BRCA1

This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. RefSeq, May 2009
BRCA1 and BRCA1 (/brkwn/) are a human gene and its protein product, respectively. The official symbol (BRCA1, italic for the gene, nonitalic for the protein) and the official name (breast cancer 1) are maintained by the HGNC. Orthologs, styled Brca1 and Brca1, are common in other mammal species.wikipedia

BRCA1

PDB image
PDB 1JM7

PDB 1JM7 1JNX 1N5O 1OQA 1T15 1T29 1T2U 1T2V 1Y98 2ING 3COJ 3K0H 3K0K 3K15 3K16 3PXA 3PXB 3PXC 3PXD 3PXE 4IFI 4IGK 4JLU 4OFB 4U4A
ENCODE experiments
Ensemble search
Entrez 672
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia BRCA1

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZS

loading

H1-hESC - Snyder - ENCSR000EBX

loading

HeLa-S3 - Snyder - ENCSR000EDB

loading

HepG2 - Snyder - ENCSR000EDY

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZS

1.
483 / 500
1.0e-1012
CCAAGTCTCGCGAGAGCTG
small heat map img p-value: 0.00
pct_center: 0.94
pct_ratio: 2.69
2.
25 / 500
7.4e-56
GGGCCTTCTGGGAATTGTAGT
small heat map img p-value: 0.00
pct_center: 0.19
pct_ratio: 0.88
3.
60 / 500
2.7e-26
AAATCTCGCGAGA
small heat map img p-value: 0.00
pct_center: 0.84
pct_ratio: 6.61
4.
103 / 500
2.0e-17
GGGGAGGGGCGGGGC
small heat map img p-value: 0.00
pct_center: 0.72
pct_ratio: 0.59
5.
21 / 500
0.000028
GTGACGTCACAAG
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 1.17
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

H1-hESC - Snyder - ENCSR000EBX

1.
450 / 500
1.1e-865
AATCTCGCGAGAGCCGGG
small heat map img p-value: 0.00
pct_center: 0.41
pct_ratio: 1.85
2.
22 / 500
2.6e-50
GCCTTCTGGGAATTGTAGTTC
small heat map img p-value: 0.00
pct_center: 0.12
pct_ratio: 0.68
3.
92 / 500
1.2e-17
GGGGGCGGGGCGGGGGAGGGG
small heat map img p-value: 0.00
pct_center: 0.65
pct_ratio: 0.58
4.
18 / 500
1.2e-15
TTGTTTATAACTAGTTAGTAGTTAGTAGTT
small heat map img p-value: 0.35
pct_center: 0.04
pct_ratio: 0.25
5.
50 / 500
1.4e-13
GAGATCTCGCGAGA
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 1.66
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HeLa-S3 - Snyder - ENCSR000EDB

1.
400 / 500
6.7e-817
CAAATCTCGCGAGAG
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 1.23
2.
87 / 500
1.1e-127
GATGACGTCAC
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 2.63
3.
28 / 500
1.7e-62
GCCTTCTGGGAATTGTAGTTT
small heat map img p-value: 0.00
pct_center: 0.10
pct_ratio: 0.77
4.
124 / 500
2.1e-24
GGGGGCGGGGC
small heat map img p-value: 0.00
pct_center: 0.44
pct_ratio: 0.64
5.
21 / 500
9.4e-13
ACGGCGCGCTCTGATGACGTA
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 1.38
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Snyder - ENCSR000EDY

1.
438 / 500
2.9e-896
AAGTCTCGCGAGAACTG
small heat map img p-value: 0.00
pct_center: 0.36
pct_ratio: 1.57
2.
49 / 500
4.5e-62
CGTGACGTCACCGGGGGGCGC
small heat map img p-value: 0.00
pct_center: 0.30
pct_ratio: 1.41
3.
26 / 500
1.2e-57
GCATGCTGGGAATTGTAGTTC
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.75
4.
108 / 500
4.3e-14
AGGGGGGGGGAGGGAGGAGGG
small heat map img p-value: 0.00
pct_center: 0.60
pct_ratio: 0.50
5.
47 / 500
3.1e-16
TCTCGCGAGATTTG
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 2.16
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at BRCA1 peaks

GM12878 - Snyder - ENCSR000DZS

GM12878
Snyder
BRCA1
ENCSR000DZS
r=1.00

small heat map img

GM12878
Snyder
H2AFZ
ENCSR000AOV
r=0.64

small heat map img

GM12878
Snyder
H3K9ac
ENCSR000AKH
r=0.58

small heat map img

GM12878
Snyder
H3K27ac
ENCSR000AKC
r=0.57

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000DRY
r=0.51

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000AKA
r=0.43

small heat map img

GM12878
Snyder
H3K4me2
ENCSR000AKG
r=0.28

small heat map img

GM12878
Snyder
H3K79me2
ENCSR000AOW
r=0.17

small heat map img

GM12878
Snyder
H3K9me3
ENCSR000AOX
r=0.05

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000DRX
r=-0.05

small heat map img

GM12878
Snyder
H3K4me1
ENCSR000AKF
r=-0.06

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000AKD
r=-0.06

small heat map img

GM12878
Snyder
H4K20me1
ENCSR000AKI
r=-0.08

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000DRW
r=-0.10

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000AKE
r=-0.24

small heat map img
551 peaks (download )

