BHLHE40

This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with ARNTL or compete for E-box binding sites in the promoter of PER1 and repress CLOCK/ARNTL's transactivation of PER1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. RefSeq, Feb 2014
Class E basic helix-loop-helix protein 40 is a protein that in humans is encoded by the BHLHE40 gene. DEC1 encodes a basic helix-loop-helix protein expressed in various tissues.wikipedia

BHLHE40


ENCODE experiments
Ensemble search
Entrez 8553
GO search
Gene Card search
HGNC search
RefSeq search
UCSC browse
UniProt search
Wikipedia BHLHB2

Average Profiles of Modified Histones around the Summit of ChIP-seq Peaks

A549 - Snyder - ENCSR000DYJ

loading

GM12878 - Snyder - ENCSR000DZJ

loading

HepG2 - Myers - ENCSR000BID

loading

HepG2 - Snyder - ENCSR000EDT

loading

K562 - Snyder - ENCSR000EGV

loading

Legend

Proximal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1
Distal:
  • H2AFZ
  • H3K27ac
  • H3K27me3
  • H3K36me3
  • H3K4me1
  • H3K4me2
  • H3K4me3
  • H3K79me2
  • H3K9ac
  • H3K9me1
  • H3K9me3
  • H4K20me1

Notes

Average histone modification profiles are shown for the [-2 kb, +2 kb] window around the summits of TF ChIP-seq peaks. Profile are shown separately for peaks that are proximal ([-1 kb, +1 kb]; ending in '-p') to an annotated transcript start site (TSS) and for peaks that are distal (>1 kb; ending in '-d') to all annotated TSS. TSS-proximal profiles are arranged such that the nearest transcript proceeds towards the right.

Motifs Enriched in the Top 500 ChIP-seq Peaks

A549 - Snyder - ENCSR000DYJ

1.
449 / 500
2.7e-442
GGCACGTGACCGGGGG
small heat map img p-value: 0.00
pct_center: 0.59
pct_ratio: 3.21
2.
12 / 500
4.5e-24
GTGCGTGTGTGTGTGTGTGTGTGTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.15
pct_ratio: 0.75
3.
30 / 500
2.0e-14
AAAGAAAAAAAAAAGTAAATT
small heat map img p-value: 0.98
pct_center: 0.08
pct_ratio: 0.25
4.
53 / 500
6.5e-12
GTGAGTCA
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 1.36
5.
84 / 500
3.4e-9
GGGGCGGG
small heat map img p-value: 0.00
pct_center: 0.45
pct_ratio: 0.61
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

GM12878 - Snyder - ENCSR000DZJ

1.
439 / 500
4.3e-377
GGCACGTGCGC
small heat map img p-value: 0.00
pct_center: 0.29
pct_ratio: 4.05
2.
27 / 500
1.1e-62
GTGTGTGTGTGTGTGTGTGTG
small heat map img p-value: 0.05
pct_center: 0.21
pct_ratio: 0.67
3.
66 / 500
2.9e-31
AAAGAGAAACTGAAA
small heat map img p-value: 0.02
pct_center: 0.26
pct_ratio: 0.52
4.
83 / 500
1.7e-8
GCGGGGGAGGGCGGGGGGGGG
small heat map img p-value: 0.00
pct_center: 0.48
pct_ratio: 0.82
5.
58 / 500
0.00050
AGGAAGTG
small heat map img p-value: 0.00
pct_center: 0.18
pct_ratio: 0.85
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Myers - ENCSR000BID

1.
476 / 500
5.5e-425
GCACGTGACTG
small heat map img p-value: 0.00
pct_center: 0.47
pct_ratio: 5.00
2.
129 / 500
5.4e-41
TGTTTGCTTAA
small heat map img p-value: 0.00
pct_center: 0.21
pct_ratio: 1.23
3.
15 / 500
4.0e-20
TGTGTGTGTGTGTGTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.16
pct_ratio: 0.77
4.
92 / 500
3.1e-25
GGGGCGGGGGCGGGG
small heat map img p-value: 0.93
pct_center: 0.52
pct_ratio: 0.54
5.
42 / 500
4.5e-10
AAAGATCAAAG
small heat map img p-value: 0.00
pct_center: 0.20
pct_ratio: 0.85
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

HepG2 - Snyder - ENCSR000EDT

1.
430 / 500
2.7e-521
GGCACGTGACCGGG
small heat map img p-value: 0.00
pct_center: 0.35
pct_ratio: 4.45
2.
43 / 500
5.1e-20
TGTGTGTGTGTGTGT
small heat map img p-value: 0.00
pct_center: 0.14
pct_ratio: 0.70
3.
83 / 500
1.3e-20
GGGGCGGGGCCGGGG
small heat map img p-value: 0.08
pct_center: 0.51
pct_ratio: 0.58
4.
70 / 500
2.4e-8
GTCACGTG
small heat map img p-value: 0.00
pct_center: 0.24
pct_ratio: 1.79
5.
38 / 500
0.00012
CAGATCAAAGA
small heat map img p-value: 0.00
pct_center: 0.11
pct_ratio: 0.60
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

K562 - Snyder - ENCSR000EGV

1.
486 / 500
3.1e-518
GGTCACGTGC
small heat map img p-value: 0.00
pct_center: 0.33
pct_ratio: 4.47
2.
86 / 500
2.2e-13
GGGGGGCGGGGCCGG
small heat map img p-value: 0.00
pct_center: 0.48
pct_ratio: 0.60
3.
63 / 500
5.2e-9
AGATAA
small heat map img p-value: 0.00
pct_center:
pct_ratio:
4.
51 / 500
6.6e-7
GGGTCACGTGA
small heat map img p-value: 0.00
pct_center: 0.13
pct_ratio: 1.15
5.
9 / 500
0.00030
GTGTAAGTGCGTGTGTGTGTGTGTGTGTGT
small heat map img p-value: 0.01
pct_center: 0.16
pct_ratio: 0.71
MEME output

Notes

The top 500 TF ChIP-seq peaks were used to identify enriched motifs de novo, using the MEME-ChIP suite of tools. Up to five motifs are reported (1 to 5) if they meet the criteria defined by our pipeline.

Binding of other histone marks at BHLHE40 peaks

A549 - Snyder - ENCSR000DYJ

A549
Snyder
BHLHE40
ENCSR000DYJ
r=1.00

small heat map img

A549
Snyder
H2AFZ
ENCSR000AUG
r=0.50

small heat map img

A549
Snyder
H2AFZ
ENCSR000AUH
r=0.48

small heat map img

A549
Snyder
H3K27ac
ENCSR000AVF
r=0.45

small heat map img

A549
Snyder
H3K4me3
ENCSR000ASH
r=0.45

small heat map img

A549
Snyder
H3K4me3
ENCSR000AST
r=0.44

small heat map img

A549
Snyder
H3K9ac
ENCSR000ASV
r=0.43

small heat map img

A549
Snyder
H3K27ac
ENCSR000AUI
r=0.42

small heat map img

A549
Snyder
H3K4me3
ENCSR000DPD
r=0.42

small heat map img

A549
Snyder
H3K4me2
ENCSR000AVI
r=0.39

small heat map img

A549
Snyder
H3K4me2
ENCSR000ATO
r=0.37

small heat map img

A549
Snyder
H3K4me1
ENCSR000AUM
r=0.12

small heat map img

A549
Snyder
H3K4me1
ENCSR000AVH
r=0.12

small heat map img

A549
Snyder
H3K79me2
ENCSR000ASU
r=0.04

small heat map img

A549
Snyder
H3K79me2
ENCSR000ATP
r=0.04

small heat map img

A549
Snyder
H3K27me3
ENCSR000AUK
r=0.01

small heat map img

A549
Snyder
H4K20me1
ENCSR000AUO
r=0.01

small heat map img

A549
Snyder
H3K9me3
ENCSR000AUN
r=-0.02

small heat map img

A549
Snyder
H3K27me3
ENCSR000AUJ
r=-0.04

small heat map img

A549
Snyder
H3K36me3
ENCSR000AUL
r=-0.05

small heat map img

A549
Snyder
H3K36me3
ENCSR000AVG
r=-0.05

small heat map img
3,123 peaks (download )

