2AFZ
ENCSR000APX
r=0.16

small heat map img

H1-hESC
Snyder
H3K79me2
ENCSR000APY
r=0.12

small heat map img

H1-hESC
Snyder
H4K20me1
ENCSR000AMH
r=0.08

small heat map img

H1-hESC
Snyder
H3K4me1
ENCSR000ANA
r=0.08

small heat map img

H1-hESC
Snyder
H3K36me3
ENCSR000ANB
r=0.05

small heat map img

H1-hESC
Snyder
H3K9me3
ENCSR000APZ
r=0.01

small heat map img

H1-hESC
Snyder
H3K27me3
ENCSR000ALU
r=-0.09

small heat map img
2,191 peaks (download )

IMR-90 - Snyder - ENCSR000EFC

IMR-90
Snyder
CHD1
ENCSR000EFC
r=1.00

small heat map img
5,777 peaks (download )

K562 - Bernstein - ENCSR000AQD

K562
Bernstein
CHD1
ENCSR000AQD
r=1.00

small heat map img

K562
Bernstein
H3K9ac
ENCSR000AKV
r=0.42

small heat map img

K562
Bernstein
H3K4me3
ENCSR000AKU
r=0.41

small heat map img

K562
Bernstein
H3K4me2
ENCSR000AKT
r=0.39

small heat map img

K562
Bernstein
H3K4me3
ENCSR000DWD
r=0.37

small heat map img

K562
Bernstein
H3K27ac
ENCSR000AKP
r=0.37

small heat map img

K562
Bernstein
H3K79me2
ENCSR000APD
r=0.35

small heat map img

K562
Bernstein
H3K9ac
ENCSR000EVZ
r=0.35

small heat map img

K562
Bernstein
H3K4me3
ENCSR000EWA
r=0.34

small heat map img

K562
Bernstein
H4K20me1
ENCSR000AKX
r=0.23

small heat map img

K562
Bernstein
H2AFZ
ENCSR000APC
r=0.17

small heat map img

K562
Bernstein
H3K36me3
ENCSR000AKR
r=0.17

small heat map img

K562
Bernstein
H3K9me3
ENCSR000APE
r=0.11

small heat map img

K562
Bernstein
H3K4me1
ENCSR000EWC
r=0.10

small heat map img

K562
Bernstein
H3K9me1
ENCSR000AKW
r=0.09

small heat map img

K562
Bernstein
H3K4me1
ENCSR000AKS
r=0.08

small heat map img

K562
Bernstein
H3K36me3
ENCSR000DWB
r=0.07

small heat map img

K562
Bernstein
H3K27me3
ENCSR000AKQ
r=0.06

small heat map img

K562
Bernstein
H3K27me3
ENCSR000DWC
r=0.02

small heat map img

K562
Bernstein
H3K27me3
ENCSR000EWB
r=-0.03

small heat map img
9,350 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at CHD1 peaks