H1-hESC - Snyder - ENCSR000EBX

H1-hESC
Snyder
BRCA1
ENCSR000EBX
r=1.00

small heat map img

H1-hESC
Snyder
H3K9ac
ENCSR000AND
r=0.51

small heat map img

H1-hESC
Snyder
H3K4me3
ENCSR000AMG
r=0.49

small heat map img

H1-hESC
Snyder
H3K27ac
ENCSR000ANP
r=0.47

small heat map img

H1-hESC
Snyder
H3K4me2
ENCSR000ANC
r=0.42

small heat map img

H1-hESC
Snyder
H2AFZ
ENCSR000APX
r=0.40

small heat map img

H1-hESC
Snyder
H3K4me1
ENCSR000ANA
r=0.11

small heat map img

H1-hESC
Snyder
H3K79me2
ENCSR000APY
r=0.03

small heat map img

H1-hESC
Snyder
H4K20me1
ENCSR000AMH
r=0.00

small heat map img

H1-hESC
Snyder
H3K9me3
ENCSR000APZ
r=0.00

small heat map img

H1-hESC
Snyder
H3K27me3
ENCSR000ALU
r=-0.01

small heat map img

H1-hESC
Snyder
H3K36me3
ENCSR000ANB
r=-0.09

small heat map img
2,025 peaks (download )

HeLa-S3 - Snyder - ENCSR000EDB

HeLa-S3
Snyder
BRCA1
ENCSR000EDB
r=1.00

small heat map img

HeLa-S3
Snyder
H3K9ac
ENCSR000AOH
r=0.43

small heat map img

HeLa-S3
Snyder
H3K27ac
ENCSR000AOC
r=0.42

small heat map img

HeLa-S3
Snyder
H3K4me3
ENCSR000AOF
r=0.42

small heat map img

HeLa-S3
Snyder
H2AFZ
ENCSR000AQN
r=0.40

small heat map img

HeLa-S3
Snyder
H3K4me3
ENCSR000DUA
r=0.39

small heat map img

HeLa-S3
Snyder
H3K4me2
ENCSR000AOE
r=0.34

small heat map img

HeLa-S3
Snyder
H3K4me1
ENCSR000APW
r=0.14

small heat map img

HeLa-S3
Snyder
H3K79me2
ENCSR000AOG
r=0.07

small heat map img

HeLa-S3
Snyder
H3K27me3
ENCSR000DTY
r=0.05

small heat map img

HeLa-S3
Snyder
H3K9me3
ENCSR000AQO
r=-0.03

small heat map img

HeLa-S3
Snyder
H4K20me1
ENCSR000AOI
r=-0.03

small heat map img

HeLa-S3
Snyder
H3K36me3
ENCSR000DTZ
r=-0.04

small heat map img

HeLa-S3
Snyder
H3K27me3
ENCSR000APB
r=-0.05

small heat map img

HeLa-S3
Snyder
H3K36me3
ENCSR000AOD
r=-0.12

small heat map img
8,114 peaks (download )

HepG2 - Snyder - ENCSR000EDY

HepG2
Snyder
BRCA1
ENCSR000EDY
r=1.00

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000AMP
r=0.51

small heat map img

HepG2
Snyder
H3K9ac
ENCSR000AMD
r=0.50

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000DUF
r=0.49

small heat map img

HepG2
Snyder
H3K27ac
ENCSR000AMO
r=0.44

small heat map img

HepG2
Snyder
H2AFZ
ENCSR000AOK
r=0.41

small heat map img

HepG2
Snyder
H3K4me2
ENCSR000AMC
r=0.34

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000AOL
r=0.32

small heat map img

HepG2
Snyder
H3K79me2
ENCSR000AOM
r=0.12

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000DUE
r=0.05

small heat map img

HepG2
Snyder
H3K9me3
ENCSR000ATD
r=0.01

small heat map img

HepG2
Snyder
H4K20me1
ENCSR000AMQ
r=0.01

small heat map img

HepG2
Snyder
H3K4me1
ENCSR000APV
r=-0.04

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000DUD
r=-0.06

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000AMB
r=-0.11

small heat map img
1,497 peaks (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at BRCA1 peaks

