BRF2

This gene encodes one of the multiple subunits of the RNA polymerase III transcription factor complex required for transcription of genes with promoter elements upstream of the initiation site. The product of this gene, a TFIIB-like factor, is directly recruited to the TATA-box of polymerase III small nuclear RNA gene promoters through its interaction with the TATA-binding protein. RefSeq, Jul 2008
Transcription factor IIIB 50 kDa subunit (TFIIIB50) also known as b-related factor 2 (BRF-2) is a protein that in humans is encoded by the BRF2 gene.wikipedia

BRF2


ENCODE experiments
Ensemble search
Entrez 55290
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia Transcription factor IIIB 50 kDa subunit

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

HeLa-S3 - Struhl - ENCSR000DNV

loading

K562 - Struhl - ENCSR000DOC

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

HeLa-S3 - Struhl - ENCSR000DNV

1.
27 / 500
2.3e-20
GAAAGAGAGAGAGAGAAAGAGGAAGAGAGA
small heat map img p-value: 0.57
pct_center: 0.30
pct_ratio: 0.63
2.
41 / 500
0.00081
GACAAAGACACAGAA
small heat map img p-value: 0.23
pct_center: 0.27
pct_ratio: 0.67
3.
3 / 500
0.0095
GTATATGTGCTGCCGAAGCGAGCACG
small heat map img p-value: 0.52
pct_center: 0.03
pct_ratio: 0.38
4.
5 / 500
2.6
GCTGGTCCGAGTGTAGTGGGTTAT
small heat map img p-value: 0.58
pct_center: 0.07
pct_ratio: 0.66
5.
14 / 500
3.7
TGATTTGTATGAAGAACAGATTCTTG
small heat map img p-value: 0.01
pct_center: 0.15
pct_ratio: 0.68
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Struhl - ENCSR000DOC

1.
16 / 500
3.1e-54
ATAGCTGGGATTACAGGCGTGAGCCACCA
small heat map img p-value: 1.00
pct_center: 0.11
pct_ratio: 0.44
2.
18 / 500
3.1e-50
AGACCAGCCTGGGCAACATAG
small heat map img p-value: 1.00
pct_center: 0.17
pct_ratio: 0.54
3.
15 / 500
4.7e-45
GGAGGCTGAGGCAGGAGGATC
small heat map img p-value: 1.00
pct_center: 0.16
pct_ratio: 0.49
4.
17 / 500
1.4e-37
TTTTTTTTTTTTTTGTAGAGACAGGGTTT
small heat map img p-value: 1.00
pct_center: 0.24
pct_ratio: 0.32
5.
13 / 500
4.9e-23
GGGCGGGGCCTGGGAATCTGCATTTT
small heat map img p-value: 0.15
pct_center: 0.10
pct_ratio: 0.60
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at BRF2 peaks

HeLa-S3 - Struhl - ENCSR000DNV

HeLa-S3
Struhl
BRF2
ENCSR000DNV
r=1.00

small heat map img

HeLa-S3
Struhl
H3K4me3
ENCSR000AOF
r=0.32

small heat map img

HeLa-S3
Struhl
H3K4me2
ENCSR000AOE
r=0.30

small heat map img

HeLa-S3
Struhl
H2AFZ
ENCSR000AQN
r=0.30

small heat map img

HeLa-S3
Struhl
H3K9ac
ENCSR000AOH
r=0.28

small heat map img

HeLa-S3
Struhl
H3K9me3
ENCSR000AQO
r=0.27

small heat map img

HeLa-S3
Struhl
H3K27me3
ENCSR000APB
r=0.24

small heat map img

HeLa-S3
Struhl
H3K4me3
ENCSR000DUA
r=0.24

small heat map img

HeLa-S3
Struhl
H3K27ac
ENCSR000AOC
r=0.23

small heat map img

HeLa-S3
Struhl
H3K4me1
ENCSR000APW
r=0.22

small heat map img

HeLa-S3
Struhl
H4K20me1
ENCSR000AOI
r=0.20

small heat map img

HeLa-S3
Struhl
H3K36me3
ENCSR000AOD
r=0.18

small heat map img

HeLa-S3
Struhl
H3K36me3
ENCSR000DTZ
r=0.15

small heat map img

HeLa-S3
Struhl
H3K27me3
ENCSR000DTY
r=0.15

small heat map img

HeLa-S3
Struhl
H3K79me2
ENCSR000AOG
r=0.13

small heat map img
303 peaks (download )