GM12878 - Snyder - ENCSR000DZE

GM12878
Snyder
CHD1
ENCSR000DZE
r=1.00

small heat map img

GM12878
Snyder
POLR2A
ENCSR000DKT
r=0.53

small heat map img

GM12878
Snyder
JUND
ENCSR000DYS
r=0.53

small heat map img

GM12878
Snyder
SREBF1
ENCSR000DYU
r=0.53

small heat map img

GM12878
Snyder
TBL1XR1
ENCSR000DYZ
r=0.52

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EAD
r=0.52

small heat map img

GM12878
Snyder
RCOR1
ENCSR000DZC
r=0.50

small heat map img

GM12878
Snyder
SIN3A
ENCSR000DYX
r=0.48

small heat map img

GM12878
Snyder
BHLHE40
ENCSR000DZJ
r=0.48

small heat map img

GM12878
Snyder
STAT1
ENCSR000DZM
r=0.48

small heat map img

GM12878
Snyder
MXI1
ENCSR000DZI
r=0.48

small heat map img

GM12878
Snyder
KAT2A
ENCSR000DNO
r=0.47

small heat map img

GM12878
Snyder
ESRRA
ENCSR000DYQ
r=0.47

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EYW
r=0.47

small heat map img

GM12878
Snyder
MAX
ENCSR000DZF
r=0.46

small heat map img

GM12878
Snyder
ELK1
ENCSR000DZB
r=0.44

small heat map img

GM12878
Snyder
POLR2A
ENCSR000BGD
r=0.44

small heat map img

GM12878
Snyder
POU2F2
ENCSR000BGP
r=0.44

small heat map img

GM12878
Snyder
PML
ENCSR000BQM
r=0.42

small heat map img

GM12878
Snyder
WRNIP1
ENCSR000EAA
r=0.42

small heat map img

GM12878
Snyder
STAT3
ENCSR000DZV
r=0.42

small heat map img

GM12878
Snyder
RELA
ENCSR000EAG
r=0.42

small heat map img

GM12878
Snyder
BRCA1
ENCSR000DZS
r=0.42

small heat map img

GM12878
Snyder
MAFK
ENCSR000DYV
r=0.41

small heat map img

GM12878
Snyder
SMC3
ENCSR000DZP
r=0.40

small heat map img

GM12878
Snyder
TBP
ENCSR000DZZ
r=0.40

small heat map img

GM12878
Snyder
CUX1
ENCSR000DYR
r=0.40

small heat map img

GM12878
Snyder
E2F4
ENCSR000DYY
r=0.37

small heat map img

GM12878
Snyder
SREBF2
ENCSR000DYT
r=0.37

small heat map img

GM12878
Snyder
EP300
ENCSR000DZG
r=0.35

small heat map img

GM12878
Snyder
EP300
ENCSR000DZD
r=0.35

small heat map img

GM12878
Snyder
IRF3
ENCSR000DZX
r=0.35

small heat map img

GM12878
Snyder
EP300
ENCSR000BHB
r=0.35

small heat map img

GM12878
Snyder
FOXM1
ENCSR000BRU
r=0.35

small heat map img

GM12878
Snyder
NFIC
ENCSR000BRN
r=0.34

small heat map img

GM12878
Snyder
RUNX3
ENCSR000BRI
r=0.34

small heat map img

GM12878
Snyder
CEBPB
ENCSR000BRX
r=0.33

small heat map img

GM12878
Snyder
STAT5A
ENCSR000BQZ
r=0.33

small heat map img

GM12878
Snyder
YY1
ENCSR000BNP
r=0.32

small heat map img

GM12878
Snyder
ATF2
ENCSR000BQK
r=0.31

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHD
r=0.31

small heat map img

GM12878
Snyder
NFATC1
ENCSR000BQL
r=0.30

small heat map img

GM12878
Snyder
TAF1
ENCSR000BGS
r=0.30

small heat map img

GM12878
Snyder
MTA3
ENCSR000BRH
r=0.30

small heat map img

GM12878
Snyder
MYC
ENCSR000DKU
r=0.30

small heat map img

GM12878
Snyder
TCF12
ENCSR000BGZ
r=0.29

small heat map img

GM12878
Snyder
RAD21
ENCSR000EAC
r=0.29

small heat map img

GM12878
Snyder
ELF1
ENCSR000BMB
r=0.29

small heat map img

GM12878
Snyder
TCF3
ENCSR000BQT
r=0.28

small heat map img

GM12878
Snyder