GM12878 - Snyder - ENCSR000DZJ

GM12878
Snyder
BHLHE40
ENCSR000DZJ
r=1.00

small heat map img

GM12878
Snyder
H2AFZ
ENCSR000AOV
r=0.41

small heat map img

GM12878
Snyder
H3K9ac
ENCSR000AKH
r=0.38

small heat map img

GM12878
Snyder
H3K27ac
ENCSR000AKC
r=0.37

small heat map img

GM12878
Snyder
H3K4me2
ENCSR000AKG
r=0.36

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000AKA
r=0.35

small heat map img

GM12878
Snyder
H3K4me3
ENCSR000DRY
r=0.29

small heat map img

GM12878
Snyder
H3K4me1
ENCSR000AKF
r=0.22

small heat map img

GM12878
Snyder
H3K79me2
ENCSR000AOW
r=0.14

small heat map img

GM12878
Snyder
H3K9me3
ENCSR000AOX
r=0.01

small heat map img

GM12878
Snyder
H4K20me1
ENCSR000AKI
r=-0.01

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000DRW
r=-0.04

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000DRX
r=-0.06

small heat map img

GM12878
Snyder
H3K27me3
ENCSR000AKD
r=-0.06

small heat map img

GM12878
Snyder
H3K36me3
ENCSR000AKE
r=-0.08

small heat map img
10,000 randomly-selected peaks from a total of 13,986 (download )

HepG2 - Myers - ENCSR000BID

HepG2
Myers
BHLHE40
ENCSR000BID
r=1.00

small heat map img

HepG2
Myers
BHLHE40
ENCSR000EDT
r=0.54

small heat map img

HepG2
Myers
H3K27ac
ENCSR000AMO
r=0.26

small heat map img

HepG2
Myers
H3K4me2
ENCSR000AMC
r=0.24

small heat map img

HepG2
Myers
H3K9ac
ENCSR000AMD
r=0.23

small heat map img

HepG2
Myers
H3K4me3
ENCSR000AMP
r=0.23

small heat map img

HepG2
Myers
H2AFZ
ENCSR000AOK
r=0.21

small heat map img

HepG2
Myers
H3K4me3
ENCSR000DUF
r=0.18

small heat map img

HepG2
Myers
H3K4me1
ENCSR000APV
r=0.15

small heat map img

HepG2
Myers
H3K27me3
ENCSR000AOL
r=0.11

small heat map img

HepG2
Myers
H3K27me3
ENCSR000DUE
r=0.03

small heat map img

HepG2
Myers
H3K79me2
ENCSR000AOM
r=0.02

small heat map img

HepG2
Myers
H4K20me1
ENCSR000AMQ
r=0.01

small heat map img

HepG2
Myers
H3K9me3
ENCSR000ATD
r=0.01

small heat map img

HepG2
Myers
H3K36me3
ENCSR000DUD
r=-0.03

small heat map img

HepG2
Myers
H3K36me3
ENCSR000AMB
r=-0.05

small heat map img
2,859 peaks (download )

HepG2 - Snyder - ENCSR000EDT

HepG2
Snyder
BHLHE40
ENCSR000EDT
r=1.00

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000AMP
r=0.37

small heat map img

HepG2
Snyder
H3K9ac
ENCSR000AMD
r=0.37

small heat map img

HepG2
Snyder
BHLHE40
ENCSR000BID
r=0.36

small heat map img

HepG2
Snyder
H3K4me2
ENCSR000AMC
r=0.35

small heat map img

HepG2
Snyder
H3K27ac
ENCSR000AMO
r=0.35

small heat map img

HepG2
Snyder
H3K4me3
ENCSR000DUF
r=0.33

small heat map img

HepG2
Snyder
H2AFZ
ENCSR000AOK
r=0.29

small heat map img

HepG2
Snyder
H3K4me1
ENCSR000APV
r=0.18

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000AOL
r=0.15

small heat map img

HepG2
Snyder
H3K79me2
ENCSR000AOM
r=0.12

small heat map img

HepG2
Snyder
H4K20me1
ENCSR000AMQ
r=0.05

small heat map img

HepG2
Snyder
H3K27me3
ENCSR000DUE
r=0.02

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000DUD
r=0.00

small heat map img

HepG2
Snyder
H3K9me3
ENCSR000ATD
r=0.00

small heat map img

HepG2
Snyder
H3K36me3
ENCSR000AMB
r=-0.02

small heat map img
10,000 randomly-selected peaks from a total of 14,628 (download )

K562 - Snyder - ENCSR000EGV

K562
Snyder
BHLHE40
ENCSR000EGV
r=1.00

small heat map img

K562
Snyder
H3K4me2
ENCSR000AKT
r=0.40

small heat map img

K562
Snyder
H3K4me3
ENCSR000AKU
r=0.39

small heat map img

K562
Snyder
H2AFZ
ENCSR000APC
r=0.37

small heat map img

K562
Snyder
H3K9ac
ENCSR000AKV
r=0.37

small heat map img

K562
Snyder
H3K27ac
ENCSR000AKP
r=0.37

small heat map img

K562
Snyder
H3K9ac
ENCSR000EVZ
r=0.37

small heat map img

K562
Snyder
H3K4me3
ENCSR000DWD
r=0.34

small heat map img

K562
Snyder
H3K4me3
ENCSR000EWA
r=0.32

small heat map img

K562
Snyder
H3K4me1
ENCSR000EWC
r=0.26

small heat map img

K562
Snyder
H3K4me1
ENCSR000AKS
r=0.24

small heat map img

K562
Snyder
H3K79me2
ENCSR000APD
r=0.17

small heat map img

K562
Snyder
H3K9me1
ENCSR000AKW
r=0.12

small heat map img

K562
Snyder
H4K20me1
ENCSR000AKX
r=0.11

small heat map img

K562
Snyder
H3K9me3
ENCSR000APE
r=0.08

small heat map img

K562
Snyder
H3K36me3
ENCSR000AKR
r=0.05

small heat map img

K562
Snyder
H3K36me3
ENCSR000DWB
r=0.01

small heat map img

K562
Snyder
H3K27me3
ENCSR000AKQ
r=0.00

small heat map img

K562
Snyder
H3K27me3
ENCSR000DWC
r=0.00

small heat map img

K562
Snyder
H3K27me3
ENCSR000EWB
r=-0.06

small heat map img
10,000 randomly-selected peaks from a total of 22,497 (download )