K562 - Struhl - ENCSR000DOC

K562
Struhl
BRF2
ENCSR000DOC
r=1.00

small heat map img

K562
Struhl
H3K9me1
ENCSR000AKW
r=0.26

small heat map img

K562
Struhl
H4K20me1
ENCSR000AKX
r=0.25

small heat map img

K562
Struhl
H3K9me3
ENCSR000APE
r=0.22

small heat map img

K562
Struhl
H3K27me3
ENCSR000AKQ
r=0.21

small heat map img

K562
Struhl
H3K9ac
ENCSR000EVZ
r=0.18

small heat map img

K562
Struhl
H3K4me3
ENCSR000AKU
r=0.18

small heat map img

K562
Struhl
H3K4me1
ENCSR000EWC
r=0.18

small heat map img

K562
Struhl
H2AFZ
ENCSR000APC
r=0.18

small heat map img

K562
Struhl
H3K4me1
ENCSR000AKS
r=0.17

small heat map img

K562
Struhl
H3K9ac
ENCSR000AKV
r=0.17

small heat map img

K562
Struhl
H3K36me3
ENCSR000DWB
r=0.16

small heat map img

K562
Struhl
H3K4me2
ENCSR000AKT
r=0.16

small heat map img

K562
Struhl
H3K27ac
ENCSR000AKP
r=0.16

small heat map img

K562
Struhl
H3K27me3
ENCSR000DWC
r=0.15

small heat map img

K562
Struhl
H3K27me3
ENCSR000EWB
r=0.15

small heat map img

K562
Struhl
H3K36me3
ENCSR000AKR
r=0.14

small heat map img

K562
Struhl
H3K4me3
ENCSR000DWD
r=0.11

small heat map img

K562
Struhl
H3K79me2
ENCSR000APD
r=0.11

small heat map img

K562
Struhl
H3K4me3
ENCSR000EWA
r=0.08

small heat map img
1,087 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at BRF2 peaks