GM12878 - Snyder - ENCSR000DZS

GM12878
Snyder
BRCA1
ENCSR000DZS
r=1.00

small heat map img

GM12878
Snyder
RCOR1
ENCSR000DZC
r=0.91

small heat map img

GM12878
Snyder
ZBTB33
ENCSR000BHC
r=0.88

small heat map img

GM12878
Snyder
MXI1
ENCSR000DZI
r=0.58

small heat map img

GM12878
Snyder
TBL1XR1
ENCSR000DYZ
r=0.58

small heat map img

GM12878
Snyder
STAT1
ENCSR000DZM
r=0.55

small heat map img

GM12878
Snyder
ELF1
ENCSR000BMB
r=0.51

small heat map img

GM12878
Snyder
POLR2A
ENCSR000DKT
r=0.51

small heat map img

GM12878
Snyder
MAX
ENCSR000DZF
r=0.51

small heat map img

GM12878
Snyder
ELK1
ENCSR000DZB
r=0.50

small heat map img

GM12878
Snyder
ESRRA
ENCSR000DYQ
r=0.48

small heat map img

GM12878
Snyder
ATF2
ENCSR000BQK
r=0.48

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EAD
r=0.47

small heat map img

GM12878
Snyder
TBP
ENCSR000DZZ
r=0.47

small heat map img

GM12878
Snyder
EP300
ENCSR000DZG
r=0.46

small heat map img

GM12878
Snyder
EP300
ENCSR000DZD
r=0.45

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EYW
r=0.45

small heat map img

GM12878
Snyder
PML
ENCSR000BQM
r=0.45

small heat map img

GM12878
Snyder
SIN3A
ENCSR000DYX
r=0.44

small heat map img

GM12878
Snyder
RELA
ENCSR000EAG
r=0.44

small heat map img

GM12878
Snyder
RUNX3
ENCSR000BRI
r=0.43

small heat map img

GM12878
Snyder
E2F4
ENCSR000DYY
r=0.42

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHD
r=0.42

small heat map img

GM12878
Snyder
SREBF1
ENCSR000DYU
r=0.41

small heat map img

GM12878
Snyder
POLR2A
ENCSR000BGD
r=0.41

small heat map img

GM12878
Snyder
YY1
ENCSR000BNP
r=0.40

small heat map img

GM12878
Snyder
JUND
ENCSR000DYS
r=0.40

small heat map img

GM12878
Snyder
BHLHE40
ENCSR000DZJ
r=0.40

small heat map img

GM12878
Snyder
MAFK
ENCSR000DYV
r=0.38

small heat map img

GM12878
Snyder
RFX5
ENCSR000DZW
r=0.38

small heat map img

GM12878
Snyder
TAF1
ENCSR000BGS
r=0.38

small heat map img

GM12878
Snyder
STAT3
ENCSR000DZV
r=0.37

small heat map img

GM12878
Snyder
CREB1
ENCSR000BUF
r=0.37

small heat map img

GM12878
Snyder
TCF12
ENCSR000BGZ
r=0.36

small heat map img

GM12878
Snyder
ETS1
ENCSR000BKA
r=0.36

small heat map img

GM12878
Snyder
NRF1
ENCSR000DZO
r=0.36

small heat map img

GM12878
Snyder
CUX1
ENCSR000DYR
r=0.35

small heat map img

GM12878
Snyder
SREBF2
ENCSR000DYT
r=0.35

small heat map img

GM12878
Snyder
POU2F2
ENCSR000BGP
r=0.34

small heat map img

GM12878
Snyder
FOXM1
ENCSR000BRU
r=0.34

small heat map img

GM12878
Snyder
SIX5
ENCSR000BJE
r=0.34

small heat map img

GM12878
Snyder
SP1
ENCSR000BHK
r=0.33

small heat map img

GM12878
Snyder
EBF1
ENCSR000DZQ
r=0.33

small heat map img

GM12878
Snyder
KAT2A
ENCSR000DNO
r=0.33

small heat map img

GM12878
Snyder
IRF3
ENCSR000DZX
r=0.32

small heat map img

GM12878
Snyder
MYC
ENCSR000DKU
r=0.32

small heat map img

GM12878
Snyder
SMC3
ENCSR000DZP
r=0.30

small heat map img

GM12878
Snyder
NFIC
ENCSR000BRN
r=0.29

small heat map img

GM12878
Snyder
WRNIP1
ENCSR000EAA
r=0.29

small heat map img

GM12878
Snyder