Notes

ChIP-seq peaks (left to right in the heatmap) for the current TF are sorted by descending TF ChIP-seq signal. The ChIP-seq signals of histone modifications are plotted for the genomic regions that correspond to the peaks of the current TF in the same order. The Pearson correlation coefficient (r) of the histone modification ChIP-seq signal with the TF ChIP-seq signal is shown.

legend
Binding of other TFs at BHLHE40 peaks

A549 - Snyder - ENCSR000DYJ

A549
Snyder
BHLHE40
ENCSR000DYJ
r=1.00

small heat map img

A549
Snyder
MAX
ENCSR000DYG
r=0.70

small heat map img

A549
Snyder
MAX
ENCSR000BTJ
r=0.65

small heat map img

A549
Snyder
MYC
ENCSR000DYC
r=0.60

small heat map img

A549
Snyder
SP1
ENCSR000BPE
r=0.56

small heat map img

A549
Snyder
USF1
ENCSR000BHX
r=0.53

small heat map img

A549
Snyder
USF1
ENCSR000BJB
r=0.50

small heat map img

A549
Snyder
GATA3
ENCSR000BTI
r=0.50

small heat map img

A549
Snyder
E2F6
ENCSR000BTC
r=0.49

small heat map img

A549
Snyder
USF1
ENCSR000BPV
r=0.47

small heat map img

A549
Snyder
CREB1
ENCSR000BRB
r=0.46

small heat map img

A549
Snyder
TEAD4
ENCSR000BUD
r=0.45

small heat map img

A549
Snyder
RAD21
ENCSR000DYE
r=0.45

small heat map img

A549
Snyder
PBX3
ENCSR000BTN
r=0.44

small heat map img

A549
Snyder
CEBPB
ENCSR000BUB
r=0.40

small heat map img

A549
Snyder
SIN3A
ENCSR000BRM
r=0.40

small heat map img

A549
Snyder
CEBPB
ENCSR000DYI
r=0.39

small heat map img

A549
Snyder
SIX5
ENCSR000BRL
r=0.39

small heat map img

A549
Snyder
RAD21
ENCSR000BUC
r=0.37

small heat map img

A549
Snyder
JUND
ENCSR000BRF
r=0.37

small heat map img

A549
Snyder
FOSL2
ENCSR000BQO
r=0.36

small heat map img

A549
Snyder
ZBTB33
ENCSR000BPZ
r=0.36

small heat map img

A549
Snyder
NR3C1
ENCSR000BJR
r=0.36

small heat map img

A549
Snyder
ETS1
ENCSR000BPU
r=0.36

small heat map img

A549
Snyder
YY1
ENCSR000BPM
r=0.35

small heat map img

A549
Snyder
CTCF
ENCSR000DYD
r=0.34

small heat map img

A549
Snyder
TCF12
ENCSR000BQQ
r=0.34

small heat map img

A549
Snyder
FOXA2
ENCSR000BRE
r=0.33

small heat map img

A549
Snyder
POLR2A
ENCSR000DMZ
r=0.33

small heat map img

A549
Snyder
REST
ENCSR000BQP
r=0.33

small heat map img

A549
Snyder
TAF1
ENCSR000BPF
r=0.32

small heat map img

A549
Snyder
GABPA
ENCSR000BPY
r=0.32

small heat map img

A549
Snyder
EP300
ENCSR000BPW
r=0.30

small heat map img

A549
Snyder
ATF3
ENCSR000BPS
r=0.30

small heat map img

A549
Snyder
POLR2A
ENCSR000BHI
r=0.30

small heat map img

A549
Snyder
POLR2A
ENCSR000BHH
r=0.29

small heat map img

A549
Snyder
BCL3
ENCSR000BQH
r=0.29

small heat map img

A549
Snyder
NR3C1
ENCSR000BHF
r=0.29

small heat map img

A549
Snyder
ELF1
ENCSR000BPT
r=0.28

small heat map img

A549
Snyder
CTCF
ENCSR000DNA
r=0.25

small heat map img

A549
Snyder
CTCF
ENCSR000AUF
r=0.24

small heat map img

A549
Snyder
FOXA1
ENCSR000BPX
r=0.22

small heat map img

A549
Snyder
CTCF
ENCSR000AUE
r=0.22

small heat map img

A549
Snyder
CTCF
ENCSR000BHV
r=0.21

small heat map img

A549
Snyder
NR3C1
ENCSR000BHE
r=0.21

small heat map img

A549
Snyder
CTCF
ENCSR000BHW
r=0.20

small heat map img

A549
Snyder
NR3C1
ENCSR000BHG
r=0.20

small heat map img

A549
Snyder
CTCF
ENCSR000DPF
r=0.18

small heat map img
3,123 peaks (download )