USF2
ENCSR000DZU
r=0.28

small heat map img

GM12878
Snyder
ZNF384
ENCSR000DYP
r=0.27

small heat map img

GM12878
Snyder
CREB1
ENCSR000BUF
r=0.26

small heat map img

GM12878
Snyder
NFE2
ENCSR000DZY
r=0.26

small heat map img

GM12878
Snyder
BCL3
ENCSR000BNQ
r=0.25

small heat map img

GM12878
Snyder
SP1
ENCSR000BHK
r=0.25

small heat map img

GM12878
Snyder
SUPT20H
ENCSR000DNP
r=0.25

small heat map img

GM12878
Snyder
RFX5
ENCSR000DZW
r=0.25

small heat map img

GM12878
Snyder
NRF1
ENCSR000DZO
r=0.25

small heat map img

GM12878
Snyder
SIX5
ENCSR000BJE
r=0.23

small heat map img

GM12878
Snyder
ETS1
ENCSR000BKA
r=0.23

small heat map img

GM12878
Snyder
IKZF1
ENCSR000EUJ
r=0.23

small heat map img

GM12878
Snyder
YY1
ENCSR000EUM
r=0.21

small heat map img

GM12878
Snyder
EGR1
ENCSR000BMQ
r=0.21

small heat map img

GM12878
Snyder
EGR1
ENCSR000BRG
r=0.19

small heat map img

GM12878
Snyder
PBX3
ENCSR000BGR
r=0.19

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHJ
r=0.18

small heat map img

GM12878
Snyder
MEF2A
ENCSR000BKB
r=0.18

small heat map img

GM12878
Snyder
NFYA
ENCSR000DNN
r=0.18

small heat map img

GM12878
Snyder
BCL11A
ENCSR000BHA
r=0.18

small heat map img

GM12878
Snyder
EBF1
ENCSR000DZQ
r=0.18

small heat map img

GM12878
Snyder
EZH2
ENCSR000ARD
r=0.18

small heat map img

GM12878
Snyder
IRF4
ENCSR000BGY
r=0.17

small heat map img

GM12878
Snyder
SRF
ENCSR000BMI
r=0.17

small heat map img

GM12878
Snyder
ZNF143
ENCSR000DZL
r=0.17

small heat map img

GM12878
Snyder
CTCF
ENCSR000DZN
r=0.17

small heat map img

GM12878
Snyder
FOS
ENCSR000EYZ
r=0.16

small heat map img

GM12878
Snyder
CTCF
ENCSR000AKB
r=0.16

small heat map img

GM12878
Snyder
JUND
ENCSR000EYV
r=0.16

small heat map img

GM12878
Snyder
RXRA
ENCSR000BJD
r=0.15

small heat map img

GM12878
Snyder
CTCF
ENCSR000DKV
r=0.14

small heat map img

GM12878
Snyder
REST
ENCSR000BGF
r=0.14

small heat map img

GM12878
Snyder
POLR3G
ENCSR000EYU
r=0.14

small heat map img

GM12878
Snyder
EBF1
ENCSR000BGU
r=0.13

small heat map img

GM12878
Snyder
ZBTB33
ENCSR000BHC
r=0.13

small heat map img

GM12878
Snyder
NFYB
ENCSR000DNM
r=0.12

small heat map img

GM12878
Snyder
GABPA
ENCSR000BGC
r=0.12

small heat map img

GM12878
Snyder
MEF2C
ENCSR000BNG
r=0.12

small heat map img

GM12878
Snyder
REST
ENCSR000BQS
r=0.12

small heat map img

GM12878
Snyder
NR2C2
ENCSR000EUL
r=0.12

small heat map img

GM12878
Snyder
SRF
ENCSR000BGE
r=0.11

small heat map img

GM12878
Snyder
CTCF
ENCSR000DRZ
r=0.11

small heat map img

GM12878
Snyder
ZZZ3
ENCSR000DNQ
r=0.11

small heat map img

GM12878
Snyder
USF1
ENCSR000BGI
r=0.10

small heat map img

GM12878
Snyder
SPI1
ENCSR000BGQ
r=0.10

small heat map img

GM12878
Snyder
BATF
ENCSR000BGT
r=0.09

small heat map img

GM12878
Snyder
ZEB1
ENCSR000BND
r=0.09

small heat map img

GM12878
Snyder
RAD21
ENCSR000BMY
r=0.09

small heat map img

GM12878
Snyder
ATF3
ENCSR000BJY
r=0.08

small heat map img

GM12878
Snyder
ZNF274
ENCSR000EUK
r=-0.03

small heat map img
6,668 peaks (download )