ZNF143
ENCSR000DZL
r=0.29

small heat map img

GM12878
Snyder
BCL3
ENCSR000BNQ
r=0.29

small heat map img

GM12878
Snyder
GABPA
ENCSR000BGC
r=0.29

small heat map img

GM12878
Snyder
CTCF
ENCSR000DZN
r=0.28

small heat map img

GM12878
Snyder
FOS
ENCSR000EYZ
r=0.28

small heat map img

GM12878
Snyder
ZNF384
ENCSR000DYP
r=0.27

small heat map img

GM12878
Snyder
TCF3
ENCSR000BQT
r=0.27

small heat map img

GM12878
Snyder
SRF
ENCSR000BMI
r=0.26

small heat map img

GM12878
Snyder
EGR1
ENCSR000BMQ
r=0.25

small heat map img

GM12878
Snyder
USF2
ENCSR000DZU
r=0.25

small heat map img

GM12878
Snyder
MEF2A
ENCSR000BKB
r=0.25

small heat map img

GM12878
Snyder
CEBPB
ENCSR000BRX
r=0.24

small heat map img

GM12878
Snyder
RAD21
ENCSR000EAC
r=0.23

small heat map img

GM12878
Snyder
NFATC1
ENCSR000BQL
r=0.23

small heat map img

GM12878
Snyder
NFE2
ENCSR000DZY
r=0.22

small heat map img

GM12878
Snyder
NFYA
ENCSR000DNN
r=0.22

small heat map img

GM12878
Snyder
NFYB
ENCSR000DNM
r=0.22

small heat map img

GM12878
Snyder
CHD1
ENCSR000DZE
r=0.21

small heat map img

GM12878
Snyder
EGR1
ENCSR000BRG
r=0.21

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHJ
r=0.20

small heat map img

GM12878
Snyder
SUPT20H
ENCSR000DNP
r=0.19

small heat map img

GM12878
Snyder
RXRA
ENCSR000BJD
r=0.18

small heat map img

GM12878
Snyder
IRF4
ENCSR000BGY
r=0.17

small heat map img

GM12878
Snyder
SRF
ENCSR000BGE
r=0.17

small heat map img

GM12878
Snyder
STAT5A
ENCSR000BQZ
r=0.16

small heat map img

GM12878
Snyder
POLR3G
ENCSR000EYU
r=0.16

small heat map img

GM12878
Snyder
CTCF
ENCSR000DKV
r=0.15

small heat map img

GM12878
Snyder
USF1
ENCSR000BGI
r=0.15

small heat map img

GM12878
Snyder
PBX3
ENCSR000BGR
r=0.14

small heat map img

GM12878
Snyder
ZEB1
ENCSR000BND
r=0.14

small heat map img

GM12878
Snyder
EBF1
ENCSR000BGU
r=0.13

small heat map img

GM12878
Snyder
SPI1
ENCSR000BGQ
r=0.13

small heat map img

GM12878
Snyder
CTCF
ENCSR000AKB
r=0.12

small heat map img

GM12878
Snyder
REST
ENCSR000BGF
r=0.12

small heat map img

GM12878
Snyder
EP300
ENCSR000BHB
r=0.12

small heat map img

GM12878
Snyder
YY1
ENCSR000EUM
r=0.12

small heat map img

GM12878
Snyder
ATF3
ENCSR000BJY
r=0.11

small heat map img

GM12878
Snyder
MEF2C
ENCSR000BNG
r=0.11

small heat map img

GM12878
Snyder
CTCF
ENCSR000DRZ
r=0.11

small heat map img

GM12878
Snyder
REST
ENCSR000BQS
r=0.10

small heat map img

GM12878
Snyder
MTA3
ENCSR000BRH
r=0.10

small heat map img

GM12878
Snyder
IKZF1
ENCSR000EUJ
r=0.09

small heat map img

GM12878
Snyder
NR2C2
ENCSR000EUL
r=0.09

small heat map img

GM12878
Snyder
JUND
ENCSR000EYV
r=0.09

small heat map img

GM12878
Snyder
BCL11A
ENCSR000BHA
r=0.09

small heat map img

GM12878
Snyder
RAD21
ENCSR000BMY
r=0.07

small heat map img

GM12878
Snyder
ZZZ3
ENCSR000DNQ
r=0.03

small heat map img

GM12878
Snyder
BATF
ENCSR000BGT
r=0.03

small heat map img

GM12878
Snyder
EZH2
ENCSR000ARD
r=-0.02

small heat map img

GM12878
Snyder
ZNF274
ENCSR000EUK
r=-0.19

small heat map img
551 peaks (download )