GM12878 - Snyder - ENCSR000DZJ

GM12878
Snyder
BHLHE40
ENCSR000DZJ
r=1.00

small heat map img

GM12878
Snyder
MAX
ENCSR000DZF
r=0.69

small heat map img

GM12878
Snyder
TBL1XR1
ENCSR000DYZ
r=0.68

small heat map img

GM12878
Snyder
MXI1
ENCSR000DZI
r=0.67

small heat map img

GM12878
Snyder
RCOR1
ENCSR000DZC
r=0.63

small heat map img

GM12878
Snyder
EP300
ENCSR000DZG
r=0.63

small heat map img

GM12878
Snyder
EP300
ENCSR000DZD
r=0.63

small heat map img

GM12878
Snyder
STAT1
ENCSR000DZM
r=0.61

small heat map img

GM12878
Snyder
USF2
ENCSR000DZU
r=0.58

small heat map img

GM12878
Snyder
RUNX3
ENCSR000BRI
r=0.58

small heat map img

GM12878
Snyder
JUND
ENCSR000DYS
r=0.58

small heat map img

GM12878
Snyder
ELK1
ENCSR000DZB
r=0.57

small heat map img

GM12878
Snyder
RELA
ENCSR000EAG
r=0.55

small heat map img

GM12878
Snyder
SREBF1
ENCSR000DYU
r=0.53

small heat map img

GM12878
Snyder
STAT3
ENCSR000DZV
r=0.53

small heat map img

GM12878
Snyder
ESRRA
ENCSR000DYQ
r=0.52

small heat map img

GM12878
Snyder
CUX1
ENCSR000DYR
r=0.52

small heat map img

GM12878
Snyder
CREB1
ENCSR000BUF
r=0.51

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHD
r=0.51

small heat map img

GM12878
Snyder
SIN3A
ENCSR000DYX
r=0.50

small heat map img

GM12878
Snyder
SP1
ENCSR000BHK
r=0.49

small heat map img

GM12878
Snyder
SMC3
ENCSR000DZP
r=0.49

small heat map img

GM12878
Snyder
ATF2
ENCSR000BQK
r=0.49

small heat map img

GM12878
Snyder
FOXM1
ENCSR000BRU
r=0.48

small heat map img

GM12878
Snyder
NFE2
ENCSR000DZY
r=0.48

small heat map img

GM12878
Snyder
CHD1
ENCSR000DZE
r=0.47

small heat map img

GM12878
Snyder
TCF12
ENCSR000BGZ
r=0.46

small heat map img

GM12878
Snyder
MAFK
ENCSR000DYV
r=0.46

small heat map img

GM12878
Snyder
NFIC
ENCSR000BRN
r=0.46

small heat map img

GM12878
Snyder
MYC
ENCSR000DKU
r=0.46

small heat map img

GM12878
Snyder
BRCA1
ENCSR000DZS
r=0.45

small heat map img

GM12878
Snyder
TBP
ENCSR000DZZ
r=0.44

small heat map img

GM12878
Snyder
E2F4
ENCSR000DYY
r=0.44

small heat map img

GM12878
Snyder
ELF1
ENCSR000BMB
r=0.44

small heat map img

GM12878
Snyder
BCL3
ENCSR000BNQ
r=0.43

small heat map img

GM12878
Snyder
SREBF2
ENCSR000DYT
r=0.43

small heat map img

GM12878
Snyder
RAD21
ENCSR000EAC
r=0.43

small heat map img

GM12878
Snyder
NRF1
ENCSR000DZO
r=0.42

small heat map img

GM12878
Snyder
FOS
ENCSR000EYZ
r=0.42

small heat map img

GM12878
Snyder
PML
ENCSR000BQM
r=0.42

small heat map img

GM12878
Snyder
TCF3
ENCSR000BQT
r=0.41

small heat map img

GM12878
Snyder
WRNIP1
ENCSR000EAA
r=0.41

small heat map img

GM12878
Snyder
POLR2A
ENCSR000DKT
r=0.41

small heat map img

GM12878
Snyder
EBF1
ENCSR000DZQ
r=0.41

small heat map img

GM12878
Snyder
IRF3
ENCSR000DZX
r=0.40

small heat map img

GM12878
Snyder
CEBPB
ENCSR000BRX
r=0.40

small heat map img

GM12878
Snyder
RFX5
ENCSR000DZW
r=0.40

small heat map img

GM12878
Snyder
IKZF1
ENCSR000EUJ
r=0.39

small heat map img

GM12878
Snyder
ZNF384
ENCSR000DYP
r=0.39

small heat map img

GM12878
Snyder
PAX5
ENCSR000BHJ
r=0.39

small heat map img

GM12878
Snyder
EP300
ENCSR000BHB
r=0.38

small heat map img

GM12878
Snyder
BCL11A
ENCSR000BHA
r=0.38

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EAD
r=0.38

small heat map img

GM12878
Snyder
MEF2A
ENCSR000BKB
r=0.38

small heat map img

GM12878
Snyder
POU2F2
ENCSR000BGP
r=0.37

small heat map img

GM12878
Snyder
USF1
ENCSR000BGI
r=0.37

small heat map img

GM12878
Snyder
NFATC1
ENCSR000BQL
r=0.37

small heat map img

GM12878
Snyder
POLR2A
ENCSR000EYW
r=0.36

small heat map img

GM12878
Snyder
IRF4
ENCSR000BGY
r=0.36

small heat map img

GM12878
Snyder
EBF1
ENCSR000BGU
r=0.35

small heat map img

GM12878
Snyder
YY1
ENCSR000BNP
r=0.34

small heat map img

GM12878
Snyder
ETS1
ENCSR000BKA
r=0.34

small heat map img

GM12878
Snyder
STAT5A
ENCSR000BQZ
r=0.34

small heat map img

GM12878
Snyder
POLR2A
ENCSR000BGD
r=0.32

small heat map img

GM12878
Snyder
ZNF143
ENCSR000DZL
r=0.32

small heat map img

GM12878
Snyder
JUND
ENCSR000EYV
r=0.32

small heat map img

GM12878
Snyder
BATF
ENCSR000BGT
r=0.32

small heat map img

GM12878
Snyder
MTA3
ENCSR000BRH
r=0.31

small heat map img

GM12878
Snyder
EGR1
ENCSR000BMQ
r=0.30

small heat map img

GM12878
Snyder
SRF
ENCSR000BMI
r=0.28

small heat map img

GM12878
Snyder
KAT2A
ENCSR000DNO
r=0.27

small heat map img

GM12878
Snyder
NFYB
ENCSR000DNM
r=0.27

small heat map img

GM12878
Snyder
SIX5
ENCSR000BJE
r=0.27

small heat map img

GM12878
Snyder
NFYA
ENCSR000DNN
r=0.27

small heat map img

GM12878
Snyder
CTCF
ENCSR000DZN
r=0.26

small heat map img

GM12878
Snyder
SPI1
ENCSR000BGQ
r=0.25

small heat map img

GM12878
Snyder
TAF1
ENCSR000BGS
r=0.23

small heat map img

GM12878
Snyder
EGR1
ENCSR000BRG
r=0.23

small heat map img

GM12878
Snyder
EZH2
ENCSR000ARD
r=0.22

small heat map img

GM12878
Snyder
SUPT20H
ENCSR000DNP
r=0.21

small heat map img

GM12878
Snyder
CTCF
ENCSR000DKV
r=0.21

small heat map img

GM12878
Snyder
RXRA
ENCSR000BJD
r=0.20

small heat map img

GM12878
Snyder
CTCF
ENCSR000AKB
r=0.20

small heat map img

GM12878
Snyder
GABPA
ENCSR000BGC
r=0.20

small heat map img

GM12878
Snyder
RAD21
ENCSR000BMY
r=0.18

small heat map img

GM12878
Snyder
PBX3
ENCSR000BGR
r=0.18

small heat map img

GM12878
Snyder
YY1
ENCSR000EUM
r=0.18

small heat map img

GM12878
Snyder
ATF3
ENCSR000BJY
r=0.17

small heat map img

GM12878
Snyder
CTCF
ENCSR000DRZ
r=0.17

small heat map img

GM12878
Snyder
NR2C2
ENCSR000EUL
r=0.16

small heat map img

GM12878
Snyder
MEF2C
ENCSR000BNG
r=0.16

small heat map img

GM12878
Snyder
SRF
ENCSR000BGE
r=0.15

small heat map img

GM12878
Snyder
POLR3G
ENCSR000EYU
r=0.15

small heat map img

GM12878
Snyder
ZBTB33
ENCSR000BHC
r=0.15

small heat map img

GM12878
Snyder
ZEB1
ENCSR000BND
r=0.12

small heat map img

GM12878
Snyder
REST
ENCSR000BGF
r=0.08

small heat map img

GM12878
Snyder
REST
ENCSR000BQS
r=0.07

small heat map img

GM12878
Snyder
ZZZ3
ENCSR000DNQ
r=-0.00

small heat map img

GM12878
Snyder
ZNF274
ENCSR000EUK
r=-0.07

small heat map img
10,000 randomly-selected peaks from a total of 13,986 (download )