H1-hESC - Bernstein - ENCSR000AQK

H1-hESC
Bernstein
CHD1
ENCSR000AQK
r=1.00

small heat map img

H1-hESC
Bernstein
CHD1
ENCSR000EBU
r=0.80

small heat map img

H1-hESC
Bernstein
SIRT6
ENCSR000AUS
r=0.49

small heat map img

H1-hESC
Bernstein
CHD7
ENCSR000AVA
r=0.41

small heat map img

H1-hESC
Bernstein
SAP30
ENCSR000ATR
r=0.33

small heat map img

H1-hESC
Bernstein
POLR2A
ENCSR000BHN
r=0.32

small heat map img

H1-hESC
Bernstein
POLR2A
ENCSR000DLJ
r=0.31

small heat map img

H1-hESC
Bernstein
KDM5B
ENCSR000AUR
r=0.29

small heat map img

H1-hESC
Bernstein
HDAC6
ENCSR000ATQ
r=0.25

small heat map img

H1-hESC
Bernstein
MAFK
ENCSR000EBS
r=0.22

small heat map img

H1-hESC
Bernstein
SIN3A
ENCSR000EBO
r=0.19

small heat map img

H1-hESC
Bernstein
ATF2
ENCSR000BQU
r=0.18

small heat map img

H1-hESC
Bernstein
BRCA1
ENCSR000EBX
r=0.17

small heat map img

H1-hESC
Bernstein
HDAC2
ENCSR000AVB
r=0.16

small heat map img

H1-hESC
Bernstein
TAF7
ENCSR000BLU
r=0.15

small heat map img

H1-hESC
Bernstein
USF2
ENCSR000ECD
r=0.14

small heat map img

H1-hESC
Bernstein
MXI1
ENCSR000EBR
r=0.13

small heat map img

H1-hESC
Bernstein
PHF8
ENCSR000ATK
r=0.13

small heat map img

H1-hESC
Bernstein
KDM5A
ENCSR000AQL
r=0.12

small heat map img

H1-hESC
Bernstein
MYC
ENCSR000EBY
r=0.11

small heat map img

H1-hESC
Bernstein
TAF1
ENCSR000BHO
r=0.10

small heat map img

H1-hESC
Bernstein
TBP
ENCSR000ECB
r=0.10

small heat map img

H1-hESC
Bernstein
ZNF274
ENCSR000EUN
r=0.10

small heat map img

H1-hESC
Bernstein
JUND
ENCSR000EBZ
r=0.10

small heat map img

H1-hESC
Bernstein
JUN
ENCSR000ECA
r=0.10

small heat map img

H1-hESC
Bernstein
RFX5
ENCSR000ECF
r=0.09

small heat map img

H1-hESC
Bernstein
RBBP5
ENCSR000AQC
r=0.09

small heat map img

H1-hESC
Bernstein
MAX
ENCSR000EUP
r=0.07

small heat map img

H1-hESC
Bernstein
SIN3A
ENCSR000BIS
r=0.07

small heat map img

H1-hESC
Bernstein
NRF1
ENCSR000ECC
r=0.06

small heat map img

H1-hESC
Bernstein
CEBPB
ENCSR000EBV
r=0.06

small heat map img

H1-hESC
Bernstein
YY1
ENCSR000BKD
r=0.06

small heat map img

H1-hESC
Bernstein
EP300
ENCSR000AUQ
r=0.06

small heat map img

H1-hESC
Bernstein
RAD21
ENCSR000ECE
r=0.06

small heat map img

H1-hESC
Bernstein
SUZ12
ENCSR000EUQ
r=0.05

small heat map img

H1-hESC
Bernstein
JUND
ENCSR000BKP
r=0.05

small heat map img

H1-hESC
Bernstein
CTBP2
ENCSR000EUO
r=0.04

small heat map img

H1-hESC
Bernstein
BCL11A
ENCSR000BIP
r=0.04

small heat map img

H1-hESC
Bernstein
BCL11A
ENCSR000BMJ
r=0.04

small heat map img

H1-hESC
Bernstein
TEAD4
ENCSR000BRY
r=0.04

small heat map img

H1-hESC
Bernstein
SUZ12
ENCSR000ATS
r=0.04

small heat map img

H1-hESC
Bernstein
REST
ENCSR000BHM
r=0.03

small heat map img

H1-hESC
Bernstein
BACH1
ENCSR000EBQ
r=0.02

small heat map img

H1-hESC
Bernstein
HDAC2
ENCSR000BNR
r=0.01

small heat map img

H1-hESC
Bernstein
SP4
ENCSR000BQV
r=0.01

small heat map img

H1-hESC
Bernstein
MYC
ENCSR000DLI
r=0.01

small heat map img

H1-hESC
Bernstein
CTCF
ENCSR000AMF
r=0.01

small heat map img

H1-hESC
Bernstein
EGR1
ENCSR000BJA
r=0.01

small heat map img

H1-hESC
Bernstein
KDM4A
ENCSR000AVC
r=0.01

small heat map img

H1-hESC
Bernstein
FOSL1
ENCSR000BNS
r=0.00

small heat map img

H1-hESC
Bernstein
TCF12
ENCSR000BIT
r=-0.00

small heat map img

H1-hESC
Bernstein
RXRA
ENCSR000BJW
r=-0.00

small heat map img

H1-hESC
Bernstein
EZH2
ENCSR000ASY
r=-0.00

small heat map img

H1-hESC
Bernstein
MAX
ENCSR000BSJ
r=-0.00

small heat map img

H1-hESC
Bernstein
EP300
ENCSR000BKK
r=-0.01

small heat map img

H1-hESC
Bernstein
NANOG
ENCSR000BMT
r=-0.01

small heat map img

H1-hESC
Bernstein
SRF
ENCSR000BIV
r=-0.02

small heat map img

H1-hESC
Bernstein
CTCF
ENCSR000DLK
r=-0.02

small heat map img

H1-hESC
Bernstein
GABPA
ENCSR000BIW
r=-0.02

small heat map img

H1-hESC
Bernstein
RAD21
ENCSR000BLD
r=-0.02

small heat map img

H1-hESC
Bernstein
E2F6
ENCSR000BSI
r=-0.02

small heat map img

H1-hESC
Bernstein
CTCF
ENCSR000BNH
r=-0.03

small heat map img

H1-hESC
Bernstein
SP2
ENCSR000BQG
r=-0.03

small heat map img

H1-hESC
Bernstein
ATF3
ENCSR000BKC
r=-0.04

small heat map img

H1-hESC
Bernstein
ZNF143
ENCSR000EBW
r=-0.04

small heat map img

H1-hESC
Bernstein
USF1
ENCSR000BIU
r=-0.05

small heat map img

H1-hESC
Bernstein
SIX5
ENCSR000BIQ
r=-0.05

small heat map img

H1-hESC
Bernstein
SP1
ENCSR000BIR
r=-0.05

small heat map img

H1-hESC
Bernstein
CREB1
ENCSR000BSN
r=-0.06

small heat map img
7,247 peaks (download )