HeLa-S3 - Struhl - ENCSR000DNV

HeLa-S3
Struhl
BRF2
ENCSR000DNV
r=1.00

small heat map img

HeLa-S3
Struhl
BDP1
ENCSR000DNX
r=0.63

small heat map img

HeLa-S3
Struhl
IRF3
ENCSR000EDF
r=0.55

small heat map img

HeLa-S3
Struhl
E2F1
ENCSR000EVJ
r=0.53

small heat map img

HeLa-S3
Struhl
ELK1
ENCSR000ECI
r=0.53

small heat map img

HeLa-S3
Struhl
BRF1
ENCSR000DNW
r=0.52

small heat map img

HeLa-S3
Struhl
ZKSCAN1
ENCSR000ECJ
r=0.51

small heat map img

HeLa-S3
Struhl
EZH2
ENCSR000ATC
r=0.51

small heat map img

HeLa-S3
Struhl
GTF3C2
ENCSR000DNY
r=0.50

small heat map img

HeLa-S3
Struhl
E2F4
ENCSR000EVL
r=0.49

small heat map img

HeLa-S3
Struhl
STAT3
ENCSR000EDC
r=0.49

small heat map img

HeLa-S3
Struhl
HCFC1
ENCSR000ECH
r=0.47

small heat map img

HeLa-S3
Struhl
ZNF143
ENCSR000ECO
r=0.47

small heat map img

HeLa-S3
Struhl
NR2C2
ENCSR000EVN
r=0.47

small heat map img

HeLa-S3
Struhl
USF2
ENCSR000ECW
r=0.45

small heat map img

HeLa-S3
Struhl
MAFK
ENCSR000ECK
r=0.45

small heat map img

HeLa-S3
Struhl
RCOR1
ENCSR000ECM
r=0.45

small heat map img

HeLa-S3
Struhl
MXI1
ENCSR000ECU
r=0.45

small heat map img

HeLa-S3
Struhl
KAT2A
ENCSR000ECR
r=0.45

small heat map img

HeLa-S3
Struhl
TCF7L2
ENCSR000EVF
r=0.45

small heat map img

HeLa-S3
Struhl
SMARCC2
ENCSR000EDL
r=0.44

small heat map img

HeLa-S3
Struhl
BRCA1
ENCSR000EDB
r=0.43

small heat map img

HeLa-S3
Struhl
PRDM1
ENCSR000ECY
r=0.43

small heat map img

HeLa-S3
Struhl
ELK4
ENCSR000EVI
r=0.43

small heat map img

HeLa-S3
Struhl
JUN
ENCSR000EDG
r=0.43

small heat map img

HeLa-S3
Struhl
ZNF274
ENCSR000EVG
r=0.41

small heat map img

HeLa-S3
Struhl
MAX
ENCSR000ECN
r=0.41

small heat map img

HeLa-S3
Struhl
E2F6
ENCSR000EVK
r=0.40

small heat map img

HeLa-S3
Struhl
SMC3
ENCSR000ECS
r=0.40

small heat map img

HeLa-S3
Struhl
MYC
ENCSR000EZD
r=0.40

small heat map img

HeLa-S3
Struhl
TCF7L2
ENCSR000EVE
r=0.39

small heat map img

HeLa-S3
Struhl
NRF1
ENCSR000EDJ
r=0.39

small heat map img

HeLa-S3
Struhl
FOS
ENCSR000EZE
r=0.39

small heat map img

HeLa-S3
Struhl
RFX5
ENCSR000ECX
r=0.38

small heat map img

HeLa-S3
Struhl
SMARCC1
ENCSR000EDM
r=0.38

small heat map img

HeLa-S3
Struhl
SUPT20H
ENCSR000ECQ
r=0.37

small heat map img

HeLa-S3
Struhl
EP300
ENCSR000ECV
r=0.37

small heat map img

HeLa-S3
Struhl
JUND
ENCSR000EDH
r=0.37

small heat map img

HeLa-S3
Struhl
CTCF
ENCSR000AOA
r=0.36

small heat map img

HeLa-S3
Struhl
STAT1
ENCSR000EZK
r=0.34

small heat map img

HeLa-S3
Struhl
TBP
ENCSR000EDD
r=0.34

small heat map img

HeLa-S3
Struhl
POLR3A
ENCSR000DNU
r=0.34

small heat map img

HeLa-S3
Struhl
MAX
ENCSR000EZF
r=0.33

small heat map img

HeLa-S3
Struhl
NFYB
ENCSR000DNR
r=0.33

small heat map img

HeLa-S3
Struhl
ZZZ3
ENCSR000DNT
r=0.33

small heat map img

HeLa-S3
Struhl
SMARCA4
ENCSR000EZC
r=0.32

small heat map img

HeLa-S3
Struhl
NFYA
ENCSR000DNS
r=0.31

small heat map img

HeLa-S3
Struhl
SMARCB1
ENCSR000EDK
r=0.30

small heat map img

HeLa-S3
Struhl
MYC
ENCSR000DLN
r=0.29

small heat map img

HeLa-S3
Struhl
RAD21
ENCSR000EDE
r=0.24

small heat map img

HeLa-S3
Struhl
CTCF
ENCSR000DUB
r=0.23

small heat map img

HeLa-S3
Struhl
POLR2A
ENCSR000BGO
r=0.23

small heat map img

HeLa-S3
Struhl
CEBPB
ENCSR000EDA
r=0.20

small heat map img

HeLa-S3
Struhl
TAF1
ENCSR000BHT
r=0.19

small heat map img

HeLa-S3
Struhl
POLR2A
ENCSR000EZL
r=0.19

small heat map img

HeLa-S3
Struhl
POLR2A
ENCSR000DLM
r=0.18

small heat map img

HeLa-S3
Struhl
GABPA
ENCSR000BHS
r=0.18

small heat map img

HeLa-S3
Struhl
REST
ENCSR000BMN
r=0.16

small heat map img

HeLa-S3
Struhl
CTCF
ENCSR000DLO
r=0.13

small heat map img
303 peaks (download )