HepG2 - Myers - ENCSR000BID

HepG2
Myers
BHLHE40
ENCSR000BID
r=1.00

small heat map img

HepG2
Myers
BHLHE40
ENCSR000EDT
r=0.54

small heat map img

HepG2
Myers
MAX
ENCSR000BTM
r=0.45

small heat map img

HepG2
Myers
MAX
ENCSR000EDS
r=0.45

small heat map img

HepG2
Myers
MXI1
ENCSR000EDU
r=0.43

small heat map img

HepG2
Myers
FOSL2
ENCSR000BHP
r=0.42

small heat map img

HepG2
Myers
EP300
ENCSR000EDV
r=0.42

small heat map img

HepG2
Myers
SP1
ENCSR000BJX
r=0.42

small heat map img

HepG2
Myers
HNF4A
ENCSR000EEU
r=0.42

small heat map img

HepG2
Myers
NR2F2
ENCSR000BVM
r=0.41

small heat map img

HepG2
Myers
MYC
ENCSR000DLR
r=0.41

small heat map img

HepG2
Myers
RCOR1
ENCSR000EDQ
r=0.40

small heat map img

HepG2
Myers
HDAC2
ENCSR000BMC
r=0.39

small heat map img

HepG2
Myers
EP300
ENCSR000BLW
r=0.38

small heat map img

HepG2
Myers
CREB1
ENCSR000BVL
r=0.38

small heat map img

HepG2
Myers
JUND
ENCSR000BGK
r=0.38

small heat map img

HepG2
Myers
TCF12
ENCSR000BJG
r=0.38

small heat map img

HepG2
Myers
ARID3A
ENCSR000EDP
r=0.37

small heat map img

HepG2
Myers
HNF4G
ENCSR000BNJ
r=0.37

small heat map img

HepG2
Myers
USF2
ENCSR000EEF
r=0.36

small heat map img

HepG2
Myers
ZEB1
ENCSR000BVN
r=0.36

small heat map img

HepG2
Myers
USF1
ENCSR000BGM
r=0.36

small heat map img

HepG2
Myers
HSF1
ENCSR000EET
r=0.35

small heat map img

HepG2
Myers
HNF4A
ENCSR000BLF
r=0.35

small heat map img

HepG2
Myers
JUND
ENCSR000EEI
r=0.34

small heat map img

HepG2
Myers
FOXA1
ENCSR000BMO
r=0.34

small heat map img

HepG2
Myers
NFIC
ENCSR000BQX
r=0.34

small heat map img

HepG2
Myers
MYBL2
ENCSR000BRO
r=0.34

small heat map img

HepG2
Myers
FOXA1
ENCSR000BLE
r=0.33

small heat map img

HepG2
Myers
SREBF1
ENCSR000EEO
r=0.33

small heat map img

HepG2
Myers
CEBPB
ENCSR000EEX
r=0.32

small heat map img

HepG2
Myers
SMC3
ENCSR000EDW
r=0.32

small heat map img

HepG2
Myers
TEAD4
ENCSR000BRP
r=0.31

small heat map img

HepG2
Myers
MAFF
ENCSR000EEC
r=0.31

small heat map img

HepG2
Myers
RAD21
ENCSR000EEG
r=0.30

small heat map img

HepG2
Myers
MAFK
ENCSR000EDZ
r=0.30

small heat map img

HepG2
Myers
ESRRA
ENCSR000EEW
r=0.29

small heat map img

HepG2
Myers
BRCA1
ENCSR000EDY
r=0.29

small heat map img

HepG2
Myers
TBP
ENCSR000EEL
r=0.29

small heat map img

HepG2
Myers
MAFK
ENCSR000EEB
r=0.28

small heat map img

HepG2
Myers
MBD4
ENCSR000BQW
r=0.28

small heat map img

HepG2
Myers
ELF1
ENCSR000BMZ
r=0.27

small heat map img

HepG2
Myers
JUN
ENCSR000EEK
r=0.27

small heat map img

HepG2
Myers
CEBPB
ENCSR000EEE
r=0.27

small heat map img

HepG2
Myers
SIN3A
ENCSR000BGL
r=0.27

small heat map img

HepG2
Myers
NR2C2
ENCSR000EVS
r=0.25

small heat map img

HepG2
Myers
RAD21
ENCSR000BLS
r=0.25

small heat map img

HepG2
Myers
ATF3
ENCSR000BKE
r=0.25

small heat map img

HepG2
Myers
YY1
ENCSR000BNT
r=0.24

small heat map img

HepG2
Myers
RXRA
ENCSR000BHU
r=0.24

small heat map img

HepG2
Myers
CEBPD
ENCSR000BQJ
r=0.24

small heat map img

HepG2
Myers
RFX5
ENCSR000EEA
r=0.23

small heat map img

HepG2
Myers
REST
ENCSR000BOT
r=0.23

small heat map img

HepG2
Myers
SREBF1
ENCSR000EZP
r=0.22

small heat map img

HepG2
Myers
TAF1
ENCSR000BJN
r=0.21

small heat map img

HepG2
Myers
CEBPB
ENCSR000BQI
r=0.21

small heat map img

HepG2
Myers
TCF7L2
ENCSR000EVQ
r=0.20

small heat map img

HepG2
Myers
POLR2A
ENCSR000EEP
r=0.20

small heat map img

HepG2
Myers
NR3C1
ENCSR000EEV
r=0.20

small heat map img

HepG2
Myers
POLR2A
ENCSR000BJM
r=0.19

small heat map img

HepG2
Myers
GABPA
ENCSR000BJK
r=0.18

small heat map img

HepG2
Myers
SREBF2
ENCSR000EZO
r=0.18

small heat map img

HepG2
Myers
POLR2A
ENCSR000EEM
r=0.17

small heat map img

HepG2
Myers
POLR2A
ENCSR000DLQ
r=0.17

small heat map img

HepG2
Myers
ZBTB7A
ENCSR000BQA
r=0.17

small heat map img

HepG2
Myers
SRF
ENCSR000BLV
r=0.16

small heat map img

HepG2
Myers
FOXA2
ENCSR000BNI
r=0.15

small heat map img

HepG2
Myers
CTCF
ENCSR000BIE
r=0.15

small heat map img

HepG2
Myers
NRF1
ENCSR000EEH
r=0.15

small heat map img

HepG2
Myers
CTCF
ENCSR000DLS
r=0.15

small heat map img

HepG2
Myers
IRF3
ENCSR000EEJ
r=0.14

small heat map img

HepG2
Myers
CTCF
ENCSR000AMA
r=0.14

small heat map img

HepG2
Myers
POLR2A
ENCSR000EZQ
r=0.13

small heat map img

HepG2
Myers
ZBTB33
ENCSR000BHR
r=0.13

small heat map img

HepG2
Myers
CTCF
ENCSR000DUG
r=0.13

small heat map img

HepG2
Myers
REST
ENCSR000BJL
r=0.13

small heat map img

HepG2
Myers
ZBTB33
ENCSR000BNA
r=0.10

small heat map img

HepG2
Myers
EZH2
ENCSR000ARI
r=0.10

small heat map img

HepG2
Myers
SP2
ENCSR000BOU
r=0.07

small heat map img

HepG2
Myers
ZNF274
ENCSR000EVR
r=-0.00

small heat map img
2,859 peaks (download )