H1-hESC - Snyder - ENCSR000EBU

H1-hESC
Snyder
CHD1
ENCSR000EBU
r=1.00

small heat map img

H1-hESC
Snyder
CHD1
ENCSR000AQK
r=0.71

small heat map img

H1-hESC
Snyder
SIRT6
ENCSR000AUS
r=0.54

small heat map img

H1-hESC
Snyder
JUND
ENCSR000EBZ
r=0.49

small heat map img

H1-hESC
Snyder
CHD7
ENCSR000AVA
r=0.44

small heat map img

H1-hESC
Snyder
POLR2A
ENCSR000DLJ
r=0.44

small heat map img

H1-hESC
Snyder
BRCA1
ENCSR000EBX
r=0.43

small heat map img

H1-hESC
Snyder
POLR2A
ENCSR000BHN
r=0.42

small heat map img

H1-hESC
Snyder
MAFK
ENCSR000EBS
r=0.41

small heat map img

H1-hESC
Snyder
EP300
ENCSR000BKK
r=0.33

small heat map img

H1-hESC
Snyder
ATF2
ENCSR000BQU
r=0.32

small heat map img

H1-hESC
Snyder
HDAC6
ENCSR000ATQ
r=0.30

small heat map img

H1-hESC
Snyder
USF2
ENCSR000ECD
r=0.29

small heat map img

H1-hESC
Snyder
MXI1
ENCSR000EBR
r=0.29

small heat map img

H1-hESC
Snyder
SIN3A
ENCSR000EBO
r=0.28

small heat map img

H1-hESC
Snyder
TAF7
ENCSR000BLU
r=0.28

small heat map img

H1-hESC
Snyder
MYC
ENCSR000EBY
r=0.27

small heat map img

H1-hESC
Snyder
JUN
ENCSR000ECA
r=0.27

small heat map img

H1-hESC
Snyder
JUND
ENCSR000BKP
r=0.26

small heat map img

H1-hESC
Snyder
TBP
ENCSR000ECB
r=0.26

small heat map img

H1-hESC
Snyder
TAF1
ENCSR000BHO
r=0.25

small heat map img

H1-hESC
Snyder
KDM5B
ENCSR000AUR
r=0.22

small heat map img

H1-hESC
Snyder
RFX5
ENCSR000ECF
r=0.22

small heat map img

H1-hESC
Snyder
NRF1
ENCSR000ECC
r=0.22

small heat map img

H1-hESC
Snyder
SAP30
ENCSR000ATR
r=0.21

small heat map img

H1-hESC
Snyder
SIX5
ENCSR000BIQ
r=0.20

small heat map img

H1-hESC
Snyder
CEBPB
ENCSR000EBV
r=0.20

small heat map img

H1-hESC
Snyder
PHF8
ENCSR000ATK
r=0.18

small heat map img

H1-hESC
Snyder
MAX
ENCSR000EUP
r=0.18

small heat map img

H1-hESC
Snyder
YY1
ENCSR000BKD
r=0.16

small heat map img

H1-hESC
Snyder
BACH1
ENCSR000EBQ
r=0.15

small heat map img

H1-hESC
Snyder
SP1
ENCSR000BIR
r=0.15

small heat map img

H1-hESC
Snyder
TEAD4
ENCSR000BRY
r=0.15

small heat map img

H1-hESC
Snyder
EP300
ENCSR000AUQ
r=0.14

small heat map img

H1-hESC
Snyder
SP4
ENCSR000BQV
r=0.14

small heat map img

H1-hESC
Snyder
KDM5A
ENCSR000AQL
r=0.13

small heat map img

H1-hESC
Snyder
RAD21
ENCSR000ECE
r=0.12

small heat map img

H1-hESC
Snyder
SIN3A
ENCSR000BIS
r=0.11

small heat map img

H1-hESC
Snyder
EGR1
ENCSR000BJA
r=0.11

small heat map img

H1-hESC
Snyder
MAX
ENCSR000BSJ
r=0.10

small heat map img

H1-hESC
Snyder
HDAC2
ENCSR000AVB
r=0.10

small heat map img

H1-hESC
Snyder
ZNF274
ENCSR000EUN
r=0.10

small heat map img

H1-hESC
Snyder
RBBP5
ENCSR000AQC
r=0.09

small heat map img

H1-hESC
Snyder
BCL11A
ENCSR000BMJ
r=0.09

small heat map img

H1-hESC
Snyder
BCL11A
ENCSR000BIP
r=0.09

small heat map img

H1-hESC
Snyder
CREB1
ENCSR000BSN
r=0.08

small heat map img

H1-hESC
Snyder
ZNF143
ENCSR000EBW
r=0.08

small heat map img

H1-hESC
Snyder
CTBP2
ENCSR000EUO
r=0.07

small heat map img

H1-hESC
Snyder
SRF
ENCSR000BIV
r=0.06

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000AMF
r=0.06

small heat map img

H1-hESC
Snyder
GABPA
ENCSR000BIW
r=0.05

small heat map img

H1-hESC
Snyder
REST
ENCSR000BHM
r=0.05

small heat map img

H1-hESC
Snyder
SP2
ENCSR000BQG
r=0.05

small heat map img

H1-hESC
Snyder
FOSL1
ENCSR000BNS
r=0.04

small heat map img

H1-hESC
Snyder
HDAC2
ENCSR000BNR
r=0.04

small heat map img

H1-hESC
Snyder
TCF12
ENCSR000BIT
r=0.04

small heat map img

H1-hESC
Snyder
USF1
ENCSR000BIU
r=0.04

small heat map img

H1-hESC
Snyder
E2F6
ENCSR000BSI
r=0.03

small heat map img

H1-hESC
Snyder
RXRA
ENCSR000BJW
r=0.03

small heat map img

H1-hESC
Snyder
NANOG
ENCSR000BMT
r=0.02

small heat map img

H1-hESC
Snyder
RAD21
ENCSR000BLD
r=0.02

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000BNH
r=0.02

small heat map img

H1-hESC
Snyder
ATF3
ENCSR000BKC
r=0.02

small heat map img

H1-hESC
Snyder
KDM4A
ENCSR000AVC
r=0.01

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000DLK
r=0.01

small heat map img

H1-hESC
Snyder
SUZ12
ENCSR000EUQ
r=0.00

small heat map img

H1-hESC
Snyder
MYC
ENCSR000DLI
r=-0.01

small heat map img

H1-hESC
Snyder
SUZ12
ENCSR000ATS
r=-0.03

small heat map img

H1-hESC
Snyder
EZH2
ENCSR000ASY
r=-0.04

small heat map img
2,191 peaks (download )