H1-hESC - Snyder - ENCSR000EBX

H1-hESC
Snyder
BRCA1
ENCSR000EBX
r=1.00

small heat map img

H1-hESC
Snyder
MXI1
ENCSR000EBR
r=0.61

small heat map img

H1-hESC
Snyder
BACH1
ENCSR000EBQ
r=0.45

small heat map img

H1-hESC
Snyder
TAF1
ENCSR000BHO
r=0.44

small heat map img

H1-hESC
Snyder
MYC
ENCSR000EBY
r=0.43

small heat map img

H1-hESC
Snyder
TBP
ENCSR000ECB
r=0.43

small heat map img

H1-hESC
Snyder
POLR2A
ENCSR000DLJ
r=0.43

small heat map img

H1-hESC
Snyder
JUND
ENCSR000EBZ
r=0.42

small heat map img

H1-hESC
Snyder
SIN3A
ENCSR000EBO
r=0.40

small heat map img

H1-hESC
Snyder
KDM4A
ENCSR000AVC
r=0.37

small heat map img

H1-hESC
Snyder
ATF2
ENCSR000BQU
r=0.36

small heat map img

H1-hESC
Snyder
MAX
ENCSR000EUP
r=0.35

small heat map img

H1-hESC
Snyder
CEBPB
ENCSR000EBV
r=0.35

small heat map img

H1-hESC
Snyder
MAX
ENCSR000BSJ
r=0.35

small heat map img

H1-hESC
Snyder
JUN
ENCSR000ECA
r=0.35

small heat map img

H1-hESC
Snyder
POLR2A
ENCSR000BHN
r=0.34

small heat map img

H1-hESC
Snyder
NRF1
ENCSR000ECC
r=0.33

small heat map img

H1-hESC
Snyder
YY1
ENCSR000BKD
r=0.32

small heat map img

H1-hESC
Snyder
CTBP2
ENCSR000EUO
r=0.32

small heat map img

H1-hESC
Snyder
TEAD4
ENCSR000BRY
r=0.32

small heat map img

H1-hESC
Snyder
ZNF143
ENCSR000EBW
r=0.31

small heat map img

H1-hESC
Snyder
RBBP5
ENCSR000AQC
r=0.31

small heat map img

H1-hESC
Snyder
EP300
ENCSR000AUQ
r=0.31

small heat map img

H1-hESC
Snyder
MAFK
ENCSR000EBS
r=0.30

small heat map img

H1-hESC
Snyder
E2F6
ENCSR000BSI
r=0.30

small heat map img

H1-hESC
Snyder
CHD7
ENCSR000AVA
r=0.29

small heat map img

H1-hESC
Snyder
SP1
ENCSR000BIR
r=0.28

small heat map img

H1-hESC
Snyder
SIRT6
ENCSR000AUS
r=0.27

small heat map img

H1-hESC
Snyder
KDM5A
ENCSR000AQL
r=0.27

small heat map img

H1-hESC
Snyder
PHF8
ENCSR000ATK
r=0.27

small heat map img

H1-hESC
Snyder
CREB1
ENCSR000BSN
r=0.27

small heat map img

H1-hESC
Snyder
USF2
ENCSR000ECD
r=0.26

small heat map img

H1-hESC
Snyder
HDAC2
ENCSR000AVB
r=0.26

small heat map img

H1-hESC
Snyder
HDAC6
ENCSR000ATQ
r=0.25

small heat map img

H1-hESC
Snyder
GABPA
ENCSR000BIW
r=0.25

small heat map img

H1-hESC
Snyder
SUZ12
ENCSR000ATS
r=0.24

small heat map img

H1-hESC
Snyder
SIX5
ENCSR000BIQ
r=0.24

small heat map img

H1-hESC
Snyder
SP4
ENCSR000BQV
r=0.23

small heat map img

H1-hESC
Snyder
SIN3A
ENCSR000BIS
r=0.23

small heat map img

H1-hESC
Snyder
TAF7
ENCSR000BLU
r=0.22

small heat map img

H1-hESC
Snyder
CHD1
ENCSR000EBU
r=0.20

small heat map img

H1-hESC
Snyder
RFX5
ENCSR000ECF
r=0.20

small heat map img

H1-hESC
Snyder
SRF
ENCSR000BIV
r=0.19

small heat map img

H1-hESC
Snyder
JUND
ENCSR000BKP
r=0.19

small heat map img

H1-hESC
Snyder
RAD21
ENCSR000ECE
r=0.17

small heat map img

H1-hESC
Snyder
EGR1
ENCSR000BJA
r=0.16

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000AMF
r=0.16

small heat map img

H1-hESC
Snyder
ATF3
ENCSR000BKC
r=0.16

small heat map img

H1-hESC
Snyder
USF1
ENCSR000BIU
r=0.16

small heat map img

H1-hESC
Snyder
EP300
ENCSR000BKK
r=0.15

small heat map img

H1-hESC
Snyder
SAP30
ENCSR000ATR
r=0.15

small heat map img

H1-hESC
Snyder
SP2
ENCSR000BQG
r=0.14

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000DLK
r=0.14

small heat map img

H1-hESC
Snyder
CTCF
ENCSR000BNH
r=0.12

small heat map img

H1-hESC
Snyder
RAD21
ENCSR000BLD
r=0.12

small heat map img

H1-hESC
Snyder
TCF12
ENCSR000BIT
r=0.12

small heat map img

H1-hESC
Snyder
FOSL1
ENCSR000BNS
r=0.12

small heat map img

H1-hESC
Snyder
HDAC2
ENCSR000BNR
r=0.11

small heat map img

H1-hESC
Snyder
MYC
ENCSR000DLI
r=0.11

small heat map img

H1-hESC
Snyder
KDM5B
ENCSR000AUR
r=0.10

small heat map img

H1-hESC
Snyder
REST
ENCSR000BHM
r=0.08

small heat map img

H1-hESC
Snyder
BCL11A
ENCSR000BMJ
r=0.08

small heat map img

H1-hESC
Snyder
NANOG
ENCSR000BMT
r=0.08

small heat map img

H1-hESC
Snyder
EZH2
ENCSR000ASY
r=0.08

small heat map img

H1-hESC
Snyder
BCL11A
ENCSR000BIP
r=0.07

small heat map img

H1-hESC
Snyder
SUZ12
ENCSR000EUQ
r=0.07

small heat map img

H1-hESC
Snyder
RXRA
ENCSR000BJW
r=0.07

small heat map img

H1-hESC
Snyder
CHD1
ENCSR000AQK
r=0.04

small heat map img

H1-hESC
Snyder
ZNF274
ENCSR000EUN
r=0.02

small heat map img
2,025 peaks (download )