HepG2 - Snyder - ENCSR000EDT

HepG2
Snyder
BHLHE40
ENCSR000EDT
r=1.00

small heat map img

HepG2
Snyder
MAX
ENCSR000EDS
r=0.68

small heat map img

HepG2
Snyder
MAX
ENCSR000BTM
r=0.61

small heat map img

HepG2
Snyder
MXI1
ENCSR000EDU
r=0.61

small heat map img

HepG2
Snyder
MYC
ENCSR000DLR
r=0.59

small heat map img

HepG2
Snyder
EP300
ENCSR000EDV
r=0.57

small heat map img

HepG2
Snyder
RCOR1
ENCSR000EDQ
r=0.57

small heat map img

HepG2
Snyder
USF2
ENCSR000EEF
r=0.54

small heat map img

HepG2
Snyder
NR2F2
ENCSR000BVM
r=0.52

small heat map img

HepG2
Snyder
HNF4A
ENCSR000EEU
r=0.51

small heat map img

HepG2
Snyder
ZEB1
ENCSR000BVN
r=0.49

small heat map img

HepG2
Snyder
ARID3A
ENCSR000EDP
r=0.48

small heat map img

HepG2
Snyder
SREBF1
ENCSR000EEO
r=0.48

small heat map img

HepG2
Snyder
BRCA1
ENCSR000EDY
r=0.47

small heat map img

HepG2
Snyder
CREB1
ENCSR000BVL
r=0.46

small heat map img

HepG2
Snyder
HSF1
ENCSR000EET
r=0.46

small heat map img

HepG2
Snyder
FOSL2
ENCSR000BHP
r=0.45

small heat map img

HepG2
Snyder
USF1
ENCSR000BGM
r=0.45

small heat map img

HepG2
Snyder
HDAC2
ENCSR000BMC
r=0.44

small heat map img

HepG2
Snyder
SP1
ENCSR000BJX
r=0.43

small heat map img

HepG2
Snyder
CEBPB
ENCSR000EEX
r=0.42

small heat map img

HepG2
Snyder
MAFF
ENCSR000EEC
r=0.41

small heat map img

HepG2
Snyder
ESRRA
ENCSR000EEW
r=0.41

small heat map img

HepG2
Snyder
TBP
ENCSR000EEL
r=0.41

small heat map img

HepG2
Snyder
JUND
ENCSR000BGK
r=0.41

small heat map img

HepG2
Snyder
MYBL2
ENCSR000BRO
r=0.40

small heat map img

HepG2
Snyder
JUND
ENCSR000EEI
r=0.40

small heat map img

HepG2
Snyder
MAFK
ENCSR000EDZ
r=0.40

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEP
r=0.40

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EEM
r=0.39

small heat map img

HepG2
Snyder
NFIC
ENCSR000BQX
r=0.38

small heat map img

HepG2
Snyder
HNF4G
ENCSR000BNJ
r=0.38

small heat map img

HepG2
Snyder
MAFK
ENCSR000EEB
r=0.37

small heat map img

HepG2
Snyder
SMC3
ENCSR000EDW
r=0.37

small heat map img

HepG2
Snyder
POLR2A
ENCSR000BJM
r=0.37

small heat map img

HepG2
Snyder
TAF1
ENCSR000BJN
r=0.37

small heat map img

HepG2
Snyder
ELF1
ENCSR000BMZ
r=0.37

small heat map img

HepG2
Snyder
EP300
ENCSR000BLW
r=0.37

small heat map img

HepG2
Snyder
YY1
ENCSR000BNT
r=0.36

small heat map img

HepG2
Snyder
TCF12
ENCSR000BJG
r=0.36

small heat map img

HepG2
Snyder
BHLHE40
ENCSR000BID
r=0.36

small heat map img

HepG2
Snyder
POLR2A
ENCSR000EZQ
r=0.36

small heat map img

HepG2
Snyder
POLR2A
ENCSR000DLQ
r=0.35

small heat map img

HepG2
Snyder
CEBPB
ENCSR000EEE
r=0.34

small heat map img

HepG2
Snyder
NR2C2
ENCSR000EVS
r=0.33

small heat map img

HepG2
Snyder
TEAD4
ENCSR000BRP
r=0.33

small heat map img

HepG2
Snyder
HNF4A
ENCSR000BLF
r=0.32

small heat map img

HepG2
Snyder
RAD21
ENCSR000EEG
r=0.32

small heat map img

HepG2
Snyder
RFX5
ENCSR000EEA
r=0.31

small heat map img

HepG2
Snyder
FOXA1
ENCSR000BLE
r=0.31

small heat map img

HepG2
Snyder
FOXA1
ENCSR000BMO
r=0.30

small heat map img

HepG2
Snyder
NR3C1
ENCSR000EEV
r=0.30

small heat map img

HepG2
Snyder
JUN
ENCSR000EEK
r=0.29

small heat map img

HepG2
Snyder
SIN3A
ENCSR000BGL
r=0.29

small heat map img

HepG2
Snyder
MBD4
ENCSR000BQW
r=0.29

small heat map img

HepG2
Snyder
CEBPD
ENCSR000BQJ
r=0.28

small heat map img

HepG2
Snyder
ATF3
ENCSR000BKE
r=0.27

small heat map img

HepG2
Snyder
RAD21
ENCSR000BLS
r=0.26

small heat map img

HepG2
Snyder
SREBF1
ENCSR000EZP
r=0.25

small heat map img

HepG2
Snyder
RXRA
ENCSR000BHU
r=0.23

small heat map img

HepG2
Snyder
SREBF2
ENCSR000EZO
r=0.23

small heat map img

HepG2
Snyder
CTCF
ENCSR000AMA
r=0.21

small heat map img

HepG2
Snyder
CTCF
ENCSR000DUG
r=0.21

small heat map img

HepG2
Snyder
CTCF
ENCSR000DLS
r=0.21

small heat map img

HepG2
Snyder
REST
ENCSR000BOT
r=0.21

small heat map img

HepG2
Snyder
IRF3
ENCSR000EEJ
r=0.21

small heat map img

HepG2
Snyder
ZBTB7A
ENCSR000BQA
r=0.20

small heat map img

HepG2
Snyder
CEBPB
ENCSR000BQI
r=0.20

small heat map img

HepG2
Snyder
NRF1
ENCSR000EEH
r=0.20

small heat map img

HepG2
Snyder
REST
ENCSR000BJL
r=0.19

small heat map img

HepG2
Snyder
CTCF
ENCSR000BIE
r=0.19

small heat map img

HepG2
Snyder
GABPA
ENCSR000BJK
r=0.18

small heat map img

HepG2
Snyder
TCF7L2
ENCSR000EVQ
r=0.17

small heat map img

HepG2
Snyder
SRF
ENCSR000BLV
r=0.17

small heat map img

HepG2
Snyder
ZBTB33
ENCSR000BHR
r=0.14

small heat map img

HepG2
Snyder
ZBTB33
ENCSR000BNA
r=0.13

small heat map img

HepG2
Snyder
FOXA2
ENCSR000BNI
r=0.12

small heat map img

HepG2
Snyder
EZH2
ENCSR000ARI
r=0.11

small heat map img

HepG2
Snyder
SP2
ENCSR000BOU
r=0.11

small heat map img

HepG2
Snyder
ZNF274
ENCSR000EVR
r=-0.01

small heat map img
10,000 randomly-selected peaks from a total of 14,628 (download )