IMR-90 - Snyder - ENCSR000EFC

IMR-90
Snyder
CHD1
ENCSR000EFC
r=1.00

small heat map img

IMR-90
Snyder
POLR2A
ENCSR000EFK
r=0.69

small heat map img

IMR-90
Snyder
MXI1
ENCSR000EFE
r=0.58

small heat map img

IMR-90
Snyder
RCOR1
ENCSR000EFG
r=0.57

small heat map img

IMR-90
Snyder
RFX5
ENCSR000EFD
r=0.48

small heat map img

IMR-90
Snyder
MAFK
ENCSR000EFH
r=0.45

small heat map img

IMR-90
Snyder
CEBPB
ENCSR000EFM
r=0.31

small heat map img

IMR-90
Snyder
RAD21
ENCSR000EFJ
r=0.30

small heat map img

IMR-90
Snyder
CTCF
ENCSR000EFI
r=0.25

small heat map img
5,777 peaks (download )

K562 - Bernstein - ENCSR000AQD

K562
Bernstein
CHD1
ENCSR000AQD
r=1.00

small heat map img

K562
Bernstein
SIRT6
ENCSR000AUB
r=0.56

small heat map img

K562
Bernstein
POLR2A
ENCSR000EHL
r=0.46

small heat map img

K562
Bernstein
SAP30
ENCSR000AQJ
r=0.43

small heat map img

K562
Bernstein
HDAC1
ENCSR000AQF
r=0.42

small heat map img

K562
Bernstein
CHD7
ENCSR000AVD
r=0.42

small heat map img

K562
Bernstein
KDM5B
ENCSR000AQA
r=0.41

small heat map img

K562
Bernstein
RBBP5
ENCSR000AQI
r=0.39

small heat map img

K562
Bernstein
SMARCA4
ENCSR000EHO
r=0.38

small heat map img

K562
Bernstein
TBL1XR1
ENCSR000EGA
r=0.37

small heat map img

K562
Bernstein
SMARCB1
ENCSR000EHN
r=0.36

small heat map img

K562
Bernstein
BACH1
ENCSR000EGD
r=0.32

small heat map img

K562
Bernstein
HDAC6
ENCSR000ATJ
r=0.32

small heat map img

K562
Bernstein
HDAC2
ENCSR000AQG
r=0.31

small heat map img

K562
Bernstein
ZMIZ1
ENCSR000EFQ
r=0.29

small heat map img

K562
Bernstein
ZNF274
ENCSR000EVX
r=0.29

small heat map img

K562
Bernstein
POLR2A
ENCSR000BMR
r=0.28

small heat map img

K562
Bernstein
TRIM28
ENCSR000EVY
r=0.28

small heat map img

K562
Bernstein
USF2
ENCSR000EHG
r=0.27

small heat map img

K562
Bernstein
POLR2A
ENCSR000FAX
r=0.27

small heat map img

K562
Bernstein
MXI1
ENCSR000EGZ
r=0.26

small heat map img

K562
Bernstein
RCOR1
ENCSR000EGC
r=0.26

small heat map img

K562
Bernstein
TBL1XR1
ENCSR000EGB
r=0.26

small heat map img

K562
Bernstein
TAL1
ENCSR000EHB
r=0.26

small heat map img

K562
Bernstein
PHF8
ENCSR000AQH
r=0.26

small heat map img

K562
Bernstein
POLR2A
ENCSR000FAY
r=0.25

small heat map img

K562
Bernstein
WHSC1
ENCSR000AVE
r=0.25

small heat map img

K562
Bernstein
UBTF
ENCSR000EFZ
r=0.25

small heat map img

K562
Bernstein
EP300
ENCSR000AQB
r=0.25

small heat map img

K562
Bernstein
UBTF
ENCSR000EFW
r=0.25

small heat map img

K562
Bernstein
SMC3
ENCSR000EGW
r=0.25

small heat map img

K562
Bernstein
ELK1
ENCSR000EFU
r=0.25

small heat map img

K562
Bernstein
POLR2A
ENCSR000DLY
r=0.24

small heat map img

K562
Bernstein
PML
ENCSR000BQY
r=0.24

small heat map img

K562
Bernstein
CUX1
ENCSR000EFO
r=0.23

small heat map img

K562
Bernstein
MAFF
ENCSR000EGI
r=0.22

small heat map img

K562
Bernstein
EZH2
ENCSR000AQE
r=0.22

small heat map img

K562
Bernstein
TRIM28
ENCSR000BRW
r=0.22

small heat map img

K562
Bernstein
SETDB1
ENCSR000AUT
r=0.21

small heat map img

K562
Bernstein
BRF2
ENCSR000DOC
r=0.21

small heat map img

K562
Bernstein
POLR2A
ENCSR000FAW
r=0.21

small heat map img

K562
Bernstein
POLR2A
ENCSR000EHP
r=0.21

small heat map img

K562
Bernstein
MAFK
ENCSR000EGX
r=0.21

small heat map img

K562
Bernstein
ARID3A
ENCSR000EFY
r=0.20

small heat map img

K562
Bernstein
TAF7
ENCSR000BNM
r=0.20

small heat map img

K562
Bernstein
ZNF263
ENCSR000EWN
r=0.20

small heat map img

K562
Bernstein
EP300
ENCSR000EGY
r=0.19

small heat map img

K562
Bernstein
TEAD4
ENCSR000BRK
r=0.19