K562 - Struhl - ENCSR000DOC

K562
Struhl
BRF2
ENCSR000DOC
r=1.00

small heat map img

K562
Struhl
BDP1
ENCSR000DOK
r=0.59

small heat map img

K562
Struhl
USF2
ENCSR000EHG
r=0.55

small heat map img

K562
Struhl
TBL1XR1
ENCSR000EGA
r=0.52

small heat map img

K562
Struhl
EP300
ENCSR000AQB
r=0.52

small heat map img

K562
Struhl
SETDB1
ENCSR000AUT
r=0.51

small heat map img

K562
Struhl
RCOR1
ENCSR000EGC
r=0.51

small heat map img

K562
Struhl
HDAC6
ENCSR000ATJ
r=0.50

small heat map img

K562
Struhl
CHD7
ENCSR000AVD
r=0.48

small heat map img

K562
Struhl
CUX1
ENCSR000EFO
r=0.48

small heat map img

K562
Struhl
SIRT6
ENCSR000DOH
r=0.47

small heat map img

K562
Struhl
STAT1
ENCSR000EHJ
r=0.47

small heat map img

K562
Struhl
GATA1
ENCSR000EWM
r=0.47

small heat map img

K562
Struhl
WHSC1
ENCSR000AVE
r=0.47

small heat map img

K562
Struhl
MAFK
ENCSR000EGX
r=0.46

small heat map img

K562
Struhl
HDAC2
ENCSR000AQG
r=0.46

small heat map img

K562
Struhl
JUN
ENCSR000EFS
r=0.46

small heat map img

K562
Struhl
GATA2
ENCSR000EWG
r=0.46

small heat map img

K562
Struhl
MYC
ENCSR000EZV
r=0.46

small heat map img

K562
Struhl
BHLHE40
ENCSR000EGV
r=0.45

small heat map img

K562
Struhl
EZH2
ENCSR000AQE
r=0.45

small heat map img

K562
Struhl
HDAC1
ENCSR000AQF
r=0.45

small heat map img

K562
Struhl
STAT2
ENCSR000FBC
r=0.45

small heat map img

K562
Struhl
STAT1
ENCSR000EHK
r=0.45

small heat map img

K562
Struhl
STAT2
ENCSR000FAT
r=0.45

small heat map img

K562
Struhl
ZNF274
ENCSR000EWE
r=0.45

small heat map img

K562
Struhl
MYC
ENCSR000FAZ
r=0.45

small heat map img

K562
Struhl
JUN
ENCSR000EZT
r=0.45

small heat map img

K562
Struhl
STAT1
ENCSR000FAU
r=0.45

small heat map img

K562
Struhl
CBX3
ENCSR000ATV
r=0.45

small heat map img

K562
Struhl
STAT1
ENCSR000FAV
r=0.44

small heat map img

K562
Struhl
BACH1
ENCSR000EGD
r=0.44

small heat map img

K562
Struhl
ATF1
ENCSR000DNZ
r=0.44

small heat map img

K562
Struhl
SMC3
ENCSR000EGW
r=0.44

small heat map img

K562
Struhl
TBL1XR1
ENCSR000EGB
r=0.44

small heat map img

K562
Struhl
ELK1
ENCSR000EFU
r=0.44

small heat map img

K562
Struhl
GATA1
ENCSR000EFT
r=0.43

small heat map img

K562
Struhl
ATF3
ENCSR000DOG
r=0.43

small heat map img

K562
Struhl
BRF1
ENCSR000DOJ
r=0.43

small heat map img

K562
Struhl
SETDB1
ENCSR000EWI
r=0.43

small heat map img

K562
Struhl
JUN
ENCSR000EZX
r=0.42

small heat map img

K562
Struhl
IRF1
ENCSR000EGT
r=0.42

small heat map img

K562
Struhl
MAFF
ENCSR000EGI
r=0.42

small heat map img

K562
Struhl
SETDB1
ENCSR000EWD
r=0.42

small heat map img

K562
Struhl
NFE2
ENCSR000FAF
r=0.42

small heat map img

K562
Struhl
RAD21
ENCSR000FAD
r=0.42

small heat map img

K562
Struhl
ZNF274
ENCSR000EVX
r=0.41

small heat map img

K562
Struhl
JUN
ENCSR000EZW
r=0.41

small heat map img

K562
Struhl
XRCC4
ENCSR000FAC
r=0.41

small heat map img

K562
Struhl
KAT2B
ENCSR000ATZ
r=0.41

small heat map img

K562
Struhl
NR2C2
ENCSR000EWH
r=0.41

small heat map img

K562
Struhl
ARID3A
ENCSR000EFY
r=0.40

small heat map img

K562
Struhl
MAX
ENCSR000FAE
r=0.40

small heat map img

K562
Struhl
MYC
ENCSR000EZU
r=0.40

small heat map img

K562
Struhl
SAP30
ENCSR000AQJ