K562 - Snyder - ENCSR000EGV

K562
Snyder
BHLHE40
ENCSR000EGV
r=1.00

small heat map img

K562
Snyder
MAX
ENCSR000EFV
r=0.72

small heat map img

K562
Snyder
MYC
ENCSR000EGS
r=0.69

small heat map img

K562
Snyder
MYC
ENCSR000EGJ
r=0.67

small heat map img

K562
Snyder
MYC
ENCSR000EZU
r=0.66

small heat map img

K562
Snyder
MYC
ENCSR000EZV
r=0.65

small heat map img

K562
Snyder
MYC
ENCSR000FAZ
r=0.64

small heat map img

K562
Snyder
MYC
ENCSR000FAG
r=0.64

small heat map img

K562
Snyder
MAX
ENCSR000FAE
r=0.63

small heat map img

K562
Snyder
JUN
ENCSR000EFS
r=0.63

small heat map img

K562
Snyder
RCOR1
ENCSR000EGG
r=0.62

small heat map img

K562
Snyder
JUND
ENCSR000EGN
r=0.62

small heat map img

K562
Snyder
MYC
ENCSR000DLZ
r=0.61

small heat map img

K562
Snyder
MXI1
ENCSR000EGZ
r=0.59

small heat map img

K562
Snyder
MAX
ENCSR000BLP
r=0.58

small heat map img

K562
Snyder
ZMIZ1
ENCSR000EFQ
r=0.58

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGB
r=0.58

small heat map img

K562
Snyder
CCNT2
ENCSR000DOA
r=0.57

small heat map img

K562
Snyder
JUN
ENCSR000FAH
r=0.57

small heat map img

K562
Snyder
JUN
ENCSR000EGH
r=0.57

small heat map img

K562
Snyder
TBL1XR1
ENCSR000EGA
r=0.56

small heat map img

K562
Snyder
IRF1
ENCSR000EGT
r=0.56

small heat map img

K562
Snyder
ATF1
ENCSR000DNZ
r=0.56

small heat map img

K562
Snyder
HMGN3
ENCSR000DOB
r=0.55

small heat map img

K562
Snyder
RCOR1
ENCSR000EGC
r=0.55

small heat map img

K562
Snyder
E2F6
ENCSR000EWJ
r=0.55

small heat map img

K562
Snyder
E2F4
ENCSR000EWL
r=0.54

small heat map img

K562
Snyder
USF1
ENCSR000BKT
r=0.54

small heat map img

K562
Snyder
STAT2
ENCSR000FAT
r=0.54

small heat map img

K562
Snyder
EP300
ENCSR000EGE
r=0.54

small heat map img

K562
Snyder
IRF1
ENCSR000EGK
r=0.54

small heat map img

K562
Snyder
STAT1
ENCSR000EHJ
r=0.53

small heat map img

K562
Snyder
IRF1
ENCSR000EGL
r=0.53

small heat map img

K562
Snyder
SETDB1
ENCSR000AUT
r=0.51

small heat map img

K562
Snyder
CBX3
ENCSR000BRT
r=0.50

small heat map img

K562
Snyder
SIRT6
ENCSR000DOH
r=0.50

small heat map img

K562
Snyder
GATA1
ENCSR000EFT
r=0.49

small heat map img

K562
Snyder
TRIM28
ENCSR000BRW
r=0.49

small heat map img

K562
Snyder
CREB1
ENCSR000BSO
r=0.49

small heat map img

K562
Snyder
ELK1
ENCSR000EFU
r=0.48

small heat map img

K562
Snyder
STAT1
ENCSR000FAU
r=0.48

small heat map img

K562
Snyder
HDAC1
ENCSR000AQF
r=0.48

small heat map img

K562
Snyder
STAT1
ENCSR000EHK
r=0.48

small heat map img

K562
Snyder
ARID3A
ENCSR000EFY
r=0.47

small heat map img

K562
Snyder
POLR2A
ENCSR000DLY
r=0.47

small heat map img

K562
Snyder
MAFK
ENCSR000EGX
r=0.47

small heat map img

K562
Snyder
STAT1
ENCSR000FAV
r=0.46

small heat map img

K562
Snyder
POLR2A
ENCSR000EHL
r=0.46

small heat map img

K562
Snyder
JUN
ENCSR000EZX
r=0.45

small heat map img

K562
Snyder
STAT2
ENCSR000FBC
r=0.45

small heat map img

K562
Snyder
POLR2A
ENCSR000FAJ
r=0.45

small heat map img

K562
Snyder
JUN
ENCSR000EZT
r=0.45

small heat map img

K562
Snyder
POLR2A
ENCSR000FAY
r=0.44

small heat map img

K562
Snyder
HCFC1
ENCSR000EFN
r=0.44

small heat map img

K562
Snyder
UBTF
ENCSR000EFZ
r=0.44

small heat map img

K562
Snyder
ATF3
ENCSR000BNU
r=0.44

small heat map img

K562
Snyder
POLR2A
ENCSR000FAX
r=0.44

small heat map img

K562
Snyder
POLR2A
ENCSR000FAW
r=0.44

small heat map img

K562
Snyder
HDAC2
ENCSR000AQG
r=0.44

small heat map img

K562
Snyder
CEBPD
ENCSR000BVY
r=0.44

small heat map img

K562
Snyder
USF2
ENCSR000EHG
r=0.44

small heat map img

K562
Snyder
CUX1
ENCSR000EFO
r=0.43

small heat map img

K562
Snyder
POLR2A
ENCSR000EHP
r=0.43

small heat map img

K562
Snyder
KDM5B
ENCSR000AQA
r=0.43

small heat map img

K562
Snyder
CHD7
ENCSR000AVD
r=0.43

small heat map img

K562
Snyder
RBBP5
ENCSR000AQI
r=0.43

small heat map img

K562
Snyder
EP300
ENCSR000EGY
r=0.42

small heat map img

K562
Snyder
SMC3
ENCSR000EGW
r=0.42

small heat map img

K562
Snyder
NR2F2
ENCSR000BRS
r=0.42

small heat map img

K562
Snyder
STAT5A
ENCSR000BRR
r=0.42

small heat map img

K562
Snyder
EP300
ENCSR000AQB
r=0.42

small heat map img

K562
Snyder
FOS
ENCSR000FAI
r=0.41

small heat map img

K562
Snyder
TEAD4
ENCSR000BRK
r=0.41

small heat map img

K562
Snyder
NFE2
ENCSR000FAF
r=0.41

small heat map img

K562
Snyder
ZNF384
ENCSR000EFP
r=0.41

small heat map img

K562
Snyder
KAT2B
ENCSR000ATZ
r=0.41

small heat map img

K562
Snyder
KDM1A
ENCSR000ATX
r=0.41

small heat map img

K562
Snyder
POLR2A
ENCSR000BMR
r=0.41

small heat map img

K562
Snyder
JUN
ENCSR000EZW
r=0.41

small heat map img

K562
Snyder
GATA2
ENCSR000EWG
r=0.41

small heat map img

K562
Snyder
SETDB1
ENCSR000EWI
r=0.40

small heat map img

K562
Snyder
UBTF
ENCSR000EFW
r=0.40

small heat map img

K562
Snyder
SAP30
ENCSR000AQJ
r=0.40

small heat map img

K562
Snyder
ATF3
ENCSR000DOG
r=0.40

small heat map img

K562
Snyder
TBP
ENCSR000EHA
r=0.40

small heat map img

K562
Snyder
GATA1
ENCSR000EWM
r=0.39

small heat map img

K562
Snyder
GTF2B
ENCSR000DOE
r=0.38

small heat map img

K562
Snyder