small heat map img

K562
Bernstein
NCOR1
ENCSR000ATY
r=0.19

small heat map img

K562
Bernstein
CEBPD
ENCSR000BVY
r=0.18

small heat map img

K562
Bernstein
GATA1
ENCSR000EFT
r=0.18

small heat map img

K562
Bernstein
NR2F2
ENCSR000BRS
r=0.18

small heat map img

K562
Bernstein
IRF1
ENCSR000EGK
r=0.18

small heat map img

K562
Bernstein
SIN3A
ENCSR000BLR
r=0.17

small heat map img

K562
Bernstein
KAT2B
ENCSR000ATZ
r=0.17

small heat map img

K562
Bernstein
GATA2
ENCSR000EWG
r=0.17

small heat map img

K562
Bernstein
CBX3
ENCSR000ATV
r=0.17

small heat map img

K562
Bernstein
POLR2A
ENCSR000FAJ
r=0.17

small heat map img

K562
Bernstein
CREBBP
ENCSR000ATT
r=0.17

small heat map img

K562
Bernstein
XRCC4
ENCSR000FAC
r=0.16

small heat map img

K562
Bernstein
SUZ12
ENCSR000AUC
r=0.16

small heat map img

K562
Bernstein
TAF1
ENCSR000BKS
r=0.16

small heat map img

K562
Bernstein
SETDB1
ENCSR000EWI
r=0.16

small heat map img

K562
Bernstein
MYC
ENCSR000FAZ
r=0.16

small heat map img

K562
Bernstein
RNF2
ENCSR000AUA
r=0.16

small heat map img

K562
Bernstein
MYC
ENCSR000EZU
r=0.16

small heat map img

K562
Bernstein
BDP1
ENCSR000DOK
r=0.16

small heat map img

K562
Bernstein
IRF1
ENCSR000EGL
r=0.16

small heat map img

K562
Bernstein
SIRT6
ENCSR000DOH
r=0.15

small heat map img

K562
Bernstein
STAT5A
ENCSR000BRR
r=0.15

small heat map img

K562
Bernstein
CHD4
ENCSR000ATL
r=0.15

small heat map img

K562
Bernstein
MYC
ENCSR000EGJ
r=0.15

small heat map img

K562
Bernstein
RAD21
ENCSR000FAD
r=0.15

small heat map img

K562
Bernstein
MYC
ENCSR000EZV
r=0.14

small heat map img

K562
Bernstein
REST
ENCSR000BMW
r=0.14

small heat map img

K562
Bernstein
STAT1
ENCSR000EHJ
r=0.14

small heat map img

K562
Bernstein
CCNT2
ENCSR000DOA
r=0.14

small heat map img

K562
Bernstein
ETS1
ENCSR000BKQ
r=0.14

small heat map img

K562
Bernstein
HMGN3
ENCSR000DOB
r=0.14

small heat map img

K562
Bernstein
BRF1
ENCSR000DOJ
r=0.13

small heat map img

K562
Bernstein
GATA1
ENCSR000EWM
r=0.13

small heat map img

K562
Bernstein
STAT1
ENCSR000EHK
r=0.13

small heat map img

K562
Bernstein
STAT1
ENCSR000FAU
r=0.13

small heat map img

K562
Bernstein
GTF2B
ENCSR000DOE
r=0.13

small heat map img

K562
Bernstein
STAT2
ENCSR000FAT
r=0.12

small heat map img

K562
Bernstein
MEF2A
ENCSR000BNV
r=0.12

small heat map img

K562
Bernstein
KDM1A
ENCSR000ATX
r=0.12

small heat map img

K562
Bernstein
JUN
ENCSR000EFS
r=0.12

small heat map img

K562
Bernstein
STAT1
ENCSR000FAV
r=0.12

small heat map img

K562
Bernstein
REST
ENCSR000ATM
r=0.12

small heat map img

K562
Bernstein
TBP
ENCSR000EHA
r=0.12

small heat map img

K562
Bernstein
ZNF384
ENCSR000EFP
r=0.12

small heat map img

K562
Bernstein
IRF1
ENCSR000EGU
r=0.12

small heat map img

K562
Bernstein
YY1
ENCSR000EWF
r=0.12

small heat map img

K562
Bernstein
STAT2
ENCSR000FBC
r=0.11

small heat map img

K562
Bernstein
MYC
ENCSR000EGS
r=0.11

small heat map img

K562
Bernstein
MYC
ENCSR000FAG
r=0.11

small heat map img

K562
Bernstein
NR2C2
ENCSR000EWH
r=0.11

small heat map img

K562
Bernstein
CEBPB
ENCSR000BRQ
r=0.11

small heat map img

K562
Bernstein
CBX3
ENCSR000BRT
r=0.11

small heat map img

K562
Bernstein
CBX2
ENCSR000ATU
r=0.10

small heat map img

K562
Bernstein
MAX
ENCSR000BLP
r=0.10

small heat map img

K562
Bernstein
NFE2
ENCSR000FAF
r=0.10

small heat map img

K562
Bernstein
EP300
ENCSR000EGE
r=0.10

small heat map img

K562
Bernstein
JUN
ENCSR000EZT
r=0.10

small heat map img

K562
Bernstein
RFX5
ENCSR000EGO
r=0.10

small heat map img

K562
Bernstein