r=0.40

small heat map img

K562
Struhl
ZNF384
ENCSR000EFP
r=0.40

small heat map img

K562
Struhl
IRF1
ENCSR000EGL
r=0.40

small heat map img

K562
Struhl
KDM1A
ENCSR000ATX
r=0.40

small heat map img

K562
Struhl
SIRT6
ENCSR000AUB
r=0.40

small heat map img

K562
Struhl
NFYA
ENCSR000EGR
r=0.39

small heat map img

K562
Struhl
FOS
ENCSR000FAI
r=0.39

small heat map img

K562
Struhl
CHD1
ENCSR000AQD
r=0.39

small heat map img

K562
Struhl
ZMIZ1
ENCSR000EFQ
r=0.39

small heat map img

K562
Struhl
CREBBP
ENCSR000ATT
r=0.39

small heat map img

K562
Struhl
IRF1
ENCSR000EGK
r=0.39

small heat map img

K562
Struhl
YY1
ENCSR000EWF
r=0.38

small heat map img

K562
Struhl
RCOR1
ENCSR000EGG
r=0.38

small heat map img

K562
Struhl
IRF1
ENCSR000EGU
r=0.38

small heat map img

K562
Struhl
MYC
ENCSR000EGJ
r=0.38

small heat map img

K562
Struhl
RBBP5
ENCSR000AQI
r=0.38

small heat map img

K562
Struhl
JUN
ENCSR000FAH
r=0.38

small heat map img

K562
Struhl
MXI1
ENCSR000EGZ
r=0.38

small heat map img

K562
Struhl
JUND
ENCSR000EGN
r=0.38

small heat map img

K562
Struhl
NRF1
ENCSR000EHH
r=0.37

small heat map img

K562
Struhl
E2F4
ENCSR000EWL
r=0.37

small heat map img

K562
Struhl
EP300
ENCSR000EGE
r=0.36

small heat map img

K562
Struhl
JUN
ENCSR000EGH
r=0.36

small heat map img

K562
Struhl
HCFC1
ENCSR000EFN
r=0.36

small heat map img

K562
Struhl
HMGN3
ENCSR000DOB
r=0.36

small heat map img

K562
Struhl
MYC
ENCSR000FAG
r=0.36

small heat map img

K562
Struhl
ZNF143
ENCSR000EGP
r=0.36

small heat map img

K562
Struhl
EP300
ENCSR000EGY
r=0.35

small heat map img

K562
Struhl
MAX
ENCSR000EFV
r=0.35

small heat map img

K562
Struhl
TRIM28
ENCSR000BRW
r=0.35

small heat map img

K562
Struhl
UBTF
ENCSR000EFW
r=0.35

small heat map img

K562
Struhl
RFX5
ENCSR000EGO
r=0.35

small heat map img

K562
Struhl
POLR2A
ENCSR000EHL
r=0.34

small heat map img

K562
Struhl
MYC
ENCSR000EGS
r=0.33

small heat map img

K562
Struhl
TRIM28
ENCSR000EVY
r=0.32

small heat map img

K562
Struhl
CCNT2
ENCSR000DOA
r=0.32

small heat map img

K562
Struhl
GTF3C2
ENCSR000DOD
r=0.32

small heat map img

K562
Struhl
GTF2B
ENCSR000DOE
r=0.32

small heat map img

K562
Struhl
CEBPD
ENCSR000BVY
r=0.32

small heat map img

K562
Struhl
CREB1
ENCSR000BSO
r=0.32

small heat map img

K562
Struhl
POLR3G
ENCSR000EHQ
r=0.31

small heat map img

K562
Struhl
SMARCB1
ENCSR000EHN
r=0.31

small heat map img

K562
Struhl
NCOR1
ENCSR000ATY
r=0.31

small heat map img

K562
Struhl
RNF2
ENCSR000AUA
r=0.31

small heat map img

K562
Struhl
CHD4
ENCSR000ATL
r=0.31

small heat map img

K562
Struhl
CTCF
ENCSR000EGM
r=0.30

small heat map img

K562
Struhl
REST
ENCSR000ATM
r=0.30

small heat map img

K562
Struhl
SMARCA4
ENCSR000EHO
r=0.30

small heat map img

K562
Struhl
CEBPB
ENCSR000EHE
r=0.29

small heat map img

K562
Struhl
NR2F2
ENCSR000BRS
r=0.29

small heat map img

K562
Struhl
STAT5A
ENCSR000BRR
r=0.29

small heat map img

K562
Struhl
SUZ12
ENCSR000AUC
r=0.29

small heat map img

K562
Struhl
TEAD4
ENCSR000BRK
r=0.28

small heat map img

K562
Struhl
ZNF263
ENCSR000EWN
r=0.28

small heat map img

K562
Struhl
TBP
ENCSR000EHA
r=0.28

small heat map img

K562
Struhl
KDM5B