HeLa-S3 - Snyder - ENCSR000EDB

HeLa-S3
Snyder
BRCA1
ENCSR000EDB
r=1.00

small heat map img

HeLa-S3
Snyder
RCOR1
ENCSR000ECM
r=0.67

small heat map img

HeLa-S3
Snyder
ELK1
ENCSR000ECI
r=0.61

small heat map img

HeLa-S3
Snyder
HCFC1
ENCSR000ECH
r=0.61

small heat map img

HeLa-S3
Snyder
MAX
ENCSR000ECN
r=0.60

small heat map img

HeLa-S3
Snyder
MXI1
ENCSR000ECU
r=0.60

small heat map img

HeLa-S3
Snyder
MAFK
ENCSR000ECK
r=0.58

small heat map img

HeLa-S3
Snyder
MYC
ENCSR000EZD
r=0.57

small heat map img

HeLa-S3
Snyder
ZKSCAN1
ENCSR000ECJ
r=0.57

small heat map img

HeLa-S3
Snyder
MAX
ENCSR000EZF
r=0.56

small heat map img

HeLa-S3
Snyder
JUND
ENCSR000EDH
r=0.49

small heat map img

HeLa-S3
Snyder
MYC
ENCSR000DLN
r=0.48

small heat map img

HeLa-S3
Snyder
STAT1
ENCSR000EZK
r=0.46

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000DLM
r=0.46

small heat map img

HeLa-S3
Snyder
ELK4
ENCSR000EVI
r=0.46

small heat map img

HeLa-S3
Snyder
SMC3
ENCSR000ECS
r=0.45

small heat map img

HeLa-S3
Snyder
STAT3
ENCSR000EDC
r=0.45

small heat map img

HeLa-S3
Snyder
JUN
ENCSR000EDG
r=0.45

small heat map img

HeLa-S3
Snyder
FOS
ENCSR000EZE
r=0.45

small heat map img

HeLa-S3
Snyder
E2F4
ENCSR000EVL
r=0.44

small heat map img

HeLa-S3
Snyder
TCF7L2
ENCSR000EVE
r=0.43

small heat map img

HeLa-S3
Snyder
ZNF143
ENCSR000ECO
r=0.42

small heat map img

HeLa-S3
Snyder
RFX5
ENCSR000ECX
r=0.42

small heat map img

HeLa-S3
Snyder
IRF3
ENCSR000EDF
r=0.42

small heat map img

HeLa-S3
Snyder
CEBPB
ENCSR000EDA
r=0.41

small heat map img

HeLa-S3
Snyder
KAT2A
ENCSR000ECR
r=0.40

small heat map img

HeLa-S3
Snyder
PRDM1
ENCSR000ECY
r=0.40

small heat map img

HeLa-S3
Snyder
TBP
ENCSR000EDD
r=0.40

small heat map img

HeLa-S3
Snyder
NFYA
ENCSR000DNS
r=0.38

small heat map img

HeLa-S3
Snyder
USF2
ENCSR000ECW
r=0.38

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000BGO
r=0.38

small heat map img

HeLa-S3
Snyder
EP300
ENCSR000ECV
r=0.38

small heat map img

HeLa-S3
Snyder
NRF1
ENCSR000EDJ
r=0.37

small heat map img

HeLa-S3
Snyder
POLR2A
ENCSR000EZL
r=0.37

small heat map img

HeLa-S3
Snyder
E2F1
ENCSR000EVJ
r=0.36

small heat map img

HeLa-S3
Snyder
RAD21
ENCSR000EDE
r=0.35

small heat map img

HeLa-S3
Snyder
E2F6
ENCSR000EVK
r=0.35

small heat map img

HeLa-S3
Snyder
SMARCC2
ENCSR000EDL
r=0.35

small heat map img

HeLa-S3
Snyder
SMARCC1
ENCSR000EDM
r=0.35

small heat map img

HeLa-S3
Snyder
SUPT20H
ENCSR000ECQ
r=0.33

small heat map img

HeLa-S3
Snyder
TCF7L2
ENCSR000EVF
r=0.33

small heat map img

HeLa-S3
Snyder
NFYB
ENCSR000DNR
r=0.32

small heat map img

HeLa-S3
Snyder
SMARCB1
ENCSR000EDK
r=0.30

small heat map img

HeLa-S3
Snyder
TAF1
ENCSR000BHT
r=0.28

small heat map img

HeLa-S3
Snyder
NR2C2
ENCSR000EVN
r=0.27

small heat map img

HeLa-S3
Snyder
GABPA
ENCSR000BHS
r=0.26

small heat map img

HeLa-S3
Snyder
SMARCA4
ENCSR000EZC
r=0.25

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000DLO
r=0.18

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000DUB
r=0.16

small heat map img

HeLa-S3
Snyder
CTCF
ENCSR000AOA
r=0.15

small heat map img

HeLa-S3
Snyder
ZNF274
ENCSR000EVG
r=0.13

small heat map img

HeLa-S3
Snyder
BDP1
ENCSR000DNX
r=0.12

small heat map img

HeLa-S3
Snyder
GTF3C2
ENCSR000DNY
r=0.12

small heat map img

HeLa-S3
Snyder
POLR3A
ENCSR000DNU
r=0.12

small heat map img

HeLa-S3
Snyder
EZH2
ENCSR000ATC
r=0.12

small heat map img

HeLa-S3
Snyder
ZZZ3
ENCSR000DNT
r=0.10

small heat map img

HeLa-S3
Snyder
BRF2
ENCSR000DNV
r=0.09

small heat map img

HeLa-S3
Snyder
REST
ENCSR000BMN
r=0.08

small heat map img

HeLa-S3
Snyder
BRF1
ENCSR000DNW
r=-0.00

small heat map img
8,114 peaks (download )