BACH1
ENCSR000EGD
r=0.38

small heat map img

K562
Snyder
EGR1
ENCSR000BNE
r=0.38

small heat map img

K562
Snyder
IRF1
ENCSR000EGU
r=0.37

small heat map img

K562
Snyder
YY1
ENCSR000BKU
r=0.37

small heat map img

K562
Snyder
HDAC6
ENCSR000ATJ
r=0.37

small heat map img

K562
Snyder
MAFF
ENCSR000EGI
r=0.36

small heat map img

K562
Snyder
NFYA
ENCSR000EGR
r=0.36

small heat map img

K562
Snyder
SMARCA4
ENCSR000EHO
r=0.36

small heat map img

K562
Snyder
TAL1
ENCSR000EHB
r=0.36

small heat map img

K562
Snyder
ELF1
ENCSR000BMD
r=0.36

small heat map img

K562
Snyder
ZNF143
ENCSR000EGP
r=0.36

small heat map img

K562
Snyder
NCOR1
ENCSR000ATY
r=0.36

small heat map img

K562
Snyder
TAF1
ENCSR000BKS
r=0.36

small heat map img

K562
Snyder
CEBPB
ENCSR000BRQ
r=0.35

small heat map img

K562
Snyder
PML
ENCSR000BQY
r=0.35

small heat map img

K562
Snyder
WHSC1
ENCSR000AVE
r=0.34

small heat map img

K562
Snyder
SMARCB1
ENCSR000EHN
r=0.34

small heat map img

K562
Snyder
E2F6
ENCSR000BLI
r=0.33

small heat map img

K562
Snyder
REST
ENCSR000BMW
r=0.33

small heat map img

K562
Snyder
PHF8
ENCSR000AQH
r=0.33

small heat map img

K562
Snyder
NRF1
ENCSR000EHH
r=0.32

small heat map img

K562
Snyder
ZNF263
ENCSR000EWN
r=0.32

small heat map img

K562
Snyder
HDAC2
ENCSR000BMG
r=0.32

small heat map img

K562
Snyder
ETS1
ENCSR000BKQ
r=0.31

small heat map img

K562
Snyder
CBX3
ENCSR000ATV
r=0.31

small heat map img

K562
Snyder
GATA2
ENCSR000BKM
r=0.31

small heat map img

K562
Snyder
GABPA
ENCSR000BLO
r=0.31

small heat map img

K562
Snyder
CTCF
ENCSR000EGM
r=0.31

small heat map img

K562
Snyder
GTF3C2
ENCSR000DOD
r=0.30

small heat map img

K562
Snyder
RNF2
ENCSR000AUA
r=0.30

small heat map img

K562
Snyder
RFX5
ENCSR000EGO
r=0.30

small heat map img

K562
Snyder
RAD21
ENCSR000FAD
r=0.30

small heat map img

K562
Snyder
CEBPB
ENCSR000EHE
r=0.30

small heat map img

K562
Snyder
YY1
ENCSR000EWF
r=0.30

small heat map img

K562
Snyder
ZNF274
ENCSR000EVX
r=0.29

small heat map img

K562
Snyder
SIRT6
ENCSR000AUB
r=0.29

small heat map img

K562
Snyder
TRIM28
ENCSR000EVY
r=0.27

small heat map img

K562
Snyder
SRF
ENCSR000BLK
r=0.27

small heat map img

K562
Snyder
BRF2
ENCSR000DOC
r=0.26

small heat map img

K562
Snyder
EZH2
ENCSR000AQE
r=0.26

small heat map img

K562
Snyder
CTCF
ENCSR000AKO
r=0.25

small heat map img

K562
Snyder
NFYB
ENCSR000EGQ
r=0.25

small heat map img

K562
Snyder
FOSL1
ENCSR000BMV
r=0.25

small heat map img

K562
Snyder
CHD4
ENCSR000ATL
r=0.24

small heat map img

K562
Snyder
CREBBP
ENCSR000ATT
r=0.24

small heat map img

K562
Snyder
CTCF
ENCSR000DMA
r=0.24

small heat map img

K562
Snyder
CHD1
ENCSR000AQD
r=0.24

small heat map img

K562
Snyder
CTCF
ENCSR000DWE
r=0.23

small heat map img

K562
Snyder
CTCF
ENCSR000BPJ
r=0.23

small heat map img

K562
Snyder
SIN3A
ENCSR000BLR
r=0.22

small heat map img

K562
Snyder
SPI1
ENCSR000BGW
r=0.22

small heat map img

K562
Snyder
SP1
ENCSR000BKO
r=0.22

small heat map img

K562
Snyder
ZBTB7A
ENCSR000BME
r=0.21

small heat map img

K562
Snyder
MEF2A
ENCSR000BNV
r=0.21

small heat map img

K562
Snyder
XRCC4
ENCSR000FAC
r=0.21

small heat map img

K562
Snyder
THAP1
ENCSR000BNN
r=0.21

small heat map img

K562
Snyder
CTCFL
ENCSR000BNK
r=0.20

small heat map img

K562
Snyder
RAD21
ENCSR000BKV
r=0.19

small heat map img

K562
Snyder
SUZ12
ENCSR000AUC
r=0.19

small heat map img

K562
Snyder
SETDB1
ENCSR000EWD
r=0.19

small heat map img

K562
Snyder
REST
ENCSR000ATM
r=0.17

small heat map img

K562
Snyder
SP2
ENCSR000BNL
r=0.17

small heat map img

K562
Snyder
TAF7
ENCSR000BNM
r=0.17

small heat map img

K562
Snyder
YY1
ENCSR000BMH
r=0.17

small heat map img

K562
Snyder
BDP1
ENCSR000DOK
r=0.16

small heat map img

K562
Snyder
ZBTB33
ENCSR000BKF
r=0.15

small heat map img

K562
Snyder
SIX5
ENCSR000BGX
r=0.15

small heat map img

K562
Snyder
SIX5
ENCSR000BNW
r=0.12

small heat map img

K562
Snyder
BRF1
ENCSR000DOJ
r=0.12

small heat map img

K562
Snyder
NR2C2
ENCSR000EWH
r=0.12

small heat map img

K562
Snyder
POLR3G
ENCSR000EHQ
r=0.11

small heat map img

K562
Snyder
POLR3A
ENCSR000DOI
r=0.09

small heat map img

K562
Snyder
CBX2
ENCSR000ATU
r=0.04

small heat map img

K562
Snyder
CBX8
ENCSR000ATW
r=0.04

small heat map img

K562
Snyder
ZNF274
ENCSR000EWE
r=-0.04

small heat map img
10,000 randomly-selected peaks from a total of 22,497 (download )

Notes

Peaks (left to right in the heatmap) are sorted by the descending order of [-log10(q-value), -log10(p-value), TF ChIP-seq signal].

legend

Average Profiles of Nucleosomes around the Summit of ChIP-seq Peaks

GM12878 - Snyder - ENCSR000DZJ

loading

K562 - Snyder - ENCSR000EGV

loading

Notes

Average nucleosome occupancy profiles in GM12878 and K562 cells are shown for the [-2 kb, +2 kb] window centered on the summits of the TF ChIP-seq peaks, separately for peaks that are proximal to an annotated transcription start site (red lines) and for peaks that are distal to all annotated transcription start sites (blue lines), as defined in the Histone section.

Help