ENCSR000AQA
r=0.27

small heat map img

K562
Struhl
CBX2
ENCSR000ATU
r=0.27

small heat map img

K562
Struhl
UBTF
ENCSR000EFZ
r=0.27

small heat map img

K562
Struhl
CBX3
ENCSR000BRT
r=0.27

small heat map img

K562
Struhl
E2F6
ENCSR000EWJ
r=0.26

small heat map img

K562
Struhl
MYC
ENCSR000DLZ
r=0.26

small heat map img

K562
Struhl
TAL1
ENCSR000EHB
r=0.26

small heat map img

K562
Struhl
CTCF
ENCSR000AKO
r=0.25

small heat map img

K562
Struhl
CEBPB
ENCSR000BRQ
r=0.25

small heat map img

K562
Struhl
ZBTB33
ENCSR000BKF
r=0.24

small heat map img

K562
Struhl
POLR2A
ENCSR000FAX
r=0.24

small heat map img

K562
Struhl
POLR2A
ENCSR000FAY
r=0.24

small heat map img

K562
Struhl
CBX8
ENCSR000ATW
r=0.24

small heat map img

K562
Struhl
GATA2
ENCSR000BKM
r=0.24

small heat map img

K562
Struhl
CTCF
ENCSR000DWE
r=0.23

small heat map img

K562
Struhl
PML
ENCSR000BQY
r=0.23

small heat map img

K562
Struhl
POLR2A
ENCSR000FAJ
r=0.23

small heat map img

K562
Struhl
ATF3
ENCSR000BNU
r=0.23

small heat map img

K562
Struhl
POLR3A
ENCSR000DOI
r=0.23

small heat map img

K562
Struhl
POLR2A
ENCSR000EHP
r=0.23

small heat map img

K562
Struhl
SIN3A
ENCSR000BLR
r=0.22

small heat map img

K562
Struhl
POLR2A
ENCSR000FAW
r=0.22

small heat map img

K562
Struhl
TAF7
ENCSR000BNM
r=0.22

small heat map img

K562
Struhl
REST
ENCSR000BMW
r=0.21

small heat map img

K562
Struhl
NFYB
ENCSR000EGQ
r=0.21

small heat map img

K562
Struhl
ETS1
ENCSR000BKQ
r=0.20

small heat map img

K562
Struhl
PHF8
ENCSR000AQH
r=0.20

small heat map img

K562
Struhl
MEF2A
ENCSR000BNV
r=0.20

small heat map img

K562
Struhl
MAX
ENCSR000BLP
r=0.20

small heat map img

K562
Struhl
EGR1
ENCSR000BNE
r=0.20

small heat map img

K562
Struhl
POLR2A
ENCSR000BMR
r=0.20

small heat map img

K562
Struhl
USF1
ENCSR000BKT
r=0.19

small heat map img

K562
Struhl
FOSL1
ENCSR000BMV
r=0.19

small heat map img

K562
Struhl
SRF
ENCSR000BLK
r=0.19

small heat map img

K562
Struhl
POLR2A
ENCSR000DLY
r=0.19

small heat map img

K562
Struhl
CTCF
ENCSR000BPJ
r=0.17

small heat map img

K562
Struhl
SP1
ENCSR000BKO
r=0.17

small heat map img

K562
Struhl
HDAC2
ENCSR000BMG
r=0.17

small heat map img

K562
Struhl
SIX5
ENCSR000BNW
r=0.16

small heat map img

K562
Struhl
SIX5
ENCSR000BGX
r=0.16

small heat map img

K562
Struhl
TAF1
ENCSR000BKS
r=0.15

small heat map img

K562
Struhl
CTCFL
ENCSR000BNK
r=0.14

small heat map img

K562
Struhl
SPI1
ENCSR000BGW
r=0.14

small heat map img

K562
Struhl
GABPA
ENCSR000BLO
r=0.14

small heat map img

K562
Struhl
ZBTB7A
ENCSR000BME
r=0.13

small heat map img

K562
Struhl
CTCF
ENCSR000DMA
r=0.13

small heat map img

K562
Struhl
YY1
ENCSR000BKU
r=0.12

small heat map img

K562
Struhl
THAP1
ENCSR000BNN
r=0.11

small heat map img

K562
Struhl
YY1
ENCSR000BMH
r=0.11

small heat map img

K562
Struhl
SP2
ENCSR000BNL
r=0.10

small heat map img

K562
Struhl
E2F6
ENCSR000BLI
r=0.09

small heat map img

K562
Struhl
ELF1
ENCSR000BMD
r=0.09

small heat map img

K562
Struhl
RAD21
ENCSR000BKV
r=0.08

small heat map img
1,087 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

K562 - Struhl - ENCSR000DOC

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help