HepG2 - Snyder - ENCSR000EDY

HepG2
Snyder
BRCA1
ENCSR000EDY
r=1.00

small heat map img

HepG2
Snyder
RCOR1
ENCSR000EDQ
r=0.81

small heat map img

HepG2
Snyder
ZBTB33
ENCSR000BNA
r=0.77

small heat map img

HepG2
Snyder
ZBTB33
ENCSR000BHR
r=0.77

small heat map img

HepG2
Snyder
MXI1
ENCSR000EDU
r=0.60

small heat map img

HepG2
Snyder
NR3C1
ENCSR000EEV
r=0.57

small heat map img

HepG2
Snyder
MAFF
ENCSR000EEC
r=0.53

small heat map img

HepG2
Snyder
MAX
ENCSR000EDS
r=0.50

small heat map img

HepG2
Snyder
EP300
ENCSR000EDV
r=0.50

small heat map img

HepG2
Snyder
MAX
ENCSR000BTM
r=0.49

small heat map img

HepG2
Snyder
HNF4A
ENCSR000EEU
r=0.47

small heat map img

HepG2
Snyder
MYC
ENCSR000DLR
r=0.47

small heat map img

HepG2
Snyder
SREBF1
ENCSR000EEO
r=0.46

small heat map img

HepG2
Snyder
NR2F2
ENCSR000BVM
r=0.46

small heat map img

HepG2
Snyder
ZEB1
ENCSR000BVN
r=0.46

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEP
r=0.45

small heat map img

HepG2
Snyder
ELF1
ENCSR000BMZ
r=0.45

small heat map img

HepG2
Snyder
MAFK
ENCSR000EDZ
r=0.45

small heat map img

HepG2
Snyder
ARID3A
ENCSR000EDP
r=0.45

small heat map img

HepG2
Snyder
TAF1
ENCSR000BJN
r=0.43

small heat map img

HepG2
Snyder
POLR2A
ENCSR000DLQ
r=0.43

small heat map img

HepG2
Snyder
MAFK
ENCSR000EEB
r=0.42

small heat map img

HepG2
Snyder
YY1
ENCSR000BNT
r=0.42

small heat map img

HepG2
Snyder
TBP
ENCSR000EEL
r=0.42

small heat map img

HepG2
Snyder
HSF1
ENCSR000EET
r=0.41

small heat map img

HepG2
Snyder
FOSL2
ENCSR000BHP
r=0.40

small heat map img

HepG2
Snyder
POLR2A
ENCSR000BJM
r=0.39

small heat map img

HepG2
Snyder
BHLHE40
ENCSR000EDT
r=0.39

small heat map img

HepG2
Snyder
ESRRA
ENCSR000EEW
r=0.39

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEM
r=0.38

small heat map img

HepG2
Snyder
MYBL2
ENCSR000BRO
r=0.38

small heat map img

HepG2
Snyder
SIN3A
ENCSR000BGL
r=0.36

small heat map img

HepG2
Snyder
JUND
ENCSR000BGK
r=0.35

small heat map img

HepG2
Snyder
NFIC
ENCSR000BQX
r=0.35

small heat map img

HepG2
Snyder
CEBPB
ENCSR000EEX
r=0.35

small heat map img

HepG2
Snyder
SP1
ENCSR000BJX
r=0.34

small heat map img

HepG2
Snyder
CREB1
ENCSR000BVL
r=0.34

small heat map img

HepG2
Snyder
HDAC2
ENCSR000BMC
r=0.33

small heat map img

HepG2
Snyder
NR2C2
ENCSR000EVS
r=0.32

small heat map img

HepG2
Snyder
JUND
ENCSR000EEI
r=0.32

small heat map img

HepG2
Snyder
TCF12
ENCSR000BJG
r=0.31