JUN
ENCSR000EZW
r=0.10

small heat map img

K562
Bernstein
GATA2
ENCSR000BKM
r=0.10

small heat map img

K562
Bernstein
JUN
ENCSR000EZX
r=0.10

small heat map img

K562
Bernstein
MAX
ENCSR000EFV
r=0.09

small heat map img

K562
Bernstein
JUN
ENCSR000EGH
r=0.09

small heat map img

K562
Bernstein
ZBTB33
ENCSR000BKF
r=0.09

small heat map img

K562
Bernstein
CTCF
ENCSR000AKO
r=0.09

small heat map img

K562
Bernstein
MYC
ENCSR000DLZ
r=0.09

small heat map img

K562
Bernstein
YY1
ENCSR000BKU
r=0.08

small heat map img

K562
Bernstein
RCOR1
ENCSR000EGG
r=0.08

small heat map img

K562
Bernstein
E2F6
ENCSR000EWJ
r=0.08

small heat map img

K562
Bernstein
BHLHE40
ENCSR000EGV
r=0.08

small heat map img

K562
Bernstein
POLR3G
ENCSR000EHQ
r=0.08

small heat map img

K562
Bernstein
MAX
ENCSR000FAE
r=0.07

small heat map img

K562
Bernstein
ATF3
ENCSR000DOG
r=0.07

small heat map img

K562
Bernstein
ZNF274
ENCSR000EWE
r=0.07

small heat map img

K562
Bernstein
JUND
ENCSR000EGN
r=0.07

small heat map img

K562
Bernstein
HDAC2
ENCSR000BMG
r=0.07

small heat map img

K562
Bernstein
FOSL1
ENCSR000BMV
r=0.06

small heat map img

K562
Bernstein
CEBPB
ENCSR000EHE
r=0.06

small heat map img

K562
Bernstein
CTCFL
ENCSR000BNK
r=0.06

small heat map img

K562
Bernstein
ZBTB7A
ENCSR000BME
r=0.06

small heat map img

K562
Bernstein
GTF3C2
ENCSR000DOD
r=0.06

small heat map img

K562
Bernstein
YY1
ENCSR000BMH
r=0.05

small heat map img

K562
Bernstein
THAP1
ENCSR000BNN
r=0.05

small heat map img

K562
Bernstein
CTCF
ENCSR000EGM
r=0.05

small heat map img

K562
Bernstein
CTCF
ENCSR000DWE
r=0.04

small heat map img

K562
Bernstein
E2F4
ENCSR000EWL
r=0.04

small heat map img

K562
Bernstein
CBX8
ENCSR000ATW
r=0.03

small heat map img

K562
Bernstein
JUN
ENCSR000FAH
r=0.03

small heat map img

K562
Bernstein
CREB1
ENCSR000BSO
r=0.03

small heat map img

K562
Bernstein
SETDB1
ENCSR000EWD
r=0.02

small heat map img

K562
Bernstein
SRF
ENCSR000BLK
r=0.02

small heat map img

K562
Bernstein
ATF3
ENCSR000BNU
r=0.02

small heat map img

K562
Bernstein
SIX5
ENCSR000BNW
r=0.02

small heat map img

K562
Bernstein
E2F6
ENCSR000BLI
r=0.02

small heat map img

K562
Bernstein
CTCF
ENCSR000BPJ
r=0.01

small heat map img

K562
Bernstein
POLR3A
ENCSR000DOI
r=0.01

small heat map img

K562
Bernstein
RAD21
ENCSR000BKV
r=0.01

small heat map img

K562
Bernstein
HCFC1
ENCSR000EFN
r=0.01

small heat map img

K562
Bernstein
SPI1
ENCSR000BGW
r=0.01

small heat map img

K562
Bernstein
CTCF
ENCSR000DMA
r=0.01

small heat map img

K562
Bernstein
ZNF143
ENCSR000EGP
r=0.00

small heat map img

K562
Bernstein
SP1
ENCSR000BKO
r=0.00

small heat map img

K562
Bernstein
NRF1
ENCSR000EHH
r=-0.01

small heat map img

K562
Bernstein
ATF1
ENCSR000DNZ
r=-0.01

small heat map img

K562
Bernstein
USF1
ENCSR000BKT
r=-0.01

small heat map img

K562
Bernstein
SIX5
ENCSR000BGX
r=-0.02

small heat map img

K562
Bernstein
NFYA
ENCSR000EGR
r=-0.03

small heat map img

K562
Bernstein
EGR1
ENCSR000BNE
r=-0.03

small heat map img

K562
Bernstein
ELF1
ENCSR000BMD
r=-0.03

small heat map img

K562
Bernstein
SP2
ENCSR000BNL
r=-0.04

small heat map img

K562
Bernstein
GABPA
ENCSR000BLO
r=-0.05

small heat map img

K562
Bernstein
FOS
ENCSR000FAI
r=-0.06

small heat map img

K562
Bernstein
NFYB
ENCSR000EGQ
r=-0.07

small heat map img

K562
Bernstein
IRF1
ENCSR000EGT
r=-0.08

small heat map img
9,350 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZE

loading

K562 - Bernstein - ENCSR000AQD

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help