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EZQ
r=0.30

small heat map img

HepG2
Snyder
HNF4G
ENCSR000BNJ
r=0.30

small heat map img

HepG2
Snyder
CEBPD
ENCSR000BQJ
r=0.30

small heat map img

HepG2
Snyder
CEBPB
ENCSR000EEE
r=0.28

small heat map img

HepG2
Snyder
RFX5
ENCSR000EEA
r=0.28

small heat map img

HepG2
Snyder
USF2
ENCSR000EEF
r=0.28

small heat map img

HepG2
Snyder
EP300
ENCSR000BLW
r=0.28

small heat map img

HepG2
Snyder
GABPA
ENCSR000BJK
r=0.27

small heat map img

HepG2
Snyder
SREBF2
ENCSR000EZO
r=0.27

small heat map img

HepG2
Snyder
SMC3
ENCSR000EDW
r=0.27

small heat map img

HepG2
Snyder
SREBF1
ENCSR000EZP
r=0.26

small heat map img

HepG2
Snyder
MBD4
ENCSR000BQW
r=0.25

small heat map img

HepG2
Snyder
NRF1
ENCSR000EEH
r=0.24

small heat map img

HepG2
Snyder
TEAD4
ENCSR000BRP
r=0.24

small heat map img

HepG2
Snyder
JUN
ENCSR000EEK
r=0.24

small heat map img

HepG2
Snyder
REST
ENCSR000BJL
r=0.23

small heat map img

HepG2
Snyder
SRF
ENCSR000BLV
r=0.22

small heat map img

HepG2
Snyder
RAD21
ENCSR000EEG
r=0.22

small heat map img

HepG2
Snyder
REST
ENCSR000BOT
r=0.21

small heat map img

HepG2
Snyder
IRF3
ENCSR000EEJ
r=0.21

small heat map img

HepG2
Snyder
FOXA1
ENCSR000BLE
r=0.20

small heat map img

HepG2
Snyder
ATF3
ENCSR000BKE
r=0.20

small heat map img

HepG2
Snyder
HNF4A
ENCSR000BLF
r=0.19

small heat map img

HepG2
Snyder
USF1
ENCSR000BGM
r=0.19

small heat map img

HepG2
Snyder
RAD21
ENCSR000BLS
r=0.17

small heat map img

HepG2
Snyder
RXRA
ENCSR000BHU
r=0.17

small heat map img

HepG2
Snyder
FOXA1
ENCSR000BMO
r=0.17

small heat map img

HepG2
Snyder
BHLHE40
ENCSR000BID
r=0.16

small heat map img

HepG2
Snyder
ZBTB7A
ENCSR000BQA
r=0.16

small heat map img

HepG2
Snyder
CTCF
ENCSR000DUG
r=0.15

small heat map img

HepG2
Snyder
CTCF
ENCSR000DLS
r=0.15

small heat map img

HepG2
Snyder
CTCF
ENCSR000AMA
r=0.15

small heat map img

HepG2
Snyder
CTCF
ENCSR000BIE
r=0.14

small heat map img

HepG2
Snyder
SP2
ENCSR000BOU
r=0.14

small heat map img

HepG2
Snyder
CEBPB
ENCSR000BQI
r=0.13

small heat map img

HepG2
Snyder
EZH2
ENCSR000ARI
r=0.06

small heat map img

HepG2
Snyder
FOXA2
ENCSR000BNI
r=0.06

small heat map img

HepG2
Snyder
TCF7L2
ENCSR000EVQ
r=0.04

small heat map img

HepG2
Snyder
ZNF274
ENCSR000EVR
r=-0.07

small heat map img
1,497 peaks (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZS

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help